CN113462624A - Genetic engineering bacterial community based on artificial design and construction method and application thereof - Google Patents
Genetic engineering bacterial community based on artificial design and construction method and application thereof Download PDFInfo
- Publication number
- CN113462624A CN113462624A CN202110639502.9A CN202110639502A CN113462624A CN 113462624 A CN113462624 A CN 113462624A CN 202110639502 A CN202110639502 A CN 202110639502A CN 113462624 A CN113462624 A CN 113462624A
- Authority
- CN
- China
- Prior art keywords
- recombinant
- gtf
- cpr
- bacterium
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
- C12N9/0038—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
- C12N9/0042—NADPH-cytochrome P450 reductase (1.6.2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
- C12Y106/02—Oxidoreductases acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
- C12Y106/02004—NADPH-hemoprotein reductase (1.6.2.4), i.e. NADP-cytochrome P450-reductase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/13—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen (1.14.13)
- C12Y114/13088—Flavonoid 3',5'-hydroxylase (1.14.13.88)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a genetic engineering flora based on artificial design and a construction method and application thereof, wherein the artificial genetic engineering flora comprises a recombinant engineering bacterium 1 containing GtF 3' H gene and CPR gene and a recombinant engineering bacterium 2 containing MpOMT gene. The construction method comprises the following steps: constructing a recombinant engineering bacterium 1 and a recombinant engineering bacterium 2; culturing to obtain a culture solution; and mixing to obtain the genetically engineered bacterial community. In the genetic engineering bacterial community, GtF 3' H catalyzes a substrate naringenin to carry out hydroxylation reaction to synthesize an intermediate product eriodictyol; CPR is a cofactor that GtF 3'H exerts a catalytic function, transferring electrons from NADPH to GtF 3' H, thereby effecting hydroxylation; and catalyzing eriodictyol serving as an intermediate product by using the MpOMT to perform an oxygen methylation reaction to synthesize hesperetin.
Description
Technical Field
The invention relates to the technical field of biochemical engineering, in particular to a genetic engineering bacterial community based on artificial design and a construction method and application thereof.
Background
The citrus flavonoid compound has antioxidant and antiviral effects, and has good effects in preventing and treating cardiovascular diseases, neurodegenerative diseases, and cancer. With the increasing market demand for flavones, the extraction of citrus flavones from plants has the characteristics of high input, high consumption, high pollution and low yield, so that the mass production of flavones is limited. The chemical synthesis involves the use of chemical reagents and harsh reaction conditions, and the prepared flavone used for foods and health-care products is easy to cause safety problems. The microbial synthesis of the citrus flavonoid compound has the advantages of environmental friendliness and resource conservation, accords with the application prospect of sustainable development, and is a research hotspot in the field of domestic and foreign flavonoid synthesis at present.
Hesperetin exists in plant such as mandarin orange, tangerine, orange, etc. in glycoside form, and has very low content of free monomer. In recent years, a large amount of scientific researches are carried out on the aspect of biological function mechanisms of hesperetin, so that hesperetin has wide application prospects in the industries of foods, medicines and the like. However, hesperetin is mainly obtained by acid hydrolysis of hesperidin, the reaction process needs to be carried out at a higher temperature, and chemical reagents such as concentrated sulfuric acid and a large amount of methanol are used, so that the environmental burden is greatly increased. The method for developing microbial synthesis of hesperetin is of great significance for green hesperetin acquisition.
Disclosure of Invention
The invention aims to solve the technical problem of seeking a genetically engineered bacterial community for green hesperetin acquisition based on artificial design and a construction method and application thereof.
In order to achieve the aim, the invention provides a genetically engineered bacterium community based on artificial design, which comprises a recombinant engineered bacterium 1 containing GtF 3' H gene and CPR gene and a recombinant engineered bacterium 2 containing MpOMT gene.
Further, the cell-to-stem weight ratio of the gene recombinant bacteria 1 to the recombinant engineering bacteria 2 is 1: 1-1: 3.
Further, in the genetically engineered bacterial community, the total dry cell weight is 24-36 g/L.
Based on a general technical concept, the invention also provides a construction method of the genetic engineering bacterial community, which comprises the following steps:
s1, constructing a recombinant engineering bacterium 1 containing GtF 3' H gene and CPR gene; constructing a recombinant engineering bacterium 2 containing an MpOMT gene;
s2, culturing the recombinant engineering bacteria 1 into a culture solution 1; culturing the recombinant engineering bacteria 2 into a culture solution 2:
and S3, mixing the culture solution 1 and the culture solution 2 to obtain the genetically engineered bacterial community.
The above construction method, further, the recombinant engineering bacterium 1 is constructed by the following method:
S1-A1, cloning nucleotide sequence GtF 3'H containing amino acids at positions 30-524 into pETDuet-1 to obtain recombinant plasmid pETDuet-trGtF 3' H;
S1-A2 and cytochrome P450 reductase nucleotide sequences are cloned to pETDuet-trGtF 3'H to obtain a recombinant plasmid pETDuet-trGtF 3' H-CPR;
S1-A3, and introducing the recombinant plasmid pETDuet-trGtF 3' H-CPR into competent escherichia coli to obtain the recombinant engineering bacterium 1.
In the above construction method, further, the S1-a1 specifically is: using GtF 3' H nucleotide sequence as a template, using GtF 3' H-1 and GtF 3' H-2 as primers to perform PCR amplification to obtain a nucleotide sequence fragment of GtF 3' H containing amino acids at positions 30-524, and cloning the nucleotide sequence fragment to pETDuet-1 to obtain a recombinant plasmid pETDuet-trGtF 3' H, wherein the DNA sequence of GtF 3' H-1 is shown as SEQ ID NO.4, and the DNA sequence of GtF 3' H-2 is shown as SEQ ID NO. 5.
In the above construction method, further, the S1-a2 specifically is: taking a cytochrome P450 reductase nucleotide sequence as a template, taking CPR-1 and CPR-2 as primers, carrying out PCR amplification to obtain an amplification product, cloning the amplification product to pETDuet-trGtF 3'H, and obtaining a recombinant plasmid pETDuet-trGtF 3' H-CPR. The DNA sequence of the CPR-1 is shown as SEQ ID NO.6, and the DNA sequence of the CPR-2 is shown as SEQ ID NO. 7.
The above construction method, further, the recombinant engineering bacteria 2 is constructed by the following method:
S1-B1, cloning the nucleotide sequence containing flavonoid 4' -O-methyltransferase to pET28a to obtain a recombinant plasmid pET28 a-MpOMT;
S1-B2, cloning the recombinant plasmid pET28a-MpOMT and Sumo sequence to a plasmid pET32a at the same time to obtain a recombinant plasmid pET32 a-SumoMpOMT;
S1-B3, and introducing the recombinant plasmid pET32 a-SumomMpOMT into competent escherichia coli to obtain the recombinant engineering bacteria 2.
In the above construction method, further, the S1-B2 specifically is: taking a Sumo nucleotide sequence as a template and SumomMpOMT-1 and SumomMpOMT-2 as primers; taking an MpOMT nucleic acid sequence as a template, taking SumommOMT-3 and SumomOMT-4 as primers to perform PCR amplification to obtain nucleotide sequence fragments of MpOMT and Sumo, cloning the nucleotide sequence fragments to pET32a to obtain a recombinant plasmid pET32 a-SumomOMT, wherein the DNA sequence of SumomOMT-1 is shown as SEQ ID NO.8, the DNA sequence of SumomOMT-2 is shown as SEQ ID NO.9, the DNA sequence of SumomOMT-3 is shown as SEQ ID NO.10, and the DNA sequence of SumomOMT-4 is shown as SEQ ID NO. 11.
Based on a general technical concept, the invention also provides an application of the genetic engineering flora colony in flavonoid synthesis.
The above application, further, the method of the application is:
(1) adding flavonoid substrates into the genetically engineered bacterial community for reaction;
(2) adding recombinant engineering bacteria 2 of expression plasmid pET32 a-SumomMpOMT for reaction;
(3) ethyl acetate was added to terminate the reaction.
Compared with the prior art, the invention has the advantages that:
(1) the invention provides a genetic engineering bacterium community based on artificial design, which comprises a recombinant engineering bacterium 1 containing GtF 3' H gene and CPR gene and a recombinant engineering bacterium 2 containing MpOMT gene. GtF 3' H is mainly used for catalyzing the hydroxylation reaction of a substrate naringenin to synthesize an intermediate product eriodictyol; CPR is a cofactor for GtF 3'H to perform catalytic functions, and mainly plays a role in transferring electrons of NADPH to GtF 3' H, so that hydroxylation reaction occurs; the MpOMT is used for catalyzing eriodictyol as an intermediate product to perform an oxygen methylation reaction to synthesize hesperetin; the recombinant engineering bacteria 1 and a substrate naringenin are subjected to catalytic reaction, the substrate is converted into an intermediate product eriodictyol as far as possible, and then the recombinant engineering bacteria 2 are added to convert the eriodictyol to synthesize the hesperetin.
(2) The invention provides a genetic engineering bacteria community based on artificial design, the content of synthesized hesperetin is greatly influenced by the different adding proportions of two recombinant engineering bacteria, the maximum difference reaches 7 times, and the content of hesperetin is obviously improved by adjusting the adding proportions of the two recombinant engineering bacteria and time nodes added in batches.
(3) The invention provides a construction method of a genetically engineered bacterium community based on artificial design, which adopts a whole-cell catalysis method to catalyze naringenin in cells to synthesize hesperetin, reduces the separation and purification process of enzyme compared with in vitro enzymatic reaction, is green and economic, and can more effectively maintain the activity of the enzyme. Meanwhile, the whole catalytic reaction is carried out in the buffer solution, so that metabolites generated by the cells cultured in the culture medium for a long time are effectively reduced, and the separation and purification of subsequent products are facilitated.
(4) The invention provides an application of a genetically engineered flora to directionally and efficiently synthesize flavonoid based on artificial design, and provides a method for directionally and efficiently synthesizing hesperetin by taking two strains of escherichia coli BL21(DE3) as starting strains and utilizing the idea of artificially designing a flora structure. The two escherichia coli genetic engineering strains effectively share the metabolic toxicity and metabolic burden of heterologous expression foreign proteins, and compared with a chemical method, the method has the characteristics of environmental protection and environmental friendliness. Meanwhile, the artificially designed thallus community structure can be popularized to directionally synthesize other flavonoid compounds, and provides a certain reference significance for producing other natural products by genetic engineering bacteria in the future.
Drawings
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention.
FIG. 1 is a diagram showing prediction of the transmembrane domain of GtF 3' H protein in example 1 of the present invention
FIG. 2 is a plasmid map of pETDuet-trGtF 3' H-CPR in example 1 of the present invention.
FIG. 3 is a plasmid map of pET32 a-SumomMpOMT in example 2 of the present invention.
Fig. 4 is a graph of the standard hesperetin curve in the embodiment of the invention.
FIG. 5 is a high performance liquid chromatogram of hesperetin in the reaction solution of example 3 of the present invention.
FIG. 6 is a hesperetin mass spectrum of the reaction solution of example 3 of the present invention.
FIG. 7 is a graph showing the content of synthesized hesperetin in the reaction solutions of examples 3 and 4 of the present invention.
Detailed Description
The invention is further described below with reference to specific preferred embodiments, without thereby limiting the scope of protection of the invention.
Unless otherwise defined, all terms of art used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention.
Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods. The methods in the following examples are conventional in the art unless otherwise specified.
The materials and reagents used in the following examples are commercially available unless otherwise specified.
In the quantitative tests in the following examples, three replicates were set up and the results averaged.
The hesperetin standard in the following examples is a product of Shanghai-derived leaf Biotech Co., Ltd. Chromatographic grade acetonitrile, methanol, acetic acid are products of Fisher corporation (usa).
The preparation method of the hesperetin standard curve working solution comprises the following steps:
preparation of a standard solution: dissolving the solid hesperetin standard product in methanol to prepare a hesperetin standard solution of 200mg/L, and diluting with methanol to prepare hesperetin standard curve working solutions of 100mg/L, 50mg/L, 25mg/L and 5mg/L respectively.
Preparing a hesperetin standard curve: and detecting the working solution of the standard curve by adopting ultra-high performance liquid chromatography, and respectively calculating peak areas of the working solution of the standard curve of the hesperetin with different concentrations under the retention time. Taking the concentration of the standard substance as an abscissa and the peak area as an ordinate, and performing linear regression analysis according to the relation between the concentration and the peak area to draw a standard curve. The standard curve of the hesperetin is drawn as shown in figure 1, and the standard curve equation obtained according to the standard curve is as follows: 40282x-23816 (where y is peak area and x is hesperetin content), and R20.9999 (fig. 4).
The media preparation methods used in the following examples:
LB liquid medium (1L): dissolving 10g of tryptone, 5g of yeast extract and 10g of NaCl in 800mL of deionized water, and fully stirring and dissolving; 5N NaOH is dripped, the pH is adjusted to 7.0, and the volume is fixed to 1L; sterilizing at high temperature and high pressure, and storing at 4 deg.C.
LB solid medium: agar was added at 15g/L on the basis of LB liquid medium.
TB medium (1L): 12g of tryptone, 24g of yeast extract and 4mL of glycerol, fully dissolving, and fixing the volume to 1L; phosphate buffer (100 mL): potassium dihydrogen phosphate (2.31 g) and dipotassium hydrogen phosphate (12.54 g) were dissolved in 100mL of the solution. Sterilizing at 121 deg.C for 20min, cooling, and mixing phosphate buffer solution with culture medium.
Examples
The materials and equipment used in the following examples are commercially available.
Example 1
The recombinant engineering bacterium BL21(DE3) is constructed by the following method:
(1) carrying a nucleotide sequence of flavonoid 3' hydroxylase F3' H (GtF 3' H) from gentiana scabra bunge on Genbank, and optimizing the nucleotide sequence by using an escherichia coli codon, wherein the specific sequence is shown as SEQ ID NO.1 and specifically comprises the following steps:
tctcgtaaaaaaggtcacggtcgttctctgccgctgccgccgggtccgcgtccgtggccgatcctgggcaacatcccgcacctgggctccaaaccgcaccagaccctggcggaaatggctaaaacctacggtccgttgatgcacctgaaattcggcctgaaagatgcggtggttgcgtccagcgcatccgtagctgaacagttcctgaaaaaacacgatgttaacttctctaaccgtccgccgaacagcggtgcaaaacacatcgcttacaactatcaggatctggtgttcgctccgtatggtccgcgctggcgtttgctgcgtaaaatttgctccgttcacctgttcagctccaaagcgctggacgatttccagcacgttcgccatgaagaaatttgcatcctgattcgtgcaattgcgtctggcggtcatgcgccggttaacctgggtaaactgctgggcgtttgcaccaccaacgctctggcgcgtgttatgctgggtcgtcgtgttttcgaaggcgatggcggtgaaaacccgcacgcggacgagttcaaatccatggttgtagaaatcatggttctggcgggtgctttcaacctgggtgatttcattccggttctggactggtttgacctgcagggtatcgccggcaaaatgaaaaaactgcacgctcgcttcgacaaattcctgaatggtatcctggaagatcgtaaaagcaacggttctaacggtgcggagcagtacgttgacctgctgagcgttctgatcagcctgcaggacagcaacatcgatggtggtgatgaaggcaccaaactgacagataccgaaatcaaagcgctgctgctgaacctgttcatcgcaggtaccgataccagctctagcaccgtggaatgggcaatggcagaactgatccgtaacccgaaactgctggtgcaggcgcaggaagaactggaccgcgtggttggcccgaaccgtttcgtgaccgaatctgatctgccgcagctgaccttcctgcaggcggtaattaaagaaacctttcgtctgcacccgtctaccccgctgagcctgccgcgtatggcggcggaagattgcgaaatcaacggctactatgtttctgaaggctctaccctgctggttaacgtttgggcgatcgcacgtgacccgaacgcatgggcgaatccgctggatttcaacccgacccgtttcctggcaggtggcgaaaaaccgaacgttgatgttaaaggtaacgattttgaagttatcccgtttggcgcgggtcgtcgtatctgcgcgggtatgagcctgggcatccgtatggttcagctggttaccgcttccctggttcatagcttcgattgggcgctgctggacggcctgaaaccggaaaaactggatatggaagaaggttacggtctgaccctgcagcgtgcatctccgctgatcgtgcacccgaaaccgcgtctgtctgctcaggtttattgcatgtaa。
(2) the transmembrane domain of GtF 3' H protein was predicted by the online software TMHMM Server 2.0, and the prediction results are shown in FIG. 1: GtF 3' H form a typical transmembrane helical region between amino acids 7 and 29. Thus, GtF 3' H protein was truncated at the first 29 amino acids from the N-terminus, and the GtF 3' H nucleotide sequence containing amino acids 30 to 524 was synthesized in whole genes by Biotechnology engineering (Shanghai) Inc., and cloned into BamH I/HindII, the first multiple cloning site of pETDuet-1, to obtain pETDuet-trGtF 3' H, a recombinant plasmid.
Wherein, the adopted primers are GtF3 'H-1 and GtF 3' H-2. Wherein the DNA sequence of GtF 3' H-1 is shown in SEQ ID NO.4, and specifically comprises: tcatcaccacagccaggatccgatgtctcgtaaaaaaggtcacgg are provided.
GtF 3' H-2 DNA sequence is shown in SEQ ID NO.5, which specifically comprises: gcattatgcggccgcaagcttttacatgcaataaacctgagcagac are provided.
And (3) PCR reaction system:
PCR reaction procedure:
(3) an arabidopsis thaliana Cytochrome P450 Reductase (CPR) nucleotide sequence is downloaded from Genbank and optimized by an escherichia coli codon, and a specific sequence is shown as SEQ ID NO.2 and specifically comprises the following steps:
atgagctctagctcttcttcttctaccagcatgattgatctgatggcggcgatcatcaaaggtgaaccggtgatcgtgtctgacccggctaacgcgagcgcatacgaatctgtagcggctgaactgagctctatgctgatcgaaaaccgtcagttcgctatgatcgtgaccaccagcatcgcggttctgatcggttgcatcgttatgctggtttggcgccgtagcggtagcggtaactccaaacgtgttgaaccgttgaaaccgctggtgatcaaaccgcgtgaagaggaaatcgatgatggccgtaaaaaagttaccatcttcttcggcactcagaccggcacggcggaaggtttcgcgaaagcgctgggtgaagaagccaaagctcgttatgaaaaaacccgcttcaaaatcgttgacttggacgattacgcggcagatgatgatgaatatgaagaaaaactgaaaaaagaagatgttgcgtttttcttcctggctacctacggtgacggcgaaccgactgataacgcggctcgtttctataaatggttcactgaaggtaacgatcgtggtgaatggctgaaaaacctgaaatacggtgtgtttggcctgggtaaccgccagtatgaacacttcaacaaagttgcgaaagtggtagacgatatcctggttgaacagggcgcacagcgtctggttcaggtaggcctgggtgatgatgaccagtgcatcgaagatgacttcaccgcttggcgcgaagcgctgtggccggaactggatacgatcctgcgtgaagaaggtgataccgccgtggcaaccccgtataccgctgcggttctggaataccgtgttagcatccatgatagcgaagatgctaaattcaacgacattaacatggcgaacggcaacggctacactgtgttcgacgcacagcatccgtacaaagcgaacgtggccgttaaacgtgaactgcataccccagaatctgaccgctcctgtatccacctggaattcgacattgcgggcagcggtctgacctatgaaaccggtgaccacgttggcgttctgtgtgacaacctgtctgaaaccgttgatgaagctctgcgtttgctggacatgtctccggatacctatttcagtctgcatgctgaaaaagaagatggtaccccgatctcatcctccctcccgccaccgttcccgccgtgcaacctgcgcactgcgctgacccgctacgcatgcctgctgagctccccgaaaaaatccgcgctggtagcgctggcggcgcacgcatccgacccaaccgaagccgaacgtctgaaacacctggcctctccggcaggcaaagacgaatactctaaatgggtggtggaaagccagcgctctctgctggaagttatggcggaattcccgagcgccaaaccgccgctgggcgtgtttttcgctggcgtggctccgcgccttcagccgcgtttctattccatctctagcagcccgaaaatcgctgaaacccgcattcacgttacttgcgcgctggtgtatgaaaaaatgccgactggtcgtatccacaaaggcgtatgtagcacctggatgaaaaacgcggttccatacgaaaaatctgaaaactgctcctccgcgccgatcttcgtgcgccagagcaactttaaactgccgtctgattctaaagttccgattattatgatcggtccgggtaccggtctggctccgttccgtggcttcctgcaggaacgtctggcgctggttgaatctggcgttgaactgggtccgtccgttctgttcttcggctgccgtaaccgccgtatggatttcatctacgaagaagaactgcagcgctttgttgaaagcggtgcgctggccgaactgtccgtcgcgttcagccgtgaaggtccgaccaaagaatatgttcagcacaaaatgatggataaagcaagcgatatctggaacatgatttctcagggcgcgtacctgtacgtttgtggcgatgcaaaaggtatggcgcgtgatgttcaccgttctctgcacaccatcgcgcaagaacagggttctatggattctaccaaagcggaaggtttcgtgaaaaacctgcagacctctggccgttacctgcgtgacgtttggtaa。
the whole gene is synthesized by the biological engineering (Shanghai) company Limited and cloned to the second multiple cloning site EcoR V/Xho I of pETDuet-trGtF 3'H to obtain the recombinant plasmid pETDuet-trGtF 3' H-CPR. The plasmid map of pETDuet-trGtF 3' H-CPR is shown in FIG. 2.
Wherein, the adopted primers are CPR-1 and CPR-2. Wherein, the DNA sequence of CPR-1 is shown as SEQ ID NO.6, which specifically comprises: ggcagatctc aattggatat cgatgagctc tagctcttct tcttctacc are provided.
The DNA sequence of the CPR-2 is shown as SEQ ID NO.7, and specifically comprises the following components: ggtttcttta ccagactcga gttaccaaac gtcacgcagg taa are provided.
And (3) PCR reaction system:
PCR reaction procedure:
(4) the recombinant plasmid pETDuet-trGtF 3' H-CPR is introduced into competent Escherichia coli to obtain recombinant engineering bacteria 1.
Example 2:
the recombinant engineering bacteria are constructed by adopting the following method:
(1) construction of recombinant plasmid pET32a-SumompOMT
Downloading a nucleotide sequence of flavonoid 4' -O-methyltransferase (MpOMT) from Genbank, optimizing a codon of escherichia coli, and performing fusion expression with Sumo, wherein a specific sequence of the MpOMT is shown as SEQ ID NO.3 and specifically comprises the following steps:
atggttgctgatgaagaagttcgtgttcgtgcggaagcatggaacaacgcgttcggttacatcaaaccgaccgcagttgcgaccgcggttgaactgggtctgccggatatcctggaaaaccacgatggtccgatgagcctgctggaactgagcgcggctaccgattgcccggccgaaccgctgcaccgtctgatgcgtttcctggttttccacggtatcttcaaaaagaccgcgaaaccgccgctgtctaacgaagcggtttactacgcgcgtaccgcgctgagccgcctgttcacccgtgacgaactgggtgacttcatgctgctgcagaccggtccgctgtctcagcacccggctggcctgaccgcgtccagcctgcgcaccggtaaaccgcagttcatccgtagcgtgaacggcgaagattcttggaccgatccggttaacggttaccacatgaaagttttctccgatgcgatggcggcgcacgcacgcgaaaccaccgcggcgatcgttcgttactgcccggcggcgttcgaaggtatcggtaccgttgttgatgttggtggccgtcacggcgttgcgctggaaaaactggttgcggcattcccgtgggtgcgtggtatctctttcgatctgccggaaatcgttgcgaaagcgccgccgcgcccaggcatcgaattcgttggtggttctttcttcgaatctgtaccgaaaggtgatctggttctgctgatgtggatcttgcacgattggtccgatgaaagctgcatcgaaatcatgaaaaaatgcaaagaagcgatcccgaccagcggtaaagttatgatcgtggatgcgatcgttgatgaagatggtgaaggtgatgatttcgcgggcgcgcgtctgagcctggatctgatcatgatggcggttctggcgcgtggtaaagaacgtacctaccgtgaatgggaatacctgctgcgtgaagcgggtttcaccaaattcgttgttaaaaacatcaacaccgttgaattcgttatcgaagcgtacccgtaa
the whole gene synthesis was carried out in Biotechnology engineering (Shanghai) Co., Ltd, and cloned into pET28a to obtain recombinant plasmid pET28 a-MpOMT. The primers used were:
pet28-MpOMT-1：cagcaaatgggtcgcggatccatggttgctgatgaagaagttcg(SEQ ID NO.12)；
pet28-MpOMT-2：ctcgagtgcggccgcaagcttttacgggtacgcttcgataacg(SEQ ID NO.13)。
(2) the obtained recombinant plasmid pET28a-MpOMT and Sumo sequence are cloned to the cloning site BamH I/Xho I of plasmid pET32a at the same time, and the recombinant plasmid pET32a-Sumo MpOMT is obtained. The plasmid map of pET32 a-SumommpOMT is shown in FIG. 3.
Wherein primers for amplifying the Sumo sequence are SumompOMT-1 and SumompOMT-2. The DNA sequence of SumomMpOMT-1 is shown as SEQ ID NO.8, and specifically comprises the following steps: gccatggctgatatcggatccatgtcggactcagaagtcaatcaa are provided. The DNA sequence of SumomMpOMT-2 is shown as SEQ ID NO.9, and specifically comprises the following steps: cagcaaccataccaccaatctgttctctgtgagc are provided. The PCR reaction system used was:
primers for amplifying the MpOMT sequence are SumoMpOMT-3 and SumoMpOMT-4. Wherein, the DNA sequence of SumomMpOMT-3 is shown as SEQ ID NO.10, and specifically comprises the following components: gattggtggtatggttgctgatgaagaagttcg, respectively; the DNA sequence of SumomMpOMT-4 is shown in SEQ ID NO.11, specifically gtggtggtggtggtgctcgagttacgggtacgcttcgataacg.
The PCR reaction system used was:
PCR reaction procedure:
(3) the recombinant plasmid pET32 a-SumomMpOMT is introduced into competent Escherichia coli to obtain recombinant engineering bacteria 2(Cell 2).
Example 3
A gene engineering bacterium community based on artificial design comprises a recombinant engineering bacterium 1 in an embodiment 1 and a repeated engineering bacterium 2 in an embodiment 2, wherein the mass ratio of the recombinant engineering bacterium 1 to the repeated engineering bacterium 2 is 1: 3.
The construction method of the genetically engineered bacterial community of the embodiment 1 specifically comprises the following steps:
1. culturing the recombinant engineering bacteria 1:
1.1, culturing the recombinant engineering bacteria 1 in a solid LB culture medium containing ampicillin resistance at a constant temperature of 37 ℃ overnight.
1.2, picking single colony on a solid LB culture medium plate to a test tube containing LB liquid culture medium containing ampicillin, and culturing for 12h at 37 ℃ and 220 rpm.
1.3, inoculating the strain in 30mL LB liquid medium containing benzyl amine resistance according to the inoculation ratio of 1%, and carrying out constant temperature shaking culture at 37 ℃ and 220rpm until the OD600 of the strain liquid is 0.6-0.8.
1.4, IPTG was added to a final concentration of 0.2mM, and protein expression was induced for 12 h.
1.5, after the induction is finished, centrifuging at 5200rpm for 10min, collecting cells, washing with 50mM Tris-HCl, pH7.4 twice, and then suspending in Tris-HCl to obtain a culture solution of the recombinant engineering bacteria 1.
2. Culturing the recombinant engineering bacteria 2:
2.1, culturing the recombinant engineering bacteria 2 in a solid LB culture medium containing ampicillin and kanamycin resistance at a constant temperature of 37 ℃ for overnight.
2.2, picking single colony on solid LB medium plate to test tube containing LB liquid medium with ampicillin and kanamycin resistance, culturing 12h at 37 ℃ and 220 rpm.
2.3, inoculating the strain in 30mL LB liquid medium containing ampicillin and kanamycin resistance at the inoculation ratio of 1%, and carrying out constant temperature shaking culture at 37 ℃ and 220rpm until the OD600 of the strain liquid is 0.6-0.8.
2.4, IPTG was added to a final concentration of 0.2mM, and protein expression was induced for 12 h. After induction, centrifugation is carried out at 5200rpm for 10min, cells are collected, washed twice with 50mM Tris-HCl, pH7.4, and then resuspended in Tris-HCl to obtain a culture solution of the recombinant engineering bacterium 2.
(3) Mixing the culture solution of the recombinant engineering bacteria 1 and the culture solution of the recombinant engineering bacteria 2 in equal volume, wherein the weight ratio of the cells is 1:3 (cell Dry weight and OD)600The relationship between: 1OD600 is 0.35g/L DCW), and the total dry cell weight is 32g/L, so as to obtain the genetically engineered bacterial community.
An application of the genetic engineering flora of the embodiment in naringenin synthesis comprises the following application methods:
in the genetically engineered bacterial community of the embodiment, a substrate naringenin is added to a final concentration of 100mg/L, after reaction for 12 hours at 23 ℃ and 220rpm, recombinant engineered bacteria 2(cell2) expressing plasmid pET32 a-SumomOMT is added in an equal volume, after reaction for 12 hours at 23 ℃ and 220rpm, ethyl acetate is added in an equal volume, and the reaction is terminated after full shaking and uniform mixing. Centrifuging the mixed solution at 4000rpm for 10min, sucking 1mL of upper organic phase, drying by nitrogen blowing, adding 1mL of methanol for redissolution, filtering with 0.22 μm filter membrane, and analyzing by ultra performance liquid chromatography (figure 5), wherein the product in the reaction solution is hesperetin by mass spectrometry (figure 6). Finally, the content of the hesperetin is 37mg/L (figure 7).
Example 4
A genetic engineering community based on artificial design inspects the influence of different quality ratios on the content of synthesized hesperetin:
Group 4 is a genetically engineered bacterium community based on artificial design, comprising the recombinant engineered bacterium 1 of example 1 and the recombinant engineered bacterium 2 of example 2, wherein the cell-to-stem weight ratio of the recombinant engineered bacterium 1 to the recombinant engineered bacterium 2 is 1: 2.
An application of the genetic engineering flora of the embodiment in naringenin synthesis comprises the following application methods:
adding naringenin as a substrate into the genetically engineered bacteria communities of groups 1 to 5 respectively until the final concentration is 100mg/L, reacting for 12 hours at 23 ℃ and 220rpm, then adding recombinant engineered bacteria 2(cell2) of expression plasmid pET32 a-SumomOMT in an equal volume, reacting for 12 hours at 23 ℃ and 220rpm, adding ethyl acetate in an equal volume, fully shaking and uniformly mixing, and stopping the reaction. The mixture was centrifuged at 4000rpm for 10min, 1mL of the upper organic phase was extracted, dried by nitrogen blow, and then redissolved by adding 1mL of methanol through a 0.22 μm filter. And (5) performing ultra-high performance liquid chromatography analysis to detect the content of hesperetin.
The investigation result is shown in FIG. 7, and it can be seen from the figure that the content of synthesized hesperetin is greatly affected by the difference of the addition ratios of the two recombinant engineering bacteria, the maximum difference is 7 times, wherein the content of hesperetin synthesized by the genetic engineering bacteria community with the cell dry weight ratio of 3: 1-1 of the recombinant engineering bacteria 1 and the recombinant engineering bacteria 2 is respectively as follows: 11.11mg/L, 3.94mg/L, 17.68 mg/L; the content of hesperetin synthesized by the genetic engineering bacteria community with the cell dry weight ratio of 1: 1-1: 3 of the recombinant engineering bacteria 1 and the recombinant engineering bacteria 2 is 17.68mg/L, 27.22mg/L and 37.07mg/L respectively, and the effect that the mass ratio of the recombinant engineering bacteria 1 to the recombinant engineering bacteria 2 is 1: 1-3 is optimal.
The foregoing is merely a preferred embodiment of the invention and is not intended to limit the invention in any manner. Although the present invention has been described with reference to the preferred embodiments, it is not intended to be limited thereto. Those skilled in the art can make many possible variations and modifications to the disclosed embodiments, or equivalent modifications, without departing from the spirit and scope of the invention, using the methods and techniques disclosed above. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention are still within the scope of the protection of the technical solution of the present invention.
Sequence listing
<110> agricultural product processing research institute of Hunan province
<120> genetic engineering bacterial community based on artificial design and construction method and application thereof
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1488
<212> DNA
<213> gentian (Gentiana scabra Bunge)
<400> 1
tctcgtaaaa aaggtcacgg tcgttctctg ccgctgccgc cgggtccgcg tccgtggccg 60
atcctgggca acatcccgca cctgggctcc aaaccgcacc agaccctggc ggaaatggct 120
aaaacctacg gtccgttgat gcacctgaaa ttcggcctga aagatgcggt ggttgcgtcc 180
agcgcatccg tagctgaaca gttcctgaaa aaacacgatg ttaacttctc taaccgtccg 240
ccgaacagcg gtgcaaaaca catcgcttac aactatcagg atctggtgtt cgctccgtat 300
ggtccgcgct ggcgtttgct gcgtaaaatt tgctccgttc acctgttcag ctccaaagcg 360
ctggacgatt tccagcacgt tcgccatgaa gaaatttgca tcctgattcg tgcaattgcg 420
tctggcggtc atgcgccggt taacctgggt aaactgctgg gcgtttgcac caccaacgct 480
ctggcgcgtg ttatgctggg tcgtcgtgtt ttcgaaggcg atggcggtga aaacccgcac 540
gcggacgagt tcaaatccat ggttgtagaa atcatggttc tggcgggtgc tttcaacctg 600
ggtgatttca ttccggttct ggactggttt gacctgcagg gtatcgccgg caaaatgaaa 660
aaactgcacg ctcgcttcga caaattcctg aatggtatcc tggaagatcg taaaagcaac 720
ggttctaacg gtgcggagca gtacgttgac ctgctgagcg ttctgatcag cctgcaggac 780
agcaacatcg atggtggtga tgaaggcacc aaactgacag ataccgaaat caaagcgctg 840
ctgctgaacc tgttcatcgc aggtaccgat accagctcta gcaccgtgga atgggcaatg 900
gcagaactga tccgtaaccc gaaactgctg gtgcaggcgc aggaagaact ggaccgcgtg 960
gttggcccga accgtttcgt gaccgaatct gatctgccgc agctgacctt cctgcaggcg 1020
gtaattaaag aaacctttcg tctgcacccg tctaccccgc tgagcctgcc gcgtatggcg 1080
gcggaagatt gcgaaatcaa cggctactat gtttctgaag gctctaccct gctggttaac 1140
gtttgggcga tcgcacgtga cccgaacgca tgggcgaatc cgctggattt caacccgacc 1200
cgtttcctgg caggtggcga aaaaccgaac gttgatgtta aaggtaacga ttttgaagtt 1260
atcccgtttg gcgcgggtcg tcgtatctgc gcgggtatga gcctgggcat ccgtatggtt 1320
cagctggtta ccgcttccct ggttcatagc ttcgattggg cgctgctgga cggcctgaaa 1380
ccggaaaaac tggatatgga agaaggttac ggtctgaccc tgcagcgtgc atctccgctg 1440
atcgtgcacc cgaaaccgcg tctgtctgct caggtttatt gcatgtaa 1488
<210> 2
<211> 2136
<212> DNA
<213> Arabidopsis thaliana (L.)) Heynh)
<400> 2
atgagctcta gctcttcttc ttctaccagc atgattgatc tgatggcggc gatcatcaaa 60
ggtgaaccgg tgatcgtgtc tgacccggct aacgcgagcg catacgaatc tgtagcggct 120
gaactgagct ctatgctgat cgaaaaccgt cagttcgcta tgatcgtgac caccagcatc 180
gcggttctga tcggttgcat cgttatgctg gtttggcgcc gtagcggtag cggtaactcc 240
aaacgtgttg aaccgttgaa accgctggtg atcaaaccgc gtgaagagga aatcgatgat 300
ggccgtaaaa aagttaccat cttcttcggc actcagaccg gcacggcgga aggtttcgcg 360
aaagcgctgg gtgaagaagc caaagctcgt tatgaaaaaa cccgcttcaa aatcgttgac 420
ttggacgatt acgcggcaga tgatgatgaa tatgaagaaa aactgaaaaa agaagatgtt 480
gcgtttttct tcctggctac ctacggtgac ggcgaaccga ctgataacgc ggctcgtttc 540
tataaatggt tcactgaagg taacgatcgt ggtgaatggc tgaaaaacct gaaatacggt 600
gtgtttggcc tgggtaaccg ccagtatgaa cacttcaaca aagttgcgaa agtggtagac 660
gatatcctgg ttgaacaggg cgcacagcgt ctggttcagg taggcctggg tgatgatgac 720
cagtgcatcg aagatgactt caccgcttgg cgcgaagcgc tgtggccgga actggatacg 780
atcctgcgtg aagaaggtga taccgccgtg gcaaccccgt ataccgctgc ggttctggaa 840
taccgtgtta gcatccatga tagcgaagat gctaaattca acgacattaa catggcgaac 900
ggcaacggct acactgtgtt cgacgcacag catccgtaca aagcgaacgt ggccgttaaa 960
cgtgaactgc ataccccaga atctgaccgc tcctgtatcc acctggaatt cgacattgcg 1020
ggcagcggtc tgacctatga aaccggtgac cacgttggcg ttctgtgtga caacctgtct 1080
gaaaccgttg atgaagctct gcgtttgctg gacatgtctc cggataccta tttcagtctg 1140
catgctgaaa aagaagatgg taccccgatc tcatcctccc tcccgccacc gttcccgccg 1200
tgcaacctgc gcactgcgct gacccgctac gcatgcctgc tgagctcccc gaaaaaatcc 1260
gcgctggtag cgctggcggc gcacgcatcc gacccaaccg aagccgaacg tctgaaacac 1320
ctggcctctc cggcaggcaa agacgaatac tctaaatggg tggtggaaag ccagcgctct 1380
ctgctggaag ttatggcgga attcccgagc gccaaaccgc cgctgggcgt gtttttcgct 1440
ggcgtggctc cgcgccttca gccgcgtttc tattccatct ctagcagccc gaaaatcgct 1500
gaaacccgca ttcacgttac ttgcgcgctg gtgtatgaaa aaatgccgac tggtcgtatc 1560
cacaaaggcg tatgtagcac ctggatgaaa aacgcggttc catacgaaaa atctgaaaac 1620
tgctcctccg cgccgatctt cgtgcgccag agcaacttta aactgccgtc tgattctaaa 1680
gttccgatta ttatgatcgg tccgggtacc ggtctggctc cgttccgtgg cttcctgcag 1740
gaacgtctgg cgctggttga atctggcgtt gaactgggtc cgtccgttct gttcttcggc 1800
tgccgtaacc gccgtatgga tttcatctac gaagaagaac tgcagcgctt tgttgaaagc 1860
ggtgcgctgg ccgaactgtc cgtcgcgttc agccgtgaag gtccgaccaa agaatatgtt 1920
cagcacaaaa tgatggataa agcaagcgat atctggaaca tgatttctca gggcgcgtac 1980
ctgtacgttt gtggcgatgc aaaaggtatg gcgcgtgatg ttcaccgttc tctgcacacc 2040
atcgcgcaag aacagggttc tatggattct accaaagcgg aaggtttcgt gaaaaacctg 2100
cagacctctg gccgttacct gcgtgacgtt tggtaa 2136
<210> 3
<211> 1326
<212> DNA
<213> mint (Mentha halopthalyx Briq)
<400> 3
atgtcggact cagaagtcaa tcaagaagct aagccagagg tcaagccaga agtcaagcct 60
gagactcaca tcaatttaaa ggtgtccgat ggatcttcag agatcttctt caagatcaaa 120
aagaccactc ctttaagaag gctgatggaa gcgttcgcta aaagacaggg taaggaaatg 180
gactccttaa gattcttgta cgacggtatt agaattcaag ctgatcagac ccctgaagat 240
ttggacatgg aggataacga tattattgag gctcacagag aacagattgg tggtatggtt 300
gctgatgaag aagttcgtgt tcgtgcggaa gcatggaaca acgcgttcgg ttacatcaaa 360
ccgaccgcag ttgcgaccgc ggttgaactg ggtctgccgg atatcctgga aaaccacgat 420
ggtccgatga gcctgctgga actgagcgcg gctaccgatt gcccggccga accgctgcac 480
cgtctgatgc gtttcctggt tttccacggt atcttcaaaa agaccgcgaa accgccgctg 540
tctaacgaag cggtttacta cgcgcgtacc gcgctgagcc gcctgttcac ccgtgacgaa 600
ctgggtgact tcatgctgct gcagaccggt ccgctgtctc agcacccggc tggcctgacc 660
gcgtccagcc tgcgcaccgg taaaccgcag ttcatccgta gcgtgaacgg cgaagattct 720
tggaccgatc cggttaacgg ttaccacatg aaagttttct ccgatgcgat ggcggcgcac 780
gcacgcgaaa ccaccgcggc gatcgttcgt tactgcccgg cggcgttcga aggtatcggt 840
accgttgttg atgttggtgg ccgtcacggc gttgcgctgg aaaaactggt tgcggcattc 900
ccgtgggtgc gtggtatctc tttcgatctg ccggaaatcg ttgcgaaagc gccgccgcgc 960
ccaggcatcg aattcgttgg tggttctttc ttcgaatctg taccgaaagg tgatctggtt 1020
ctgctgatgt ggatcttgca cgattggtcc gatgaaagct gcatcgaaat catgaaaaaa 1080
tgcaaagaag cgatcccgac cagcggtaaa gttatgatcg tggatgcgat cgttgatgaa 1140
gatggtgaag gtgatgattt cgcgggcgcg cgtctgagcc tggatctgat catgatggcg 1200
gttctggcgc gtggtaaaga acgtacctac cgtgaatggg aatacctgct gcgtgaagcg 1260
ggtttcacca aattcgttgt taaaaacatc aacaccgttg aattcgttat cgaagcgtac 1320
ccgtaa 1326
<210> 4
<211> 45
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 4
tcatcaccac agccaggatc cgatgtctcg taaaaaaggt cacgg 45
<210> 5
<211> 46
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 5
gcattatgcg gccgcaagct tttacatgca ataaacctga gcagac 46
<210> 6
<211> 49
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 6
ggcagatctc aattggatat cgatgagctc tagctcttct tcttctacc 49
<210> 7
<211> 43
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 7
ggtttcttta ccagactcga gttaccaaac gtcacgcagg taa 43
<210> 8
<211> 45
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 8
gccatggctg atatcggatc catgtcggac tcagaagtca atcaa 45
<210> 9
<211> 34
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 9
cagcaaccat accaccaatc tgttctctgt gagc 34
<210> 10
<211> 33
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 10
gattggtggt atggttgctg atgaagaagt tcg 33
<210> 11
<211> 43
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 11
gtggtggtgg tggtgctcga gttacgggta cgcttcgata acg 43
<210> 12
<211> 44
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 12
cagcaaatgg gtcgcggatc catggttgct gatgaagaag ttcg 44
<210> 13
<211> 43
<212> DNA
<213> Artificial sequence (artifical sequence)
<400> 13
ctcgagtgcg gccgcaagct tttacgggta cgcttcgata acg 43
Claims (10)
1. A genetically engineered bacterium community based on artificial design is characterized by comprising a recombinant engineered bacterium 1 containing GtF 3' H gene and CPR gene and a recombinant engineered bacterium 2 containing MpOMT gene.
2. The genetically engineered bacterium community according to claim 1, wherein the cell-to-stem weight ratio of the genetically recombinant bacterium 1 to the genetically recombinant bacterium 2 is 1: 1-1: 3; and/or the total dry cell weight in the genetically engineered bacterial community is 24-36 g/L.
3. A method for constructing a genetically engineered bacterial community according to claim 1 or 2, comprising the steps of:
s1, constructing a recombinant engineering bacterium 1 containing GtF 3' H gene and CPR gene; constructing a recombinant engineering bacterium 2 containing an MpOMT gene;
s2, culturing the recombinant engineering bacteria 1 into a culture solution 1; culturing the recombinant engineering bacteria 2 into a culture solution 2;
and S3, mixing the culture solution 1 and the culture solution 2 to obtain the genetically engineered bacterial community.
4. The construction method according to claim 3, wherein the recombinant engineering bacteria 1 is constructed by adopting the following method:
S1-A1, cloning nucleotide sequence GtF 3'H containing amino acids at positions 30-524 into pETDuet-1 to obtain recombinant plasmid pETDuet-trGtF 3' H;
S1-A2, cloning a cytochrome P450 reductase nucleotide sequence into the recombinant plasmid pETDuet-trGtF 3'H to obtain a recombinant plasmid pETDuet-trGtF 3' H-CPR;
S1-A3, and introducing the recombinant plasmid pETDuet-trGtF 3' H-CPR into competent escherichia coli to obtain recombinant engineering bacteria 1.
5. The method according to claim 4, wherein S1-A1 is specifically: using GtF 3' H nucleotide sequence as a template, using GtF 3' H-1 and GtF 3' H-2 as primers to perform PCR amplification to obtain a nucleotide sequence fragment of GtF 3' H containing amino acids at positions 30-524, and cloning the nucleotide sequence fragment to pETDuet-1 to obtain a recombinant plasmid pETDuet-trGtF 3' H, wherein the DNA sequence of GtF 3' H-1 is shown as SEQ ID NO.4, and the DNA sequence of GtF 3' H-2 is shown as SEQ ID NO. 5.
6. The method according to claim 4, wherein S1-A2 is specifically: performing PCR amplification by using a cytochrome P450 reductase nucleotide sequence as a template and CPR-1 and CPR-2 as primers to obtain an amplification product, and cloning the amplification product into the recombinant plasmid pETDuet-trGtF 3'H to obtain a recombinant plasmid pETDuet-trGtF 3' H-CPR; the DNA sequence of the CPR-1 is shown as SEQ ID NO.6, and the DNA sequence of the CPR-2 is shown as SEQ ID NO. 7.
7. The construction method according to claim 3, wherein the recombinant engineering bacteria 2 is constructed by adopting the following method:
S1-B1, cloning the nucleotide sequence containing flavonoid 4' -O-methyltransferase to pET28a to obtain a recombinant plasmid pET28 a-MpOMT;
S1-B2, cloning the recombinant plasmid pET28a-MpOMT and Sumo sequence to a plasmid pET32a at the same time to obtain a recombinant plasmid pET32 a-SumoMpOMT;
S1-B3, and introducing the recombinant plasmid pET32 a-SumomMpOMT into competent escherichia coli to obtain recombinant engineering bacteria 2.
8. The method according to claim 7, wherein S1-B2 is specifically: taking a Sumo nucleotide sequence as a template and SumomMpOMT-1 and SumomMpOMT-2 as primers; taking an MpOMT nucleic acid sequence as a template, taking SumommOMT-3 and SumomOMT-4 as primers to perform PCR amplification to obtain nucleotide sequence fragments of MpOMT and Sumo, cloning the nucleotide sequence fragments to pET32a to obtain a recombinant plasmid pET32 a-SumomOMT, wherein the DNA sequence of SumomOMT-1 is shown as SEQ ID NO.8, the DNA sequence of SumomOMT-2 is shown as SEQ ID NO.9, the DNA sequence of SumomOMT-3 is shown as SEQ ID NO.10, and the DNA sequence of SumomOMT-4 is shown as SEQ ID NO. 11.
9. Use of the genetically engineered bacterial colony of claim 1 or 2 for the synthesis of flavonoids.
10. The application according to claim 9, wherein the method of application is:
(1) adding flavonoid substrates into the genetically engineered bacterial community for reaction;
(2) adding recombinant engineering bacteria 2 of expression plasmid pET32 a-SumomMpOMT for reaction;
(3) ethyl acetate was added to terminate the reaction.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110639502.9A CN113462624B (en) | 2021-06-08 | 2021-06-08 | Genetic engineering bacterial community based on artificial design and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110639502.9A CN113462624B (en) | 2021-06-08 | 2021-06-08 | Genetic engineering bacterial community based on artificial design and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113462624A true CN113462624A (en) | 2021-10-01 |
| CN113462624B CN113462624B (en) | 2023-01-10 |
Family
ID=77869451
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110639502.9A Active CN113462624B (en) | 2021-06-08 | 2021-06-08 | Genetic engineering bacterial community based on artificial design and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113462624B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107022515A (en) * | 2017-05-19 | 2017-08-08 | 南京工业大学 | One plant of genetic engineering bacterium and its construction method and application using ligno-cellulose hydrolysate anaerobic fermentation production L aspartic acids |
| US20180135029A1 (en) * | 2014-10-03 | 2018-05-17 | Symrise Ag | Method for the biotechnological production of flavonoids |
| WO2020165182A1 (en) * | 2019-02-11 | 2020-08-20 | Abolis Biotechnologies | Method for biosynthesising diosmetin and/or hesperetin in a microorganism |
| CN112725256A (en) * | 2021-02-22 | 2021-04-30 | 湖南省农产品加工研究所 | Recombinant escherichia coli and method for biosynthesizing diosmetin by using recombinant escherichia coli |
-
2021
- 2021-06-08 CN CN202110639502.9A patent/CN113462624B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180135029A1 (en) * | 2014-10-03 | 2018-05-17 | Symrise Ag | Method for the biotechnological production of flavonoids |
| CN107022515A (en) * | 2017-05-19 | 2017-08-08 | 南京工业大学 | One plant of genetic engineering bacterium and its construction method and application using ligno-cellulose hydrolysate anaerobic fermentation production L aspartic acids |
| WO2020165182A1 (en) * | 2019-02-11 | 2020-08-20 | Abolis Biotechnologies | Method for biosynthesising diosmetin and/or hesperetin in a microorganism |
| CN112725256A (en) * | 2021-02-22 | 2021-04-30 | 湖南省农产品加工研究所 | Recombinant escherichia coli and method for biosynthesizing diosmetin by using recombinant escherichia coli |
Non-Patent Citations (4)
| Title |
|---|
| UEYAMA,Y.等: "BAB87839.1", 《GENBANK》 * |
| 侯杰等: "植物类黄酮3’-羟化酶(F3"H)基因的研究进展", 《植物生理学报》 * |
| 单杨等: "生物合成柑橘类黄酮研究进展", 《中国食品学报》 * |
| 方起程: "《天然药物化学研究进展》", 30 September 2006, 中国协和医科大学出版社 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113462624B (en) | 2023-01-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112877272B (en) | Escherichia coli engineering bacteria of N-acetylglucosamine and fermentation production method | |
| CN111979163B (en) | Recombinant Roche bacterium, preparation method and application thereof | |
| CN114107152B (en) | Construction method and application of high-yield 3-fucosyllactose microorganism | |
| CN113373125A (en) | flavone-O-methyltransferase and its application in synthesis of wogonin, isowogonin and thuja flavone | |
| CN114196646B (en) | Olive alcohol synthetase variant A and application thereof | |
| CN109706189B (en) | Preparation method of D-chiro-inositol | |
| US11098287B2 (en) | 17β-hydroxysteroid dehydrogenase mutants and application thereof | |
| CN110804598B (en) | Precorrin-2C (20) -methyltransferase mutant, mutant gene and application thereof in preparing vitamin B12In (1) | |
| US20240052388A1 (en) | O-methyltransferase protein with highly specific catalytic function for multiple bias parent nuclei and encoding gene and use thereof | |
| CN113462624B (en) | Genetic engineering bacterial community based on artificial design and construction method and application thereof | |
| CN107142287B (en) | Artemisinic aldehyde double-bond reductase DBR1 and application of recombinant bacterium thereof in preparation of dihydro-beta-ionone | |
| CN110950938B (en) | Bi-component regulation and control system and application thereof in preparing vitamin B12In (1) | |
| CN107779459B (en) | Glucose dehydrogenase DNA molecule, vector, strain and application | |
| CN111041020B (en) | Isocitrate lyase mutant, mutant gene and application thereof in preparation of vitamin B12In (1) | |
| CN110904079B (en) | β -fructofuranosidase mutant, mutant gene and application thereof in preparation of vitamin B12In (1) | |
| CN115011614A (en) | Application of Pa22 gene as negative regulatory factor in improving yield of Pantoea agglomerans in synthesis of herbicidin A | |
| CN110903358B (en) | Ribosomal factor and its mutant and its use in preparing vitamin B12In (1) | |
| CN114276970B (en) | Genetically engineered bacterium for producing 1, 3-propylene glycol | |
| CN114292825B (en) | Synthesis method of tropinone | |
| CN111269948B (en) | Method for preparing 4-ethylphenol by using glycerol | |
| CN110819615B (en) | Uroporphyrinogen III synthetase mutant, mutant gene and application of mutant gene in preparation of vitamin B12 | |
| CN113025546B (en) | Method for producing tyrosol by converting L-tyrosine through multienzyme cascade | |
| CN114262681B (en) | Berberine production strain, establishment method and application thereof | |
| CN116837016B (en) | Method for constructing recombinant escherichia coli engineering strain for producing capsaicin-vanilla nonanamide, recombinant strain and application | |
| CN113583983A (en) | Fusion protein or variant thereof and application thereof in preparation of calcifediol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |