CN113481113A

CN113481113A - Space breeding saccharomyces cerevisiae and application thereof in brewing wine

Info

Publication number: CN113481113A
Application number: CN202111039118.1A
Authority: CN
Inventors: 郑晓卫; 丁子元; 刘沛通; 商华; 都振江; 孙建平; 何少华; 范佳硕; 陈欣怡; 孙玉婷; 杨娟; 殷红; 颜国政
Original assignee: Cofco Great Wall Wine Ningxia Co ltd; Cofco Nutrition and Health Research Institute Co Ltd
Current assignee: Cofco Great Wall Wine Ningxia Co ltd; Cofco Nutrition and Health Research Institute Co Ltd
Priority date: 2021-09-06
Filing date: 2021-09-06
Publication date: 2021-10-08
Anticipated expiration: 2041-09-06
Also published as: CN113481113B

Abstract

The invention relates to the field of fermentation engineering, and discloses a space breeding saccharomyces cerevisiae and application thereof in brewing wine. The saccharomyces cerevisiae provided by the invention has the advantages of high fermentation speed, high acid yield and high yield of aroma substances such as esters during wine brewing, is particularly suitable for wine production by taking unbalanced grapes with high sugar content and low acidity ratio as raw materials, and can obviously improve the acidity of the wine, thereby improving the balance and further improving the quality of the wine.

Description

Space breeding saccharomyces cerevisiae and application thereof in brewing wine

Technical Field

The invention relates to the field of fermentation engineering, in particular to a space breeding saccharomyces cerevisiae and application thereof in brewing wine.

Background

Saccharomyces cerevisiae (Saccharomyces cerevisiae) Is an important strain adopted in the wine brewing process, can be fermented to produce alcohol, and can also produce various fermented aroma substances in the fermentation process, thereby endowing the wine with unique and complex flavor. The quality and flavor of the wine and the production process are all related to the adopted saccharomyces cerevisiae. However, most of the saccharomyces cerevisiae adopted in the wine production process in China is imported commercial active dry yeast, so that the wine production in China is greatly restricted by people, and the wine production in China is very unfavorable for the autonomous development of the industry. Moreover, China's wine grape producing area and foreign wine grape producing area are in the same placeThe aspects of the physical location, the climate, the soil condition and the like are different, although the imported yeast is improved and screened, the imported yeast still cannot be completely suitable for the brewing requirement of the wine in China, and the problem that the wine brewed by the grapes in different production areas tends to be homogeneous exists.

The Shanlang province is a vast country, has a plurality of grape producing areas suitable for planting wine grapes, wherein the east foot producing area of the Helan mountain is located in the intersection area of the Helan mountain impact inclined plain and the Huanghe impact plain, and has the characteristics of large day-night temperature difference, long sunshine time, excellent soil quality and the like suitable for planting the wine grapes. However, the summer climate of east foot producing areas of Helan mountain is hot, strong sunlight irradiation causes high sugar content and low acidity in grapes, and imbalance of sugar-acid ratio can cause adverse effect on the quality of wine. With the development of the wine industry in China, the development of a wine brewing process suitable for grapes with high sugar content and low acidity (unbalanced sugar-acid ratio) is urgently needed, and the quality of the wine brewed by the grapes is improved.

Disclosure of Invention

The invention aims to solve the problem that the quality of wine brewed by grapes with high sugar content and low acidity (unbalanced sugar-acid ratio) cannot be ensured by the existing commercial active dry yeast in the prior art, and provides a space breeding saccharomyces cerevisiae and application thereof in wine brewing. The saccharomyces cerevisiae provided by the invention has the advantages of high fermentation speed, high acid yield, outstanding aroma production characteristics and the like, and is particularly suitable for brewing high-quality wine from grapes with low acidity and high sugar degree.

In order to achieve the aim, the invention provides a strain of saccharomyces cerevisiae, wherein the saccharomyces cerevisiae has a preservation number of CGMCC No. 20563.

In a second aspect the present invention provides the use of a s.cerevisiae strain as described above in s.cerevisiae.

In a third aspect, the present invention provides a method for brewing wine, said method comprising inoculating the aforementioned saccharomyces cerevisiae into grape juice, and fermenting under brewing conditions to obtain wine.

A fourth aspect of the invention provides a wine prepared according to the method as described above.

Through the technical scheme, the invention can obtain the following beneficial effects:

(1) the saccharomyces cerevisiae provided by the invention has higher stress resistance, stronger tolerance in the aspects of ethanol, sugar, sulfur dioxide, pH, temperature and the like, can start fermentation at low temperature (such as 10 ℃), has wide application range and is beneficial to large-scale popularization and application;

(2) the saccharomyces cerevisiae provided by the invention has high fermentation speed, and the content of reducing sugar in the grape raw material can be less than 4g/L in 5-10 days; in addition, the yield of metabolites which are unfavorable to the flavor of the wine is low in the fermentation process, the yield of wine aroma substances such as total esters is high, the unique and outstanding aroma production performance is realized, and the method is suitable for brewing high-quality wine;

(3) the saccharomyces cerevisiae provided by the invention has high acid yield, and is particularly suitable for brewing grapes with low acidity and high sugar degree (such as grapes in eastern foot production areas of Helan mountain) for use;

(4) the saccharomyces cerevisiae provided by the invention can replace the existing strains for use, provides more strain selections for wine brewing, is beneficial to breaking the situation that the core strain adopted by the wine industry at present is limited by foreign monopoly, perfects the industrial chain and reduces the production cost.

Biological preservation

The invention provides saccharomyces cerevisiae (Saccharomyces cerevisiae) It has been preserved in China general microbiological culture Collection center (CGMCC) at 28.08.2020, with the address of No. 3 of Xilu No. 1 of Beijing, Chaoyang, and the preservation number of CGMCC No. 20563.

Drawings

FIG. 1 is a characteristic diagram of colonies obtained by culturing HTZL05-1 in YPD medium in example 1;

FIG. 2 is a characteristic diagram of colonies when HTZL05-1 was cultured in WL medium in example 1;

FIG. 3 is a graph of the ethanol tolerance of HTZL05-1 plotted in example 2;

FIG. 4 is a graph of the glucose tolerance of HTZL05-1 plotted in example 2;

FIG. 5 is a sulfur dioxide tolerance curve for HTZL05-1 plotted in example 2;

FIG. 6 is a pH tolerance curve for HTZL05-1 plotted in example 2;

FIG. 7 is a temperature tolerance plot of HTZL05-1 plotted in example 2;

FIG. 8 is a comparative plot of sensory evaluation results for Cabernet Sauvignon dry red wine produced at eastern foot of Helan mountain brewed using HTZL05-1 and XR in example 4.

Detailed Description

The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values. For ranges of values, between the endpoints of each of the ranges and the individual points, and between the individual points may be combined with each other to give one or more new ranges of values, and these ranges of values should be considered as specifically disclosed herein.

In the invention, under the condition that no special description is made, the saccharomyces cerevisiae (provided by the invention) and the saccharomyces cerevisiae HTZL05-1 both refer to the saccharomyces cerevisiae CGMCC No.20563 provided by the invention.

The mutagenesis screening is a common means for screening and breeding industrial strains, and the common mutagenesis modes mainly comprise physical mutagenesis and chemical mutagenesis, wherein the traditional physical mutagenesis modes comprise ultraviolet mutagenesis, ionizing radiation mutagenesis, ion implantation mutagenesis, laser mutagenesis, microwave mutagenesis and the like. However, for saccharomyces cerevisiae, the productivity of strains obtained by traditional mutation breeding technology reaches the bottleneck of mutation screening, and great breakthrough is difficult to obtain. With the improvement of the technological level, aerospace breeding (also called space breeding) is widely concerned in recent years, microorganisms can be induced by virtue of the microgravity effect, extreme temperature difference, high vacuum environment, high-energy particle radiation, weak magnetic field and the like in the space environment, the gene mutation frequency is obviously improved, and therefore the bottleneck of traditional mutation breeding is hopeful to be broken through, and the saccharomyces cerevisiae with more excellent performance is bred.

The inventors of the present inventionIn the research process, the saccharomyces cerevisiae strain obtained by separating and screening the naturally fermented grape mash is subjected to space mutagenesis and then screened to obtain a saccharomyces cerevisiae strain (Saccharomyces cerevisiae) The method has the characteristics of high fermentation speed, outstanding aroma production characteristics, high acid yield and the like, and is particularly suitable for brewing grape wine by adopting the wine grapes with low acidity and high sugar degree.

In the first aspect of the invention, the saccharomyces cerevisiae (Saccharomyces cerevisiae) The saccharomyces cerevisiae has a preservation number of CGMCC No. 20563.

In a second aspect the present invention provides the use of a s.cerevisiae as described above for the brewing of wine.

In a third aspect, the invention provides a method for brewing wine, which is characterized in that the method comprises inoculating the saccharomyces cerevisiae into grape juice and/or grape fruit pulp, and fermenting under brewing conditions to obtain the wine.

In the method of the present invention, the source of the raw material (wine grape) used for wine brewing is not particularly limited, and any grape juice or grape pulp made of a grape that can be used for wine brewing can be applied to the method of the present invention. The saccharomyces cerevisiae CGMCC No.20563 provided by the invention has high acid yield in the process of brewing the wine, so the saccharomyces cerevisiae CGMCC No.20563 is particularly suitable for brewing the wine (such as the grapes produced in eastern foot producing areas of Helan mountain) by taking the wine grapes with low acidity and high sugar degree as raw materials.

According to a preferred embodiment of the invention, the ratio between the content of reducing sugars and the total acid content used in the preparation of said must and/or must is greater than 15, more preferably between 30 and 50. Wherein, the reducing sugar content and the total acid content (calculated by tartaric acid) can be respectively measured by a Fehling reagent method and a titration method.

The method provided by the invention can be used for brewing wine by adopting any variety of wine-brewing grapes with the characteristics as raw materials. According to a preferred embodiment of the invention, wherein the grape variety used for preparing the grape juice and/or grape pulp is selected from at least one of Cabernet Sauvignon, Mantherland, Merlot, pindol, Sira, Heibono, Danfite, St.longissima, Guinea and Chardonnay. The grape variety used to prepare the must and/or pulp is, for example, grapes produced in the eastern foot of Helan mountain.

Any grape juice or grape pulp prepared from the wine grapes characterized as described above can be applied to the method provided by the present invention, and there is no particular limitation on the components therein. According to a preferred embodiment of the invention, the content of reducing sugar in the grape juice and/or grape pulp is 150-300g/L, and the total acid content is 4-10 g/L.

Preferably, the content of reducing sugar in the grape juice and/or the grape pulp is 190-290g/L, and the total acid content is 4.5-6.5 g/L.

More preferably, the content of reducing sugar in the grape juice and/or the grape pulp is 240-260g/L, and the total acid content is 5.5-6.5 g/L.

The grape juice or grape pulp used in the method provided by the invention can be prepared by any method existing in the field, and can also be directly purchased from commercial sources, as long as the raw materials meet the characteristics.

In the method provided by the present invention, the inoculation amount of the saccharomyces cerevisiae is not particularly limited, and may be adjusted according to actual conditions (for example, source of raw material, fermentation conditions, product requirements, etc.). According to a preferred embodiment of the present invention, wherein the inoculation amount of Saccharomyces cerevisiae is 10⁶-10¹⁰CFU/mL. The above-mentioned 10⁶-10¹⁰CFU/mL means that the content of the saccharomyces cerevisiae in a fermentation system after inoculation is 10⁶-10¹⁰Of the order of CFU/mL, e.g. 10⁶Levels on the order of CFU/mL represent 1X 10 or greater⁶CFU/mL to less than 1X 10⁷CFU/mL range, i.e., such as 1X 10⁶CFU/mL、5×10⁶CFU/mL、9.9×10⁶CFU/mL, etc. all belong to 10⁶An order of magnitude level of CFU/mL. Therefore, in the method provided by the invention, the inoculation amount of the saccharomyces cerevisiae is more than or equal to 1 × 10⁶CFU/mL to less than 1X 10¹¹CFU/mL.

Preferably, the inoculation amount of the saccharomyces cerevisiae is 10⁶-10⁸CFU/mL。

Any brewing conditions existing in the art suitable for wine brewing can be adapted to the method provided by the present invention. In order to further adapt to the characteristics of wine grapes with high sugar content and low acidity and improve the quality of wine, according to a preferred embodiment of the invention, the wine brewing conditions comprise: the temperature is 10-30 deg.C (preferably 12-28 deg.C, more preferably 25-28 deg.C), and the time is 5-10 days.

In the method provided by the invention, auxiliary materials, such as auxiliary materials for assisting yeast fermentation, can be added into the raw materials (namely grape juice and/or grape pulp) for brewing the wine for the purpose of improving the quality of the wine. According to a preferred embodiment of the invention, the grape juice and/or grape pulp further comprises at least one of pectinase, tannin, a nitrogen source, zymosan and oak product. The amount of the auxiliary materials used in the method provided by the invention is not particularly limited, and can be adjusted according to actual conditions (such as raw material characteristics, auxiliary material characteristics, product requirements and the like). The nitrogen source may be a nitrogen source commonly used in the art, such as peptone, yeast extract, and the like. Oak products are used to further improve the aroma and flavor of wine.

In the method of the present invention, the strain may be activated by a conventional method before fermentation. The conditions for activation may include: the temperature is 20-25 deg.C, and the time can be 20-30 h.

Any wine prepared by the above method provided by the present invention is within the scope of the present invention, and the specific components thereof are not particularly limited.

Since the components of the wine are related to wine brewing raw materials, wine brewing conditions and the like, the components of the wine obtained by adopting wine brewing grapes of different sources and varieties or wine brewing conditions are different.

According to a preferred embodiment of the present invention, the wine is brewed from the Cabernet Sauvignon grape juice with reducing sugar content of 240-250g/L and total acid content of 5.6-6.3g/L as raw material under the brewing conditions as described above, wherein the wine comprises: 12-16% of ethanol, 200-300 mg/L of higher alcohol, 60-80 mg/L of ester substance and 100-150mg/L of acid aroma substance. The "acid aroma substance" refers to an acid substance in a volatile aroma substance in wine, for example, caproic acid, caprylic acid, capric acid, isovaleric acid, etc.

Preferably, the wine contains: 12-16% of ethanol, 270 mg/L of higher alcohol 240-one, 70-80 mg/L of ester substances and 150mg/L of acid aroma substances 130-one.

The present invention will be described in detail below by way of examples. It should be understood that the following examples are only intended to further illustrate and explain the contents of the present invention by way of example, and are not intended to limit the present invention.

The chemicals used in the following examples were purchased from regular chemical suppliers and were chemically pure.

The media used in the following examples were prepared as follows:

WL medium:

4g/L of yeast extract powder, 0.0025g/L of ferric chloride, 50g/L of glucose, 0.0025g/L of manganese sulfate, 0.425g/L of potassium chloride, 0.022g/L of bromocresol green, 0.125g/L of calcium chloride, 0.125g/L of magnesium sulfate, 5g/L of acid hydrolyzed casein and 0.55g/L of potassium dihydrogen phosphate. Weighing the reagent according to the dosage, dissolving in deionized water, and adjusting pH to 5.5 +/-0.2 to obtain the liquid WL culture medium. Agar is added into the liquid WL culture medium according to the proportion of 20g/L, and the solid WL culture medium is obtained.

The obtained culture medium is sterilized by autoclaving at 121 deg.C for 15min, and cooling for use.

And (3) cooling the sterilized solid WL culture medium to be not too hot (about 50 ℃), pouring the solid WL culture medium into a plate culture dish, and cooling and solidifying to obtain a WL culture plate.

YPD medium:

10g/L of yeast extract, 20g/L of glucose and 20g/L of peptone. And weighing the reagent according to the dosage, dissolving in deionized water without adjusting the pH value to obtain the liquid YPD culture medium. Agar is added into the liquid YPD culture medium according to the proportion of 1.5g/L to obtain the solid YPD culture medium.

Cooling the sterilized solid YPD culture medium to a temperature of about 50 ℃, pouring the cooled solid YPD culture medium into a plate culture dish, and cooling and solidifying to obtain the YPD culture plate.

High acid yield screening culture medium:

10g/L of yeast extract, 20g/L of glucose, 20g/L of peptone and 1g/L of bromocresol green. Weighing the reagent according to the above dosage, dissolving in deionized water, and adjusting pH to 6 to obtain the liquid high-acid-yield screening culture medium. And adding agar into the liquid high-acid-yield screening culture medium according to the proportion of 1.5g/L to obtain the solid high-acid-yield screening culture medium.

And (3) cooling the sterilized solid high-yield acid screening culture medium to a temperature of about 50 ℃ without scalding hands, pouring the cooled solid high-yield acid screening culture medium into a plate culture dish, and cooling and solidifying to obtain the high-yield acid screening culture plate.

Grape juice simulated medium:

100g/L glucose, 100g/L fructose, 3g/L tartaric acid, 0.3 g/L citric acid, 0.3 g/L-malic acid, 0.3 g/L ammonium sulfate, 0.6 g/L asparagine, 4 mg/L manganese sulfate monohydrate, 4 mg/L zinc sulfate monohydrate, 2g/L potassium dihydrogen phosphate, 1 mg/L copper sulfate pentahydrate, 1 mg/L potassium iodide, 1 mg/L boric acid, (NH)₄)₆MO₇O₂₄·4H₂O 1 mg/L，COCl₂·6H₂0.4 mg/L of O, 0.3 g/L of inositol, 0.04 mg/L of biotin, 11 mg/L of vitamin B, 61 mg/L of vitamin B, 1 mg/L of nicotinic acid, 1 mg/L of pantothenic acid and 1 mg/L of p-aminobenzoic acid. Weighing the reagents according to the above dosage, dissolving in deionized water, adjusting pH to 5.8, filtering and sterilizing to obtain the grape juice simulated culture medium.

Example 1

This example illustrates the acquisition and preservation of Saccharomyces cerevisiae CGMCC No.20563 provided by the present invention.

(I) mutagenesis of strains

A strain of saccharomyces cerevisiae ZL05 (stored in a microbial strain bank of the technical center of the wine industry of the Chinese food nutrition and health research institute) is obtained by purifying and culturing wine grape mash naturally fermented in the east foot producing area of Helan mountain, and is carried in a new generation manned spacecraft test ship launched by a Changyang fifth-grade B carrier rocket in first flight for space mutagenesis.

(II) purifying and screening bacterial strain

The glycerol storage tube of the space mutagenic strain frozen at-80 ℃ is slowly frozen at 4 ℃, inoculated into a WL culture plate in an aseptic workbench in an inoculation amount of 2 volume percent, cultured for 24 hours at 30 ℃, single bacterial colonies are randomly selected, and streaked, separated and purified for 3 times to obtain a plurality of single pure bacterial colonies.

Primary screening: and (3) adopting a point-grafting method, sequentially point-grafting the bacterial colonies obtained by separation and purification in a high-acid-yield screening culture plate by using an aseptic inoculating needle, wherein three bacterial colonies are arranged in parallel. Culturing at 30 ℃ for 48h, observing yellow circles around colonies, and screening 11 strains with better acid-producing performance from the yellow circles, wherein the strains are numbered as HTZL05-1 to HTZL05-11 in sequence.

Re-screening: HTZL05-1 to HTZL05-11 were subcultured in YPD liquid medium, respectively, and the subcultured strains were cultured on YPD plates, and the strains were picked from the YPD plates, inoculated in YPD liquid medium (100 mL) in 250mL Erlenmeyer flasks, respectively, and cultured on a shaker (180 rpm, 30 ℃) for 24 hours to give seed solutions.

Seed solutions were prepared in the same manner using ZL05 and a conventional, imported, commercial Saccharomyces cerevisiae XR (available from Lamoth-Abiet, France) as controls.

500mL Erlenmeyer flask according to 10⁶CFU/mL inoculum seed solutions of HTZL05-1 to HTZL05-11, ZL05 and XR were inoculated into 300mL grape juice simulant medium at an initial total reducing sugar concentration of 200g/L, sealed with a fermentation plug, and incubated at 25 ℃ for 10-14 days (terminating the fermentation until the reducing sugar content is < 4 g/L). The malic acid content of the fermentation product was measured by liquid chromatography (Agilent HPLC 1200 series), and the results are detailed in Table 1.

As can be seen from the data in Table 1, the malic acid production was improved for most of the spatially mutagenized strains compared to the starting strain Saccharomyces cerevisiae ZL05, and also higher compared to the imported commercial strain XR. Among them, HTZL05-1 has the strongest acid production capacity, the acid production is 2.2 times of that of the ground strain, and the acid production is 2.1 times of that of the imported commercial strain XR.

(III) identification of the Strain

Morphological identification: the HTZL05-1 seed solution obtained in the test (II) is streaked on an YDP culture plate and a WL culture plate, cultured for 48h at 30 ℃, and the obtained colony characteristics are observed.

YPD culture plate culture results: the colony is milky white, round, shiny, neat in edge, sticky and easy to pick up (as shown in fig. 1).

WL culture plate culture results: the colonies were cream, spherical, smooth, opaque, and creamy (as shown in FIG. 2).

5.8 sequencing and identification of the S-ITS rDNA gene: the ITS rDNA amplification was performed according to the PCR system of Table 2 and the amplification procedure of Table 3, using the total DNA of strain HTZL05-1 (extracted using kit DP6201 from the company Baitach, according to the instructions).

The amplified product was sent to Biotechnology engineering (Shanghai) Co., Ltd for sequencing to obtain the ITS rDNA sequence (SEQ ID NO: 1) of the following strain HTZL 05-1:

CCCCGGTATGCTTAGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTGAACCACGGACCA

comparing the sequencing result with the data in NCBI to find the strains HTZL05-1 and NCBISaccharomyces cerevisiaeHas 100 percent of homology, combines the morphological identification result and the physiological and biochemical identification result, and comprehensively identifies the saccharomyces cerevisiae(s) ((Saccharomyces cerevisiae）。

(IV) Strain preservation

In 28 days 08-month-2020, Saccharomyces cerevisiae (Saccharomyces cerevisiae) Is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and has the address of No. 3 of Xilu No. 1 of Beijing north Chen in the area of rising and the preservation number of CGMCC No. 20563. The strain BC60260 in the deposit certificate is the strain HTZL05-1 screened in this example.

Example 2

This example is used to illustrate the stress resistance of Saccharomyces cerevisiae CGMCC No.20563 provided by the present invention.

HTZL05-1 seed solution was prepared as described in example 1. The seed solution was inoculated into YPD liquid medium containing different concentrations of stressors at an inoculum size of 3 vol% using a 96-well plate, and the stress resistance of the strain was examined.

(ii) ethanol tolerance

HTZL05-1 seed solution was inoculated into liquid YPD medium containing 6 vol%, 8 vol%, 10 vol%, 12 vol%, 14 vol%, 16 vol%, 18 vol% ethanol in 3 parallel wells (total volume per well of approximately 1 mL). Shaking and culturing at 30 deg.C and 200rpm overnight (about 18 h), and detecting OD with microplate reader_600nmTo determine ethanol tolerance of HTZL 05-1.

FIG. 3 is a graph of ethanol tolerance of HTZL05-1 plotted against test results.

(di) saccharide tolerance

HTZL05-1 seed solution was inoculated into liquid YPD medium containing glucose concentrations of 20 wt%, 30 wt%, 40 wt%, 50 wt%, and 60 wt%, respectively, in 3 parallel wells (total volume per well: about 1 mL). Shaking and culturing at 30 deg.C and 200rpm overnight (about 18 h), and detecting OD with microplate reader_600nmValue to determine sugar tolerance of HTZL 05-1.

FIG. 4 is a graph of the glucose tolerance of HTZL05-1 plotted against the test results.

(III) Sulfur dioxide tolerance

HTZL05-1 seed solution was inoculated into liquid YPD medium containing sulfur dioxide concentrations of 150mg/L, 200mg/L, 250mg/L, 300mg/L, and 350mg/L in 3 parallel wells (total volume per well: about 1 mL). Shaking and culturing at 30 deg.C and 200rpm overnight (about 18 h), and detecting OD with microplate reader_600nmTo determine the sulfur dioxide tolerance of HTZL 05-1.

FIG. 5 is a sulfur dioxide tolerance curve of HTZL05-1 plotted against test results.

(IV) pH tolerance (acid tolerance)

HTZL05-1 seed solution was inoculated into liquid YPD media at pH1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, respectively, in 3 parallel wells (total volume per well: about 1 mL) at each pH. Shaking and culturing at 30 deg.C and 200rpm overnight (about 18 h), and detecting OD with microplate reader_600nmTo determine the pH tolerance of HTZL 05-1.

FIG. 6 is a pH tolerance curve of HTZL05-1 plotted against test results.

(V) temperature resistance

HTZL05-1 seed solution was inoculated into liquid YPD medium in a total volume of about 1mL per well. Placing the inoculated 96-well plate at 10 deg.C, 13 deg.C, 18 deg.C, 32 deg.C, 40 deg.C, shaking and culturing at 200rpm overnight (about 18 h), performing 3-group parallel experiments at each temperature, and detecting OD by enzyme labeling instrument_600nmTo determine the temperature tolerance of HTZL 05-1.

FIG. 7 is a temperature tolerance curve of HTZL05-1 plotted against test results.

In FIGS. 3-7, OD_600nmValues (ordinate) greater than 20% indicate that the strain is normally growing and fermenting. According to the experimental results, the saccharomyces cerevisiae HTZL05-1 provided by the invention can normally grow and ferment under the conditions of 16 vol% ethanol, 600g/L glucose, pH1.5, 40 ℃ and 350mg/L sulfur dioxide, and the strain can start fermentation at low temperature (10 ℃). The strain has good stress resistance and wide application range for brewing raw materials and process conditions.

Example 3

This example is used to illustrate the fermentation effect and flavor-producing performance of the Saccharomyces cerevisiae CGMCC No.20563 provided by the present invention.

Seed liquor preparation for Saccharomyces cerevisiae HTZL05-1 and imported commercial Saccharomyces cerevisiae XR was performed as described in example 1.

500mL Erlenmeyer flask according to 10⁶And (3) inoculating the inoculation amount of CFU/mL, inoculating Saccharomyces cerevisiae HTZL05-1 and XR seed liquid into 300mL of grape juice simulation culture medium, sealing with fermentation plug liquid, and standing at 25 ℃ for fermentation culture for 10 days (until the content of reducing sugar is less than 4 g/L).

The contents of ethanol, fructose, glucose, glycerol, acetic acid, citric acid, malic acid and succinic acid in the fermentation product are detected by liquid chromatography (GB/T15038-2006), and the detection results are detailed in Table 4.

Volatile aroma substances in the fermentation product are detected by an Agilent 6890 Gas Chromatography (GC) and Agilent 5975 Mass Spectrometry (MS) combined instrument (Agilent, USA). The concrete conditions are as follows: capillary column HP-INNOWAX Polyethylene Glycol 60 m × 0.25 mm × 0.25 μm (J & W scientific, USA) carrier gas is high purity helium gas, and flow rate is 1 mL/min; manually injecting sample for headspace solid phase microextraction, adopting non-flow-dividing mode, inserting into sample inlet of gas chromatography, and thermally desorbing at 250 deg.C for 25 min. The temperature rising program of the column oven is as follows: keeping the temperature at 40 ℃ for 5min, then heating to 200 ℃ at the speed of 3 ℃/min, and keeping the temperature for 2 min. The interface temperature of the mass spectrum is 280 ℃, the temperature of the ion source is 230 ℃, the ionization mode EI is 70 ev, and the mass scanning range is 20-450 amu. The results are detailed in Table 5.

The higher alcohol content in table 5 refers to the total amount of alcohols shown in table 5, the ester content refers to the total amount of esters shown in table 5, and the acid content refers to the total amount of acids shown in table 5.

According to the data in tables 4 and 5, the content of acids in the fermentation process of the saccharomyces cerevisiae HTZL05-1 provided by the invention is higher, for example, the content of malic acid in the fermentation process is 2.1 times of that in the imported commercial saccharomyces cerevisiae XR, namely, the saccharomyces cerevisiae HTZL05-1 can obviously improve the acidity of wine and achieve a better acid increasing effect when the wine is brewed. Therefore, when brewing wine using grapes having high sugar content and low acidity as raw materials, the saccharomyces cerevisiae HTZL05-1 can obtain wine with higher quality than commercial strains.

As can be seen from the data in Table 5, the yield of higher alcohols, total esters, etc. in the aroma components in the wine brewed by HTZL05-1 is significantly higher than that of the commercial yeast, and the content of the higher alcohols does not exceed the highest value of the unpleasant flavor (400 mg/L), indicating that the strain has stronger aroma-producing ability. Especially, the grape wine brewed by HTZL05-1 has higher content of isoamyl acetate (with banana flavor), 2-phenylethyl acetate (with fruity flavor and rose fragrance) and ethyl lactate (with sweet pineapple and butterfat flavor), belongs to a strain with high ester yield, and can bring unique and rich flavor to the grape wine.

Moreover, from the experimental contents in the embodiment, it can be seen that the saccharomyces cerevisiae HTZL05-1 provided by the invention can rapidly complete the brewing process of the wine (dry red wine), so that a wine product meeting the national standard is obtained, the acidity of the wine can be effectively improved, the aroma richness and complexity of the wine are increased, and the quality of the wine is improved.

Example 4

This example illustrates the sensory evaluation of wine brewed with the Saccharomyces cerevisiae CGMCC No.20563 provided by the present invention.

The grape wine is brewed by adopting cabernet sauvignon grape juice produced in eastern foot producing areas of Helan mountain as a raw material. The preparation method of the cabernet sauvignon grape juice comprises the following steps: mechanically removing stalks of fructus Vitis Viniferae, crushing, juicing, pasteurizing (65 deg.C for 30 min), clarifying, collecting clear juice, and sampling, coating, and detecting to confirm that the grape juice is sterile. The detection proves that the content of reducing sugar (calculated by glucose) in the grape juice is 245.01 +/-4.17 g/L, and the total acid content (calculated by tartaric acid) is 5.94 +/-0.33 g/L.

Respectively mixing HTZL05-1 and XR seed solutions according to the ratio of 10⁶Inoculating the CFU/mL into 10L Cabernet Sauvignon grape juice, standing at 20 deg.C for 24h, and heating to 22 deg.C to obtain HTZL05-1 and XR activation solution.

The activated solutions of HTZL05-1 and XR were transferred to 100L fermentors (Huaqiang Zhongtian fluid devices, Beijing, Ltd., HCHT-100L. multidot.8) for fermentation under the following conditions: fermenting at 27 + -1 deg.C, and pressing the cap 3 times a day in the morning, at noon and at night to ensure soaking the leather cap. Ending the fermentation when the concentration of reducing sugar in the fermentation liquor is less than 4g/L to obtain the wine. The fermentation time for HTZL05-1 and XR was 10 days.

Ten appraisers are invited to perform sensory evaluation on the wine brewed by the method, and the invited ten appraisers comprise five national wine tasters from enterprises, professors and subsidiary professors engaged in wine research in two domestic colleges and universities, and masters and doctor researchers of three-position wine specialties. The sensory evaluation items included: clarity, color, purity, richness, elegance, acidity, sweetness, balance, sustainability, etc., and comprehensive evaluation according to the overall feeling of the wine, the total score corresponding to each sensory evaluation item is detailed in table 6. The average value of each rater score was taken, and the results are shown in detail in FIG. 8 (note: the score in FIG. 8 is a value normalized by 10 points as the total score).

According to the comparison of sensory evaluation scores in fig. 8, it can be seen that the cabernet sauvignon dry red wine brewed by using the HTZL05-1 has higher elegance and richness and better aroma characteristic, the acidity of the wine is obviously improved, the balance is improved, the defect of insufficient acidity of the dry red wine in eastern foot producing areas of the Heilan mountain is better improved, and the quality of the wine in the producing areas is improved.

The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.

Sequence listing

<110> Zhongliang Nutrition and health research institute Co., Ltd

Zhongliangcheng grape wine (Ningxia) Co., Ltd

<120> space breeding saccharomyces cerevisiae and application thereof in brewing wine

<130> YSI70320COF

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 584

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

ccccggtatg cttagtacgg cgagtgaagc ggcaaaagct caaatttgaa atctggtacc 60

ttcggtgccc gagttgtaat ttggagaggg caactttggg gccgttcctt gtctatgttc 120

cttggaacag gacgtcatag agggtgagaa tcccgtgtgg cgaggagtgc ggttctttgt 180

aaagtgcctt cgaagagtcg agttgtttgg gaatgcagct ctaagtgggt ggtaaattcc 240

atctaaagct aaatattggc gagagaccga tagcgaacaa gtacagtgat ggaaagatga 300

aaagaacttt gaaaagagag tgaaaaagta cgtgaaattg ttgaaaggga agggcatttg 360

atcagacatg gtgttttgtg ccctctgctc cttgtgggta ggggaatctc gcatttcact 420

gggccagcat cagttttggt ggcaggataa atccatagga atgtagcttg cctcggtaag 480

tattatagcc tgtgggaata ctgccagctg ggactgagga ctgcgacgta agtcaaggat 540

gctggcataa tggttatatg ccgcccgtct tgaaccacgg acca 584

Claims

1. A strain of Saccharomyces cerevisiaeSaccharomyces cerevisiae) The method is characterized in that the saccharomyces cerevisiae is the saccharomyces cerevisiae with the preservation number of CGMCC No. 20563.

2. Use of the saccharomyces cerevisiae according to claim 1 for brewing wine.

3. A method for brewing wine, comprising inoculating the Saccharomyces cerevisiae of claim 1 into grape juice and/or grape pulp, and fermenting under brewing conditions to obtain wine.

4. A process as claimed in claim 3, wherein the ratio between the reducing sugar content and the total acid content in the must and/or pulp is greater than 15.

5. A process as claimed in claim 3, wherein the ratio between the reducing sugar content and the total acid content in the must and/or pulp is between 30 and 50;

or the content of reducing sugar in the grape juice and/or the grape pulp is 150-300g/L, and the total acid content is 4-10 g/L.

6. The method according to any one of claims 3-5, wherein the grape variety used for preparing the grape juice and/or grape pulp is selected from at least one of Cabernet Sauvignon, Mantherland, Merlot, pindol, Sira, Heibeno, Danrphet, St.longissima, Guirenxiang and Chardonnay.

7. The method of claim 3, wherein the saccharomyces cerevisiae is inoculated in an amount of 10⁶-10¹⁰CFU/mL。

8. The method of claim 3, wherein the brewing conditions comprise: the temperature is 10-30 ℃ and the time is 5-10 days.

9. The method of claim 3, wherein the grape juice and/or grape pulp further comprises at least one of pectinase, tannin, a nitrogen source, zymosan, and an oak product.

10. Wine obtained by the process according to any one of claims 3 to 9.