CN113462788A - Gene detection primer and judgment method for judging boar semen quality - Google Patents
Gene detection primer and judgment method for judging boar semen quality Download PDFInfo
- Publication number
- CN113462788A CN113462788A CN202110907141.1A CN202110907141A CN113462788A CN 113462788 A CN113462788 A CN 113462788A CN 202110907141 A CN202110907141 A CN 202110907141A CN 113462788 A CN113462788 A CN 113462788A
- Authority
- CN
- China
- Prior art keywords
- gene
- sperm
- boar
- semen
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention belongs to the technical field of livestock molecular biology, and provides a gene detection primer and a gene detection method for judging the semen quality of a breeding boar and a screening method of candidate genes of the semen quality of the breeding boar. Candidate genes HSF1, VDAC2 and WIP1 for judging the quality of the boar semen are obtained by researching the correlation between the expression level of the candidate genes and the semen quality index. And designing detection primer pairs according to the information specificity of the candidate genes, namely a candidate gene HSF1 gene primer pair, a VDAC2 gene primer pair and a WIP1 gene primer pair. The method for judging the semen quality of the breeding boar according to the expression level of the candidate gene has the characteristics of rapidness, accuracy and high efficiency, and fills the blank in the field.
Description
Technical Field
The invention belongs to the technical field of livestock molecular biology, and relates to a gene detection primer and a judgment method for judging boar semen quality.
Background
The economic benefit of a pig farm depends to a large extent on the semen quality of boars. The reproductive capacity of boars not only directly determines the economic benefit of a pig farm, but also influences the reproductive performance of sows in a large-scale pig farm, the requirement of raw semen must meet the specified standard to ensure the normal conception effect of the sows, and the effect of boar semen is increasingly greater under the condition that artificial insemination and frozen semen are increasingly popularized in the current livestock and poultry production. The boar is raised to produce great amount of high quality semen and maintain its excellent genetic character. However, in actual production, boars have large difference in semen quality, and the utilization period is generally short, which is one of the important factors restricting the development of the pig industry.
The quality of the boar semen is selectively marked in the aspect of molecules, so that the boar semen with better quality can be more accurately and quickly screened, and a more favorable basis is provided for animal breeding selection. However, boar semen quality is controlled by multiple genes, boar semen quality of different breeds has larger difference, and suitable candidate genes with direct target indexes are screened from multiple genes with larger uncertainty, so that the research and report aiming at boar semen quality regulation genes, in particular to Hoshou black pigs of a special breed of Anhui, are not provided at present.
Disclosure of Invention
Aiming at the blank of the current boar semen quality regulation gene research, the method selects Hoshou black pigs of Anhui local pigs, Duroc and Changbai pigs of foreign lean type pigs as experimental animal models, and obtains the difference of the semen quality of the Hoshou black pigs and boars of other varieties and the correlation of the expression level of important genes on the basis of comparing the expression of the semen quality parameter indexes and the semen quality related genes of the Hoshou black pigs, the Changbai pigs and Duroc pigs, thereby obtaining a set of method for judging the semen quality of the boars, and providing reference for the subsequent variety breeding and the establishment of new strains.
The invention provides a gene detection primer for judging the semen quality of a breeding boar, which comprises the following sequences:
the forward sequence of the HSF1 gene primer pair is shown as SEQ ID NO.1, and the reverse primer sequence is shown as SEQ ID NO. 2;
the forward sequence of the VDAC2 gene primer pair is shown as SEQ ID NO.3, and the reverse primer sequence is shown as SEQ ID NO. 4;
the WIP1 gene primer pair has a forward sequence shown in SEQ ID NO.5 and a reverse primer sequence shown in SEQ ID NO. 6.
The invention also provides a method for judging the semen quality of the breeding boar, which takes the sperm density, the acrosome integrity, the sperm motility, the sperm DNA integrity and the sperm mitochondrial activity as the positive indexes of the semen quality.
The method for judging the semen quality of the boars takes the candidate gene HSF1 gene, the candidate gene VDAC2 and the candidate gene WIP1 gene as semen quality marker genes.
According to the method for judging boar semen quality, the sperm density and acrosome integrity are judged according to the expression level of the candidate gene HSF 1; the candidate gene HSF1 is positively correlated with sperm density and acrosome integrity rate; the higher the expression level of the candidate gene HSF1 gene is, the higher the sperm density and acrosome integrity are, and the higher the boar semen quality is under the same condition of other indexes.
According to the method for judging the quality of the boar semen, the sperm activity is judged according to the expression level of the candidate gene VDAC 2; the candidate gene VDAC2 gene is positively correlated with sperm motility; the higher the expression level of the candidate gene VDAC2 gene is, the stronger the sperm motility is, and the higher the boar semen quality is under the same condition of other indexes.
According to the method for judging the quality of the boar semen, the sperm activity and the sperm mitochondrial activity are judged according to the expression quantity of the candidate gene WIP 1; the candidate gene WIP1 gene is respectively in negative correlation with sperm motility and sperm mitochondrial activity; the lower the expression level of the candidate gene WIP1 gene is, the higher the sperm motility and the sperm mitochondrial activity are, and the higher the boar semen quality is under the same condition of other indexes; the boar is a Huoshou black pig.
According to the method for judging the quality of the boar semen, the sperm motility and the sperm DNA integrity rate are judged according to the expression quantity of the candidate gene WIP 1; the candidate gene WIP1 gene is respectively in negative correlation with sperm motility and sperm DNA integrity; the lower the expression level of the candidate gene WIP1 gene is, the higher the sperm motility and the DNA integrity rate are, and the higher the boar semen quality is under the same condition of other indexes; the boars are Duroc pigs and Changbai pigs.
According to the method for judging the quality of the semen of the breeding boar, the breeding boar is a Huoshou black pig; the positive indicator is sperm motility.
The boar semen quality judgment method comprises the following specific steps: (1) taking sperm density, acrosome integrity, sperm motility, sperm DNA integrity and sperm mitochondrial activity as positive indexes of semen quality; (2) taking a candidate gene HSF1 gene, a candidate gene VDAC2 and a candidate gene WIP1 gene as semen quality marker genes; (3) designing qRT-PCR primers according to candidate genes, wherein a forward sequence of an HSF1 gene primer pair is shown as SEQ ID NO.1, and a reverse primer sequence is shown as SEQ ID NO. 2; the forward sequence of the VDAC2 gene primer pair is shown as SEQ ID NO.3, and the reverse primer sequence is shown as SEQ ID NO. 4; the WIP1 gene primer pair has a forward sequence shown as SEQ ID NO.5 and a reverse primer sequence shown as SEQ ID NO. 6; (4) extracting the total RNA of the boar semen sperms; (5) reverse transcription of mRNA to obtain cDNA; (6) carrying out real-time fluorescent quantitative PCR amplification by using the PCR primer shown in the step (3); (7) comparing the gene expression level of the PCR amplification product obtained in the step (6); (8) the higher the candidate gene HSF1 gene and VDAC2 gene levels are, the lower the candidate gene WIP1 gene expression level is, the higher the semen quality of boars is.
The screening method of the boar semen quality candidate gene comprises the following specific steps: (1) selecting semen quality indexes: taking sperm motility, sperm density, sperm motility rate, acrosome integrity rate, sperm plasma membrane integrity rate, sperm aberration rate, sperm DNA integrity rate and sperm mitochondrial activity as semen quality evaluation indexes; (2) qRT-PCR primer design: selecting candidate gene HSF1, designing its forward sequence as shown in SEQ ID NO.1 and its reverse sequence as shown in SEQ ID NO. 2; a candidate gene VDAC2, wherein the forward sequence is designed to be shown as SEQ ID NO.3, and the reverse sequence is designed to be shown as SEQ ID NO. 4; a candidate gene WIP1, wherein the forward sequence is designed to be shown as SEQ ID NO.5, and the reverse sequence is designed to be shown as SEQ ID NO. 6; a candidate gene P34H, wherein the forward sequence is designed to be shown as SEQ ID NO.7, and the reverse sequence is designed to be shown as SEQ ID NO. 8; designing an internal reference primer GAPDH, wherein the forward sequence is shown as SEQ ID NO.9, and the reverse sequence is shown as SEQ ID NO. 10; (3) test animal selection: selecting Duroc, Hoshou black pig and Changbai pig boar with completely consistent feeding conditions, consistent age bracket and good health state, and collecting semen; (4) and (3) evaluating the semen quality: evaluating the semen of each boar in the step (3) according to the evaluation index in the step (1); (5) obtaining a cDNA template: carrying out sperm total RNA extraction on the semen obtained in the step (3), and carrying out reverse transcription; the reaction procedure is as follows: 15min at 42 ℃, 30min at 42 ℃ and 5min at 85 ℃; (6) qRT-PCR amplification, the reaction program is: fluorescence detection was performed 1 time at 94 ℃ for 30s, 94 ℃ for 5s, 61 ℃ for 35s, for 40 cycles, with 3 replicates per sample set; (7) data statistical analysis: analyzing the semen quality difference between varieties by adopting an SPSS 25.0 software single-factor variance analysis program, and analyzing the correlation between the semen quality parameter index and gene expression by adopting an SPSS 25.0 software Pearson correlation program; (8) selecting breeding boar semen quality candidate genes: according to the statistical result in the step (7), the expression of the HSF-1 gene is found to be in positive correlation with the sperm density and the sperm acrosome integrity rate of the Hoshou black pig; the expression of the VDAC2 gene is in positive correlation with the sperm motility of Hoshou black pigs and Duroc pigs; the expression of the WIP1 gene is obviously and negatively related to the sperm motility and the DNA integrity rate of the Duroc boar; the expression of the WIP1 gene is obviously and negatively related to the sperm motility and the sperm mitochondrial activity of the Hoshou black boar; the expression of the WIP1 gene is obviously negatively related to the sperm motility and the DNA integrity rate of the boars of the Changbai pig breeds; the P34H gene has no significant correlation with the semen quality of three breeds of boars; HSF-1, VDAC2 and WIP1 were selected as candidate genes for boar semen quality.
The sperm motility refers to the capability of sperm in semen to move forward and inseminate; the semen quality can be intuitively influenced by the height of the sperm, and the sperm motility is an important index influencing the semen quality and directly influences the fertilization capability in the research of the semen quality. The sperm density refers to the number of sperms contained in each milliliter of semen, the density directly influences the dilution multiple of the semen in use, and the semen with low sperm density can directly influence the conception rate of sows. The sperm motility rate refers to the percentage of the sperm in the semen which tends to move forward in the whole sperm; the sperm motility rate is closely related to the conception rate of the sow. Acrosomal integrity refers to the integrity of a secretory vesicle covering the front of the sperm; which directly affects the acrosome reaction during fertilization. The sperm plasma membrane integrity rate plays an important role in maintaining sperm metabolism, capacitation and the like, and indirectly influences the sperm fertilization capability. Sperm teratogenesis is the number of abnormal sperm present in the semen as a percentage of the total number of sperm detected. DNA integrity ratio refers to the absence of any form of chromosomal abnormalities or DNA damage in sperm; DNA damage it leads to decreased semen quality, early embryo development disorders, increased miscarriage and increased incidence of genetic defects in offspring. The sperm mitochondrial activity, also called mitochondrial integrity, is an index reflecting the energy state of mitochondria, and researches show that the sperm motility, the sperm fertilization rate and the mitochondrial membrane potential are in positive correlation, and the sperm with low mitochondrial activity does not have the function of fertilization.
The invention has the following advantages:
1. the invention provides a candidate gene for judging the semen quality of a breeding boar for the first time in the field, and provides a reliable molecular biology identification method for rapidly identifying the semen quality of the breeding boar.
2. The invention systematically researches the difference between the semen quality of the breeding boar for the first time, and adopts a qRT-PCR method to determine the correlation between the index and the candidate gene by combining a CSAS system and a statistical analysis method, thereby providing a good reference method for the semen quality judgment of the breeding boar, in particular to the Hoshou black boar which is a special boar of Anhui.
Drawings
FIG. 1 expression of boar semen HSF-1 gene of different breeds
FIG. 2 expression of boar semen VDAC2 gene of different breeds
FIG. 3 expression of boar semen P34H gene of different breeds
FIG. 4 expression of WIP1 gene in boar semen of different breeds
Detailed Description
The present invention will be specifically described with reference to the following examples.
Example 1:
materials and methods
(I) test materials
1. Test animal
The method comprises the steps of selecting 16 Duroc pigs, Hoshou black pigs and Changbai pig breeding boars with good health states and completely consistent feeding conditions from Haoyu animal husbandry Limited company in Anhui province, wherein the Duroc pigs, the Hoshou black pigs and the Changbai pig breeding boars are 6 Duroc pigs, 6 Houshou black pigs and 4 Changbai pigs respectively. Semen is collected once every 3 days for each boar, and semen is collected 5 times for each boar, and semen collection is continuously completed within 24 days. Diluting the collected semen by a semen diluent in the same proportion, sending the diluted semen back to a laboratory in an incubator, and preserving the diluted boar semen in the incubator at 17 ℃.
2. Main test equipment
TABLE 1 Main test Equipment
(II) test method
1. Semen dilution
50g of the diluted powder is respectively put into 1000mL of sterile distilled water with the temperature of 32-36 ℃ in advance for 30min, and the cover is added for stirring to ensure that the diluted powder is completely dissolved. According to sperm concentration and mass 1: 1, and adjusting the concentration to be in a proper range. Diluting the collected boar semen within 30min, wherein the temperature difference between the semen and the diluent is not more than 1 ℃, and storing the diluted semen in a 17 ℃ incubator. Storage of the sperm requires mixing every 12HR to prevent sperm sedimentation and death. The diluted semen is immediately sent to a laboratory for later use by a constant temperature refrigerator.
2. Semen quality detection
(1) Computer-assisted sperm analysis system (CASA) detection
Diluting the fetched fresh boar semen according to a certain proportion, and dripping 5 mu L of semen sample on a counting plate. Placing on a constant temperature stage at 37 deg.C, and detecting index parameters of sperm by computer aided sperm analysis system (CASA).
(2) And (3) detecting the integrity rate of the plasma membrane: the integrity of the sperm plasma membrane was determined using the Hypo-osmotic Swelling Test (HOST). The method comprises the following specific steps:
firstly, preparing a fructose-sodium citrate hypotonic solution: to a 1.5mL centrifuge tube was added 1mL of the previously prepared hypotonic solution. Then placing in a constant temperature water bath kettle at 37 ℃ for preheating for 5 min.
② adding 100 mu L of fresh semen into the preheated hypotonic solution. And then the mixture is slowly blown and beaten by a liquid transfer gun until the essence can be fully mixed with the hypotonic solution.
③ then putting the blown semen into a water bath kettle at 37 ℃ and incubating for 30 min.
Fourthly, taking out 10 mu L of semen sample and dripping the semen sample on the glass slide. The cover plate was air dried and placed on a 37 ℃ constant temperature stage.
Fifthly, calculating the tail bending condition of the sperm tail by utilizing confocal laser microscopy. At least 200 sperm were counted each time and repeated more than 5 times.
(3) And (3) detecting the integrity of the sperm acrosome: the detection method of FITC-PNA fluorescent staining comprises the following specific steps:
preparing FITC-PNA dye solution: 10L of semen sample was dropped onto the slide. The slides were fixed with 50% methanol solution for 10min while waiting for the slides to dry completely.
② taking out 10 mu L of prepared FITC-PNA dye solution by using a pipette gun and uniformly coating the prepared FITC-PNA dye solution on the whole glass slide. Incubate immediately at 37 ℃ in a dark environment for 30 min.
And thirdly, slowly washing the glass slide by 1x PBS for 5 times, and then placing the glass slide on a dark experiment table for natural drying.
And fourthly, dripping a plurality of brightener into the prepared sheet. Cover with a cover glass.
Counting the sperms with complete acrosome by laser confocal microscope. 200 sperm were counted under the mirror and repeated 5 more times. The head of the sperm can be observed to present green fluorescence under laser confocal to be an acrosomal intact type sperm. The head presents complete cap-shaped green fluorescence, the head is complete, and the fluorescent head with the incomplete top body has uneven cap shape, no light or incomplete head.
(4) And (3) detecting the sperm DNA integrity: and (5) detecting by an acridine orange staining method. Sperm DNA integrity rate ═ number of DNA intact sperm/total number of counted sperm × 100%. The method comprises the following specific steps:
preparing an acridine orange solution.
② the semen sample is washed 3 times with 1x PBS and the supernatant is discarded.
③ taking 10 mu L of boar semen to evenly smear and dry.
Preparing an absolute ethyl alcohol-glacial acetic acid (3:1) mixed solution, and fixing 10 mu L of the mixed solution on a glass slide by a pipette gun for 15min until the mixed solution is dried.
And fifthly, sucking a proper amount of acridine orange dye solution by using a liquid transfer gun under the condition of keeping out of the sun, and dripping the acridine orange dye solution on a cover glass until all sperms are soaked and dyed for 15 min.
Sixthly, slowly washing the glass plate by 1xPBS for 5 times, and covering a cover glass after the glass plate is completely dried.
Seventhly, counting and observing by using a confocal laser microscope. 200 sperm cells were counted and repeated 5 more times. Under a fluorescence microscope, four kinds of sperms with green fluorescence on the head can be observed as sperms with complete DNA.
(5) Sperm teratogenesis rate: the eosin staining solution for detecting the sperm teratogenesis rate comprises the following specific steps:
taking 10 mu L of semen by using a pipette, uniformly coating the semen on a slide, and naturally drying the semen.
Secondly, taking a proper amount of the prepared 50% methanol solution by using a liquid transfer gun, fixing for 5min, and naturally drying.
③ taking a proper amount of 0.5 percent eosin dye solution by a liquid transfer gun to dye for 5 min.
And fourthly, slowly washing the glass slide by using 1xPBS, and immediately observing under a microscope after the glass slide is air-dried. The sperm teratogenesis rate in 3-5 visual fields is randomly read by microscopic examination and then averaged.
(6) And (3) detecting the sperm mitochondrion activity rate: and jointly dyeing by using rhodamine (Rh123) and Propidium Iodide (PI) fluorescent dyes. The method comprises the following specific steps:
washing semen sample with 1xPBS solution for 3 times, and regulating sperm density to 2 × 104One per ml.
Secondly, preparing a constant-temperature water bath kettle with the temperature of 37 ℃, and putting the kettle in the kettle for preheating for 10 min.
③ to the pre-warmed semen sample, 1. mu.L of Rh123 and 1. mu.L of LPI were added, and incubated for 15min at 37 ℃ in the dark.
Fourthly, after preheating, 100 mu L of semen sample is taken out by a pipette and added into the semen sample, and the semen sample is incubated for 30min in a dark environment at 37 ℃.
Fifthly, 10 mu L of semen is taken and dripped on a glass slide to wait for drying. The cover plate is stored in dark.
Sixthly, performing microscopic examination under a laser confocal microscope, calculating the percentage of sperms with good mitochondrial membrane function,
200 sperm cells were counted and repeated 5 more times.
Seventhly, three types of sperms can be observed under the confocal laser:
(a) if the sperm shows red fluorescence at the nuclear position of the head, the sperm head is all red fluorescence because of the longer staining time.
(b) If the tail of the sperm shows a green fluorescent mark, the sperm is represented as sperm with good mitochondrial membrane function.
(c) Sperm with poor mitochondrial activity were observed if no green fluorescence at the sperm tail was observed.
3. Purification of sperm
(1) Two test tubes are prepared, 90% Percoll solution is prepared, 9mL of Percoll is put into a 15mL centrifuge tube, 1mL of 10xPBS is added, and the mixture is mixed for standby.
(2) Adding 45% Percoll, adding 90% solution into centrifuge tube, adding 1xPBS, and mixing.
(3) 3mL of the prepared 90% Percoll solution is taken as the lowest layer of a centrifuge tube, then 45% of the same amount of Percoll is slowly added into the middle layer, then fresh semen is centrifuged, supernatant is removed, precipitate is left, 2mL of 1xPBS is added into the centrifuge tube to be slowly beaten and uniformly mixed, then the uniformly mixed semen is added onto the 45% Percoll as the uppermost layer, then 300g is obtained, the speed increasing and reducing curve is 2, and centrifugation is carried out for 25min at 17 ℃. Then the sperm precipitated in the middle layer is taken out by a suction tube and sucked into a 1.5mL centrifuge tube by the suction tube, and is frozen and preserved at the temperature of minus 80 ℃.
4. Extraction of sperm Total RNA
(1) Sample treatment: the sperm was added to 1mL of Trizon Reagent and removed into a 1.5mL centrifuge tube and shaken.
(2) Standing at room temperature for 5min to completely separate protein nucleic acid complex.
(3) 200. mu.L of chloroform was added per 1mL of trizon Reagent. Shaking vigorously for 30s, and standing at room temperature for 5 min.
(4) Centrifuge at 12000rpm for 15min at 4 ℃. At this time, the centrifuged semen sample is divided into three layers, the upper water phase is RNA, 400 mu L of the upper water sample is absorbed by a pipette gun and then is put into an RNase-Free centrifuge tube.
(5) Add 400. mu.L 70% ethanol and shake slowly to mix well.
(6) Transferring the solution obtained in the step 5 to an adsorption column with a collecting pipe.
(7) Centrifuge at 12000rpm for 20 s. The waste liquid was decanted.
(8) 350 mu LBuffer RW1 was put into an adsorption column, centrifuged at 12000rpm for 20s, and the waste liquid was decanted and the adsorption column was returned to the collection tube.
(9) To 52 μ LRNase-Free Water was added 8ul 10xReactionbuffer and 20 μ LDNasel (1U/. mu.L). Mix well to 80. mu.L DNase I mixture.
(10) Adding 80 μ LDNase I mixed solution into adsorption column, and incubating at 20-30 deg.C for 15 min.
(11) Add 350. mu.L buffer RW1 to the adsorption column, centrifuge at 12000rpm for 1min, pour the waste liquid and return the adsorption column to the collection tube.
(12)500 μ LBuffer RW2 was centrifuged at 12000rpm for 20s in an adsorption column. The waste liquid was decanted.
(13) Step 11 is repeated.
(14) Centrifuge at 12000rpm for 2 min. And (4) pouring off the waste liquid, and waiting for air drying, wherein the effect of thorough air drying is to thoroughly remove the ethanol solution in the adsorption column. The ethanol solution remaining on the adsorption column affects the enzymatic reaction (enzyme digestion, PCR, etc.).
(15) The new RNase-free centrifuge tube is placed into an adsorption column, and 30-50 mu LRNase-FreeWater is added to the middle position of the adsorption column. Standing at normal temperature for 1min, and centrifuging at 12000pm for 1 min. The collected RNA solutions were stored at-70 ℃ ultra low temperature.
(16) And detecting the concentration and purity of the refined RNA, and immediately storing the qualified RNA in a refrigerator at the temperature of-80 ℃.
Determination of RNA concentration and purity
The OD260/OD280 ratio was between 1.8 and 2.0 as determined by RNA concentration analyzer analysis. This indicates that the RNA is pure and that the RNA extraction has been considered successful, and each experiment has to be repeated three times. After the RNA meets the experimental requirements, reverse transcription can be carried out or the RNA is stored in a freezer at the temperature of minus 80 ℃.
Design of PCR primers
Based on the sequences of the porcine HSF-1 (NM-001243819.1), Vdac2 (NM-214369.1), P34H (XM-021066401.1) and WIP1 (XM-005669013.3) genes in NCBI, corresponding primer sequences were designed using Premier5.0 software and then synthesized by Nikon Bio. The primer synthesis of the internal reference gene GAPDH is provided by Ninten Bio Inc.
TABLE 2 primer sequences for qRT-PCR
| Name of Gene | Primer sequence (5 '→ 3') |
| HSF1 | F：GCTCCTGGAGAACATCAAGA；R：TCTCTTGCTTCCCCTTCATC |
| VDAC2 | F：CATGGTTCAGCTGTCTTTGG；R：TGTAGCCCACTGCAAAGTTA |
| WIP1 | F：TAAGCCAGAACTTCCCAAGG；R：GGTCGTTTCCAAACTACACG |
| P34H | F：CAAGATCCGTGTGAATGCAG；R：TCAGCAGGAAAAGGATGGC |
| GAPDH | F：ATTCCACCCACGGCAAGTT；R：TTTGATGTTGGCGGGATCT |
Reverse transcription of mRNA to synthesize cDNA
The reverse transcription process of mRNA and the reaction system using RNA as a template are shown in Table 3 below.
TABLE 3 RNA reverse transcription reaction System
Reaction procedure: storing at 42 deg.C for 15min, 42 deg.C for 30min, and 85 deg.C for 5min and-20 deg.C.
8. Real-time fluorescent quantitative PCR amplification
The real-time fluorescent quantitative PCR (qRT-PCR) amplification process and reaction system are shown in Table 4 below.
TABLE 4 qRT-PCR amplification reaction System
Each sample was set to 3 replicates. The amplification procedure was: fluorescence detection was performed 1 time at 94 ℃ for 30s, 94 ℃ for 5s, and 61 ℃ for 35s for a total of 40 cycles.
Thirdly, data statistics and result analysis
After the data are processed briefly by Excle2007, the data in the paper are expressed by Mean + -standard deviation (Mean + -SD), the difference of semen quality between varieties is analyzed by adopting SPSS 25.0 software one-way variance analysis program, and the correlation between sperm parameter index and gene expression is analyzed by adopting SPSS 25.0 software Pearson correlation program. P < 0.05 indicates significant difference, and P < 0.01 indicates significant difference.
Determination result and difference analysis of pig semen character
1. Sperm motility difference analysis of pigs of the same breed
As can be seen from Table 5, the average sperm motility of the three boars is respectively Duroc 87.82%, Hoshou black pig 90.32% and Changbai 83.92%. The results showed that the viability of Hoshou black pig sperm was significantly higher than that of Duroc (P < 0.05). The sperm motility of the long white pigs is the weakest, the difference between the sperm motility of the Duroc and the long white pigs is obvious (P is less than 0.01), and the difference between the sperm motility of the Huoshou black pigs and the long white pigs is obvious (P is less than 0.01).
TABLE 5 differences in sperm motility of different breeds of boars
| Boar breed | Average sperm motility (%) |
| Huoshou black pig | 90.32±2.40Aa |
| Duroc | 87.82±1.39Ab |
| Changbai pig | 83.91±0.32Bc |
Note that different capital letters in the same column indicate significant differences (P < 0.01), different lower case letters indicate significant differences (P < 0.05), and the following table is the same.
2. Sperm motility rate difference analysis of pigs among different breeds
As can be seen from Table 6, the average sperm motility rates of the three types of boars were 95.25% for Duroc, 95.21% for Hoshou black boar and 90.26% for Changbai boar, and the results showed that the sperm motility rates of Duroc boars were the highest and the sperm motility rates of Changbai boars were the lowest. The difference between the sperm motility rates of Duroc and Huoshou black pigs is not obvious, the difference between the sperm motility rates of Duroc boars and the sperm motility rates of Changbai boars is extremely obvious (P is less than 0.01), and the difference between the sperm motility rates of Huoshou black boars and the sperm rates of Changbai boars is extremely obvious (P is less than 0.01).
TABLE 6 differences in sperm motility of boars of different breeds
| Boar breed | Average sperm motility (%) |
| Duroc | 95.25±1.28Aa |
| Huoshou black pig | 95.21±2.32Aa |
| Changbai pig | 90.26±3.27Bb |
3. Sperm density differential analysis of pigs between different breeds
As can be seen from Table 7, the average sperm density of the three boars was 1.04 (hundred million/ml), 0.96 (hundred million/ml) for Hoshou black pigs, and 0.89 (hundred million/ml) for Changbai. Wherein, the difference between the sperm density of Duroc and that of Hoshou black pigs is not obvious and is obviously higher than that of Changbai pigs (P is less than 0.05). The sperm density of the Huoshou black pigs is higher than that of the Changbai pigs, and the difference is not obvious.
TABLE 7 differences in sperm density for different breeds of boars
| Boar breed | Average sperm density (Yi/ml) |
| Duroc | 1.04±0.13a |
| Huoshou blackPig | 0.96±0.04ab |
| Changbai pig | 0.89±0.01b |
4. Analysis of difference in linear movement rate of sperm among different breeds of pigs
As is clear from Table 8, the average linear motion rates of sperm of Duroc, Huoshou black pig and Long and white pig were 23.80 (. mu.m/s), 23.50 (. mu.m/s) and 23.50 (. mu.m/s) in this order. The difference of the average linear motion rates of sperms of the Duroc boar and the Hosho black boar is not obvious, the difference of the average linear motion rates of the sperms of the Duroc boar and the Changbai boar is not obvious, and the difference of the average linear motion rates of the sperms of the Hosho black boar and the Changbai boar is not obvious.
TABLE 8 differences in mean linear movement rates of boar sperm of different breeds
| Boar breed | Average linear motion velocity (μm/s) |
| Duroc | 23.80±2.22 |
| Huoshou black pig | 23.50±3.02 |
| Changbai pig | 23.50±1.01 |
5. Analysis of difference in sperm curvilinear motion rate among different breeds
As can be seen from Table 9, the average sperm mean curve movement rates of the three boars were Duroc 58.50(μm/s), Hoogel black pig 53.56(μm/s), and Changbai 55.67(μm/s). Wherein the average curvilinear motion rate of Duroc sperms is obviously different from that of the Huoshou black pigs (P is less than 0.05), the difference between Duroc and the long white pigs is not obvious, and the difference between the Huoshou black pigs and the long white pigs is not obvious. Average curve movement rate of sperm was lowest in Hoshou black pigs.
TABLE 9 difference in mean curve movement rate of sperm from different breeds of boars
| Boar breed | Mean rate of curvilinear motion (μm/s) |
| Duroc | 58.50±2.98a |
| Changbai pig | 55.67±3.94a |
| Huoshou black pig | 53.56±2.61b |
6. Analysis of sperm pathway velocity differences among pigs of different breeds
As can be seen from Table 10, the average sperm path velocities of the three boars are respectively Duroc 41.36(μm/s), Hold black pig 36.08(μm/s) and Changbai 39.36(μm/s), wherein the average sperm path velocity of Duroc is the highest, and the difference between Duroc and Changbai pig sperm average path velocities is very significant (P < 0.01), Duroc and Changbai pig sperm average path velocity is not significant, and Hold black and Changbai pig sperm average path velocity is significant (P < 0.05).
TABLE 10 differences in mean pathway velocity of sperm from different boars
7. Sperm whipping frequency difference analysis of pigs between different breeds
As can be seen from table 11, the average whipping frequency of the sperms of the duroc boar, the hough black boar and the long white boar is 0.79(BCF), 0.82(BCF) and 0.77(BCF) in sequence, the difference between the average whipping frequency of the sperms of the duroc boar and the hough black boar is not significant, the difference between the average whipping frequency of the sperms of the duroc boar and the long white boar is not significant, and the difference between the average whipping frequency of the sperms of the hough black boar and the long white boar is not significant.
TABLE 11 differences in mean whipping frequency of sperm from different breeds of boars
| Boar breed | Average whipping frequency (BCF) |
| Huoshou black pig | 0.82±0.064 |
| Duroc | 0.79±0.010 |
| Changbai pig | 0.77±0.02 |
8. Analysis of sperm aberration rate differences among pigs of different breeds
As can be seen from Table 12, the average sperm teratogenesis rates of the three boars are respectively 2.99% of Duroc, 2.73% of Hoshou black pig and 3.21% of Changbai, wherein there is no significant difference among the sperm teratogenesis rates of Duroc, Hoshou black pig and Changbai pig.
TABLE 12 difference in sperm teratogenicity rate of boars of different breeds
| Boar breed | Rate of deformity |
| Duroc | 2.99％±0.002 |
| Huoshou black pig | 2.73％±0.008 |
| Changbai pig | 3.21％±0.009 |
9. Analysis of differences in sperm plasma membrane integrity rates between different breeds of swine
As can be seen from Table 13, the plasma membrane integrity rates of the sperms of Duroc, Hoshou black pig and Changbai pig are 91.05%, 93.85% and 79.97% in sequence, the difference between the plasma membrane integrity rates of the sperms of Duroc and Hoshou black pig is significant (P < 0.05), the difference between the plasma membrane integrity rates of the sperms of Duroc and Changbai pig is significant (P < 0.01), and the difference between the plasma membrane integrity rates of the sperms of Hoshou black pig and Changbai pig is significant (P < 0.01).
TABLE 13 differences in plasma membrane integrity rates of different breeds of boars
| Boar breed | Integrity rate of plasma membrane |
| Huoshou black pig | 93.85％±0.017Aa |
| Duroc | 91.05％±0.009Ab |
| Changbai pig | 79.97％±0.037Bc |
10. Differential analysis of sperm DNA integrity rates in pigs of different breeds
As shown in Table 14, the sperm DNA integrity rates of Duroc, Hold black pig and Long white pig were 91.43%, 93.99% and 86.9% in sequence, the difference between sperm DNA integrity rates of Duroc and Hold black pig was significant (P < 0.05), the difference between sperm DNA integrity rates of Duroc and Long white pig was significant (P < 0.01), and the difference between sperm DNA integrity rates of Hold black pig and Long white pig was significant (P < 0.01).
TABLE 14 comparison of sperm DNA integrity rates of different breeds of boars
| Boar breed | DNA integrity ratio |
| Huoshou black pig | 93.99％±0.02Aa |
| Duroc | 91.43％±0.01Ab |
| Changbai pig | 86.9％±0.03Bc |
11. Differential analysis of sperm mitochondrial Activity in pigs between breeds
As shown in table 15, the sperm mitochondrial activities of duroc, hough black pig and long white pig were 94.73%, 93.33% and 90.18% in sequence, the sperm mitochondrial activities of duroc and hough black pig were significantly different (P < 0.05), the sperm mitochondrial activities of duroc and long white pig were significantly different (P < 0.01), and the sperm mitochondrial activities of hough black pig and long white pig were significantly different (P < 0.01).
TABLE 15 comparison of sperm mitochondrial Activity between boars of different breeds
12. Analysis of differences in sperm acrosome integrity rates between different breeds of swine
From Table 16, it is known that the sperm acrosome integrity rates of Duroc, Hoshou black pig and Changbai pig are 93.27%, 93.33% and 89.19% in sequence, the difference between the sperm acrosome integrity rates of Duroc and Hoshou black pig is not significant, the difference between the sperm acrosome integrity rates of Duroc and Changbai pig is significant (P < 0.01), and the difference between the sperm acrosome integrity rates of Hoshou black pig and Changbai pig is significant (P < 0.01).
TABLE 16 comparison of sperm acrosome integrity rates of boars of different breeds
| Boar breed | Percentage of sperm acrosome integrity |
| Duroc | 93.33％±0.013Aa |
| Huoshou black pig | 93.27％±0.020Aa |
| Changbai pig | 89.19％±0.015Bb |
(II) variety difference analysis of boar semen quality related gene expression
1. Differential expression analysis of HSF-1 Gene
As can be seen from FIG. 1, the Duroc HSF-1 gene expression level is very different from that of the black Hoshou pigs and the long white pigs (P is less than 0.01), and the expression difference is not significant in the semen of the black Hoshou pigs and the long white pigs.
2. Differential expression analysis of VDAC2 Gene
As can be seen from FIG. 2, the expression level of VDAC2 gene of Hoshou black pig is significantly different from that of Duroc (P < 0.05), and is higher than that of Changbai pig (P < 0.01); the expression level of the Duroc VDAC2 gene is very different from that of the long white pig (P is less than 0.01).
3. Differential analysis of expression of P34H Gene
As can be seen from FIG. 3, the expression level of the gene P34H in Hoshou black pigs was higher than that in Duroc (P > 0.05), and both Hoshou black pigs and Duroc were higher than that in Changbai pigs (P < 0.01).
4. Differential expression analysis of WIP1 Gene
As can be seen from FIG. 4, the difference between the WIP1 gene of the semen of Duroc pigs and that of Hooke black pigs is not significant, the difference between the WIP1 gene of the semen of Duroc pigs and that of Changbai pigs is significant (P < 0.01), and the difference between the WIP1 gene of the semen of Hooke black pigs and that of Changbai pigs is significant (P < 0.01).
(III) correlation between semen quality and genes of boars of different breeds
Relevant information of preselected genes WIP1, VDAC2, P34H and HSF-1 is found through an NCBI database, gene primers are designed, real-time fluorescence quantitative PCR (qRT-PCR) detection is carried out on the extracted sperm RNA of the Duroc boar, and as can be seen from Table 17, the expression levels of the HSF-1 and P34H genes have no significant correlation with the quality of Duroc semen, and the VDAC2 gene has significant positive correlation with sperm motility. WIP1 shows significant negative correlation with sperm motility and sperm DNA integrity, the higher the expression level of WIP1 gene is, the lower the sperm motility of Duroc boar is, and the process of repairing DNA damage is negatively regulated. There was no significant correlation with other morphological parameters.
TABLE 17 correlation between Duroc boar semen quality and genes
Note that the differences were significant (P < 0.01), and the differences were significant (P < 0.05), as shown below.
As can be seen from Table 18, the HSF-1 gene is positively correlated with Hoshou black pig sperm density and acrosome integrity; the higher the expression of HSF-1 gene, the higher the density of Hoshou black pig sperms and the function of positively regulating and controlling the integrity of sperm acrosomes. The expression of the P34H gene has no obvious correlation with the semen quality of Hoshou black pigs, the expression of the WIP1 gene has obvious negative correlation with sperm motility, whipping speed and mitochondrial activity, and simultaneously has negative correlation with the DNA integrity of the sperm but has no obvious correlation.
TABLE 18 correlation between boar semen quality and genes for Hoshou Black boars
As can be seen from Table 19, the correlation between the expression levels of the HSF-1, P34H and VDAC2 genes and the semen quality of the boars is not significant. The expression of WIP1 gene showed a very significant correlation with sperm motility and DNA integrity, and no significant correlation with other morphological parameters.
TABLE 19 correlation between sperm quality and genes of Changbai boars
It will be understood that the above-described embodiments are merely illustrative of the principles of the invention, which is not limited thereto, and that various modifications and changes can be made by those skilled in the art without departing from the spirit of the invention, which also falls within the scope of the invention.
Sequence listing
<110> agriculture university of Anhui
<120> gene detection primer and judgment method for judging boar semen quality
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gctcctggag aacatcaaga 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tctcttgctt ccccttcatc 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
catggttcag ctgtctttgg 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tgtagcccac tgcaaagtta 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
taagccagaa cttcccaagg 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggtcgtttcc aaactacacg 20
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
attccaccca cggcaagtt 19
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tttgatgttg gcgggatct 19
Claims (10)
1. A gene detection primer for judging the semen quality of a breeding boar is characterized by comprising the following sequences:
the forward sequence of the HSF1 gene primer pair is shown as SEQ ID NO.1, and the reverse primer sequence is shown as SEQ ID NO. 2;
the forward sequence of the VDAC2 gene primer pair is shown as SEQ ID NO.3, and the reverse primer sequence is shown as SEQ ID NO. 4;
the WIP1 gene primer pair has a forward sequence shown in SEQ ID NO.5 and a reverse primer sequence shown in SEQ ID NO. 6.
2. A method for judging the semen quality of a breeding boar is characterized by comprising the following steps: the sperm density, acrosome integrity, sperm motility, sperm DNA integrity and sperm mitochondrial activity are taken as the positive indexes of the sperm quality.
3. The method for judging the semen quality of the breeding boar as claimed in claim 2, wherein: the method takes a candidate gene HSF1 gene, a candidate gene VDAC2 and a candidate gene WIP1 gene as semen quality marker genes.
4. The method for judging the semen quality of a breeding boar as claimed in claim 3, wherein: judging the sperm density and the acrosome integrity rate according to the expression level of the candidate gene HSF 1; the candidate gene HSF1 is positively correlated with sperm density and acrosome integrity rate; the higher the expression level of the candidate gene HSF1 gene is, the higher the sperm density and acrosome integrity are, and the higher the boar semen quality is under the same condition of other indexes.
5. The method for judging the semen quality of a breeding boar as claimed in claim 3, wherein: judging the sperm motility according to the expression level of the candidate gene VDAC 2; the candidate gene VDAC2 gene is positively correlated with sperm motility; the higher the expression level of the candidate gene VDAC2 gene is, the stronger the sperm motility is, and the higher the boar semen quality is under the same condition of other indexes.
6. The method for judging the semen quality of a breeding boar as claimed in claim 3, wherein: judging the sperm motility and the sperm mitochondrial activity according to the expression quantity of the candidate gene WIP1 gene; the candidate gene WIP1 gene is respectively in negative correlation with sperm motility and sperm mitochondrial activity; the lower the expression level of the candidate gene WIP1 gene is, the higher the sperm motility and the sperm mitochondrial activity are, and the higher the boar semen quality is under the same condition of other indexes; the boar is a Huoshou black pig.
7. The method for judging the semen quality of a breeding boar as claimed in claim 3, wherein: judging sperm motility and sperm DNA integrity rate according to the expression quantity of the candidate gene WIP 1; the candidate gene WIP1 gene is respectively in negative correlation with sperm motility and sperm DNA integrity; the lower the expression level of the candidate gene WIP1 gene is, the higher the sperm motility and the DNA integrity rate are, and the higher the boar semen quality is under the same condition of other indexes; the boars are Duroc pigs and Changbai pigs.
8. The method for judging the semen quality of the breeding boar as claimed in claim 2 or 5, wherein: the breeding boar is a Huoshou black pig; the positive indicator is sperm motility.
9. The method for judging the semen quality of the breeding boar as claimed in any one of claims 2 to 8, which is characterized by comprising the following specific steps: (1) taking sperm density, acrosome integrity, sperm motility, sperm DNA integrity and sperm mitochondrial activity as positive indexes of semen quality; (2) taking a candidate gene HSF1 gene, a candidate gene VDAC2 and a candidate gene WIP1 gene as semen quality marker genes; (3) designing PCR primers according to the candidate genes, wherein the forward sequence of the HSF1 gene primer pair is shown as SEQ ID NO.1, and the reverse primer sequence is shown as SEQ ID NO. 2; the forward sequence of the VDAC2 gene primer pair is shown as SEQ ID NO.3, and the reverse primer sequence is shown as SEQ ID NO. 4; the WIP1 gene primer pair has a forward sequence shown as SEQ ID NO.5 and a reverse primer sequence shown as SEQ ID NO. 6; (4) extracting the total RNA of sperms in the semen of the breeding boar; (5) reverse transcription of mRNA to obtain cDNA; (6) carrying out real-time fluorescent quantitative PCR amplification by using the PCR primer shown in the step (3); (7) comparing the gene expression level of the PCR amplification product obtained in the step (6); (8) the higher the candidate gene HSF1 gene and VDAC2 gene levels are, the higher the semen quality of the boar with the lower candidate gene WIP1 gene expression level is.
10. A screening method of breeding boar semen quality candidate genes is characterized by comprising the following specific steps: (1) selecting semen quality indexes: taking sperm motility, sperm density, sperm motility rate, acrosome integrity rate, sperm plasma membrane integrity rate, sperm aberration rate, sperm DNA integrity rate and sperm mitochondrial activity as semen quality evaluation indexes; (2) qRT-PCR primer design: selecting candidate gene HSF1, designing its forward sequence as shown in SEQ ID NO.1 and its reverse sequence as shown in SEQ ID NO. 2; a candidate gene VDAC2, wherein the forward sequence is designed to be shown as SEQ ID NO.3, and the reverse sequence is designed to be shown as SEQ ID NO. 4; a candidate gene WIP1, wherein the forward sequence is designed to be shown as SEQ ID NO.5, and the reverse sequence is designed to be shown as SEQ ID NO. 6; a candidate gene P34H, wherein the forward sequence is designed to be shown as SEQ ID NO.7, and the reverse sequence is designed to be shown as SEQ ID NO. 8; designing an internal reference primer GAPDH, wherein the forward sequence is shown as SEQ ID NO.9, and the reverse sequence is shown as SEQ ID NO. 10; (3) test animal selection: selecting Duroc, Hoshou black pig and Changbai pig boar with completely consistent feeding conditions, consistent age bracket and good health state, and collecting semen; (4) and (3) evaluating the semen quality: evaluating the semen of each boar in the step (3) according to the evaluation index in the step (1); (5) obtaining a cDNA template: carrying out sperm total RNA extraction on the semen obtained in the step (3), and carrying out reverse transcription; the reaction procedure is as follows: 15min at 42 ℃, 30min at 42 ℃ and 5min at 85 ℃; (6) qRT-PCR amplification, the reaction program is: fluorescence detection was performed 1 time at 94 ℃ for 30s, 94 ℃ for 5s, 61 ℃ for 35s, for 40 cycles, with 3 replicates per sample set; (7) data statistical analysis: analyzing the difference of the semen quality related indexes among the varieties by adopting an SPSS 25.0 software single-factor variance analysis program, and analyzing the correlation of the semen quality parameter indexes and gene expression by adopting an SPSS 25.0 software Pearson related program; (8) selecting breeding boar semen quality candidate genes: according to the statistical result in the step (7), the expression of the HSF-1 gene is found to be in obvious positive correlation with the sperm density and acrosome integrity rate of the Hoshou black pig; the expression of the VDAC2 gene is in positive correlation with the sperm motility of Hoshou black pigs and Duroc pigs; the expression of the WIP1 gene is obviously and negatively related to the sperm motility and the DNA integrity rate of the Duroc boar; the expression of the WIP1 gene is obviously and negatively related to the sperm motility and the sperm mitochondrial activity of the Hoshou black boar; the expression of the WIP1 gene is obviously negatively related to the sperm motility and the DNA integrity rate of the boars of the Changbai pig breeds; the P34H gene has no significant correlation with the semen quality of three breeds of boars; HSF-1, VDAC2 and WIP1 were selected as candidate genes for boar semen quality.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110907141.1A CN113462788A (en) | 2021-08-09 | 2021-08-09 | Gene detection primer and judgment method for judging boar semen quality |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110907141.1A CN113462788A (en) | 2021-08-09 | 2021-08-09 | Gene detection primer and judgment method for judging boar semen quality |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113462788A true CN113462788A (en) | 2021-10-01 |
Family
ID=77867609
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110907141.1A Pending CN113462788A (en) | 2021-08-09 | 2021-08-09 | Gene detection primer and judgment method for judging boar semen quality |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113462788A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116004855A (en) * | 2023-01-17 | 2023-04-25 | 佛山科学技术学院 | Molecular marker related to mitochondrial membrane potential of Duroc pig sperm and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2031456A (en) * | 1978-09-01 | 1980-04-23 | Fossum K | Method for increasing fertility of mammals |
| CN106755299A (en) * | 2016-11-15 | 2017-05-31 | 安徽农业大学 | A kind of primer pair and method for comparing weanling pig intestine immunity developmental potency |
| CN113215277A (en) * | 2021-05-19 | 2021-08-06 | 华中农业大学 | SNP genetic marker associated with pig semen quality traits and application |
-
2021
- 2021-08-09 CN CN202110907141.1A patent/CN113462788A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2031456A (en) * | 1978-09-01 | 1980-04-23 | Fossum K | Method for increasing fertility of mammals |
| CN106755299A (en) * | 2016-11-15 | 2017-05-31 | 安徽农业大学 | A kind of primer pair and method for comparing weanling pig intestine immunity developmental potency |
| CN113215277A (en) * | 2021-05-19 | 2021-08-06 | 华中农业大学 | SNP genetic marker associated with pig semen quality traits and application |
Non-Patent Citations (5)
| Title |
|---|
| P SUTOVSKY: "New Approaches to Boar Semen Evaluation, Processing and Improvement", 《REPROD DOM ANIM》, vol. 50, no. 2, pages 11 - 19 * |
| YANLING ZHAO 等: "iTRAQ‑based proteomic analysis of sperm reveals candidate proteins that affect the quality of spermatozoa from boars on plateaus", 《PROTEOME SCI》, vol. 19, no. 9, pages 1 * |
| 李远发 等: "Wipl 基因在人精子中的表达及与精子浓度和活力的相关性研究", 《广西医科大学学报》, vol. 36, no. 4, pages 593 * |
| 汤加勇 等: "热应激对雄性哺乳动物精液品质的影响机制及热应激公猪的营养调控", 《中国畜牧杂志》, pages 1 * |
| 甄林青 等: "家畜精液质量相关生物标记的研究进展", 《畜牧兽医学报》, vol. 47, no. 4, pages 645 - 651 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116004855A (en) * | 2023-01-17 | 2023-04-25 | 佛山科学技术学院 | Molecular marker related to mitochondrial membrane potential of Duroc pig sperm and application |
| CN116004855B (en) * | 2023-01-17 | 2023-08-08 | 佛山科学技术学院 | Molecular marker related to mitochondrial membrane potential of Duroc pig sperm and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105506086B (en) | The relevant SNP marker of chicken fertilization duration character and its application | |
| CN108546766B (en) | SNP molecular marker related to pig litter traits, identification and combined application thereof | |
| CN113462788A (en) | Gene detection primer and judgment method for judging boar semen quality | |
| CN111172295B (en) | Method for detecting cow VAMP7 gene CNV marker and special kit | |
| Lechniak et al. | Gilts and sows produce similar rate of diploid oocytes in vitro whereas the incidence of aneuploidy differs significantly | |
| CN107760791A (en) | The application of gene | |
| CN113249492B (en) | SNP marker for evaluating pig eye muscle area and application method thereof | |
| Mondal et al. | In vitro production of goat embryos in Bangladesh | |
| CN107858440A (en) | A kind of SNP marker related to pig birth weight character and application thereof | |
| Mondal et al. | In vitro embryo production in sheep | |
| CN106399480B (en) | Microsatellite genetic fingerprint of grass carp meiotic gynogenesis progeny induced by megalobrama amblycephala sperms | |
| CN113684282A (en) | Method for detecting pig hairless character based on EDAR gene expression level and application thereof | |
| Bukowska et al. | The invasive and new non-invasive methods of mammalian oocyte and embryo quality assessment: a review. | |
| Vega‐Hidalgo et al. | Sperm selection techniques in cattle: Microfilter device versus conventional methods | |
| CN109486956B (en) | Multi-group integrated precise breeding method for pigs | |
| Dogan et al. | Can we rely on only morphokinetic parameters to detect embryo aneuploidy? | |
| Pardede et al. | Bovine nucleoprotein transitions genes and protein abundance as valuable markers of sperm motility and the correlation with fertility | |
| CN109628609B (en) | Method for detecting 4 repeated deletion polymorphic sites of Chinese cattle PPP2R2B gene and application | |
| CN109486957A (en) | Pig multiple groups integrate accurate breeding method | |
| CN108570505B (en) | Multi-group integrated precise breeding method for pigs | |
| Suliman | Relationship between fertility and spermatozoal transcriptome characteristics in stallion | |
| CN117603976A (en) | Application of cholesterol modification in transfection of dsRNA into sperm and sex control of mice | |
| CN117965432A (en) | Through NAD+Method for improving activity of separated bovine sperm | |
| Zhang | Cytogenetic and molecular analysis of the channel catfish (Ictalurus punctatus) genome | |
| Opizzo Balza et al. | Morphological and functional characterization of cow oocytes for assisted reproduction techniques |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |