CN113444705A - High-purity and high-activity Ces1C protein, and expression vector and application thereof - Google Patents

Abstract

The invention provides a high-purity high-activity Ces1C protein, an expression vector and an application thereof, wherein a nucleotide sequence for coding the high-purity high-activity Ces1C protein is shown as SEQ ID NO: 1 is shown. The recombinant expression vector is a recombinant expression vector which is expressed by a nucleotide sequence shown as SEQ ID NO: 1 into the multiple cloning site of an expression vector. The preparation method of the recombinant expression vector comprises the following steps: obtaining the peptide shown as SEQ ID NO: 1, a target gene segment shown in the specification; adopting the target gene fragment as SEQ ID NO: 3-4, carrying out PCR to obtain a PCR product; and carrying out double enzyme digestion on the yeast vector pPic9K by SnaB I/Not I, and then carrying out enzyme ligation on the PCR product to obtain an expression vector pPic9K-Ces 1C. The Km of the Ces1C protease is 147.2-242.9 μ M, and the purity is more than 90%.

Description

High-purity and high-activity Ces1C protein, and expression vector and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, and more particularly relates to a Ces1C protein with high purity and high activity, an expression vector and an application thereof.

Background

Carboxylesterases (Ces) are known for their ability to hydrolyze ester, thioester, carbamate and amide bonds in chemicals and have been shown to have the ability to metabolize cholesterol in the liver, playing a role in lipid metabolism, indicating that Ces enzymes are important enzymes of both extrinsic and intrinsic metabolism. The Ces protein can be subdivided into 3 domains, including the catalytic domain, which contains the active site serine, an α/β domain, and a regulatory domain. And two disulfide bonds (Cys87-Cys116 and Cys274-Cys285) are present, with a cysteine residue (Cys116) located in the B2 domain. These cysteine bridges are present in many esterases and may play an important role in maintaining the protein in an enzymatically active conformation. For example, Cys87 was mutated to Ala or Ser, disrupting one of the disulfide bonds, resulting in a significant decrease in enzymatic activity of Ces. The B2 motif contains a catalytic serine and forms the bottom layer of the active site. The B2 domain appears to be an essential structural component that makes up the beta chain in the alpha/beta domain, which is well conserved. Since this amino acid sequence is also present in other esterases, such as cholinesterase, lipase and thioesterase, and disulfide bonds are also common to these proteins, this domain is likely to be a key structural component of these enzymes. Ces have been found in organisms ranging from bacteria to humans, and are members of the esterase family, which hydrolyze carboxyl esters (RCOOR) to the corresponding alcohols (ROH) and carboxylic acids (RCOOH). At present, 6 human Ces genes are found on chromosome 16, and 20 mouse Ces genes are found on chromosome 8. The large number of Ces genes in rodents are thought to be produced by tandem repeats. Thus, the sequence similarity of mouse Ces mRNA species and protein products is quite high. Ces has long been recognized to play an important role in the biotransformation of ester and amide containing compounds to affect the detoxification or activation of various xenobiotics, anesthetics, and pharmaceutical agents in the liver and gut. In some cases, Ces converts an inactive prodrug to an active metabolite, a process that is critical for biological activity. These compounds include the anticancer drugs CPT-11, capecitabine and the drug heroin. Ces can also hydrolyze many esterified drugs to inactive products and then excrete them outside the body, and agents such as meperidine, lidocaine, and cocaine can all be hydrolyzed and inactivated by these enzymes. Based on the important role of Ces in the activation, detoxification and biodistribution of various drugs and xenobiotics, the aim of tolerating and regulating the enzymatic activity or function treatment method can be achieved through the action of therapeutic intervention of the enzymes. The Ces inhibitor is screened by the active Ces protein, so that the bioavailability of the medicine can be increased, or the half-life period of the medicine inactivated by the Ces can be prolonged; ② improving the toxicity associated with the Ces activating drug; thirdly, eliminating the resistance of insects over expressing the Ces to pesticides; in addition, recombinant Ces proteins can also be used to rapidly eliminate or detoxify toxins in the body, and these methods are worthy of further investigation. Since ester function is a very valuable chemical form of drug design, studies demonstrating Ces biology will continue to significantly impact the development of new therapeutic drugs.

However, there are few Ces related products on the market and fewer products with biological activity. Although the protein expressed by the large intestine expression system can obtain high-yield protein, most of the protein is expressed by inclusion bodies, and the protein has low or even no activity, so that the application requirement of subsequent activity screening cannot be met.

Therefore, how to develop a high-purity and high-activity Ces1C protein and an expression vector thereof becomes a technical problem to be solved urgently.

Disclosure of Invention

Aiming at the technical problems in the prior art, the invention provides a high-purity high-activity Ces1C protein, an expression vector and an application thereof, the high-purity high-activity Ces1C protein can be prepared, and the high-purity mouse Ces1C protein has good enzyme activity through an enzymatic reaction test, the Km of the Ces1C protease is 147.2-242.9 mu M, and the purity is more than 90%.

The invention adopts the following technical scheme:

in the first aspect of the invention, a high-purity high-activity Ces1C protein is provided, and a nucleotide sequence for coding the high-purity high-activity Ces1C protein is shown as SEQ ID NO: 1 is shown.

In a second aspect of the invention, there is provided a nucleic acid molecule encoding the Ces1C protein, wherein the nucleotide sequence of the nucleic acid molecule is as set forth in SEQ ID NO: 1 is shown.

In the third aspect of the invention, a recombinant expression vector of the high-purity and high-activity Ces1C protein is provided, wherein the recombinant expression vector is obtained by inserting the nucleic acid molecule into a multiple cloning site of an expression vector.

Further, the expression vector further comprises an encoding tag sequence upstream of the nucleic acid molecule, wherein the tag sequence comprises one of a His tag, an HA tag and a Flag tag.

Further, the expression vector comprises one of a prokaryotic expression vector, a eukaryotic expression vector and a viral expression vector.

In a fourth aspect of the present invention, there is provided a method for preparing a recombinant expression vector of a high-purity and high-activity Ces1C protein, the method comprising:

obtaining the peptide shown as SEQ ID NO: 1, a target gene segment shown in the specification;

adopting the target gene fragment as SEQ ID NO: 3-4, carrying out PCR to obtain a PCR product;

and carrying out double enzyme digestion on the yeast vector pPic9K by SnaB I/Not I, and then carrying out enzyme ligation on the PCR product to obtain an expression vector pPic9K-Ces 1C.

In the fifth aspect of the invention, a recombinant cell line or recombinant expression bacterium for expressing the high-purity and high-activity Ces1C protein is provided, which comprises the recombinant expression vector.

In a sixth aspect of the present invention, there is provided a method for preparing the high-purity and high-activity Ces1C protein, the method comprising: the recombinant cell line or the recombinant expression bacterium of the Ces1C protein with high purity and high activity is obtained by induction, expression and purification.

In the seventh aspect of the invention, the high-purity and high-activity Ces1C protein is provided for screening Ces inhibitor products and/or preparing toxin removing products.

In the eighth aspect of the present invention, there is provided a method for detecting the activity of the Ces1C protein, the method comprising:

dissolving a substrate 4-NPA with the concentration of C in a substrate solvent and a buffer solution to obtain a mixed solution; wherein the buffer solution comprises 50-100mM Tris-HCl, pH7.0-8.0; the concentration C of the substrate 4-NPA is 0.3125-0.625 mug/ml;

adding the Ces1C protein to be detected for activity into the mixed solution for enzymolysis reaction to obtain an enzyme reaction speed;

according to the concentration C of the substrate 4-NPA and the enzyme reaction speed, the Km value of the Ces1C protein is obtained.

More preferably, the concentration of the substrate 4-NPA is 0.4. mu.g/ml. The substrate solvent is DMSO

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a high-purity high-activity Ces1C protein and an expression vector and application thereof, wherein a recombinant expression vector of Ces1C is constructed by optimizing a Ces1C expression codon sequence, a high-purity mouse Ces1C protein is obtained by a eukaryotic expression system and purification, the protein has enzyme activity, and the high-purity high-activity Ces1C protein is screened out by an activity detection method, wherein the Km of Ces1C protease is 147.2-242.9 mu M, and the purity is more than 90%.

Drawings

FIG. 1 is a product recovery detection scheme; in fig. 1, the following are shown in sequence from left to right: line1 is Marker; line2 Ces1C-pPic9K product;

FIG. 2 is a view of a carrier recovery test; in fig. 2, the following are shown in sequence from left to right: line1 is a double enzyme digestion product of pPic 9K; line2 is Marker;

FIG. 3 is a spot picking detection map; from left to right are: line1 is Marker; line 2-7, spot-picking PCR amplification strip; the Marker is 5000, 3000, 2000, 1500, 1000, 750, 500, 250 and 100(bp) from top to bottom;

FIG. 4 is a diagram showing the plasmid extraction and the identification of the digestion products; from left to right are: line 1: Ces1C-pPic9K plasmid; line 2: ces1C-pPic9K linearized plasmid;

FIG. 5 is a transformed plate;

FIG. 6 shows the PCR identification of Pichia pastoris recombinants; line1 to Line 20 in FIG. 6 are single colony identification results; line 21 is a negative control, and Line 22 is a positive control;

FIG. 7 is a SDS-PAGE pattern of the Ces1C yeast expressed protein; line1 in fig. 7: culture medium supernatant; line 2: sample loading and flow-through; line 3: 250mM imidazole eluent; line 4: marker; marker is 116, 66, 45, 35, 25, 18, 14(Kd) from top to bottom;

FIG. 8 shows the results of the 4-NPA substrate enzymolysis test using different concentrations of the Ces1C enzyme gradient;

FIG. 9 shows the results of the test of the gradient of the Ces1C protein in 4-NPA with different substrates;

FIG. 10 shows Km results for Ces1C protease;

FIG. 11 shows the results of batch to batch and thermal stability tests for the Ces1C protein;

FIG. 12 shows the results of the 4-NPA substrate enzymatic hydrolysis experiment using different concentrations of the Ces1C enzyme gradient in comparative example 1;

FIG. 13 shows the results of the test of the gradient of the Ces1C protein in comparative example 1 on different substrates, 4-NPA.

Detailed Description

The present invention is further described in detail below with reference to specific examples so that those skilled in the art can more clearly understand the present invention.

The following examples are provided only for illustrating the present invention and are not intended to limit the scope of the present invention. All other embodiments obtained by a person skilled in the art based on the specific embodiments of the present invention without any inventive step are within the scope of the present invention.

In the examples of the present invention, all the raw material components are commercially available products well known to those skilled in the art, unless otherwise specified; in the examples of the present invention, unless otherwise specified, all technical means used are conventional means well known to those skilled in the art.

In order to solve the technical problems, the general idea of the embodiment of the application is as follows:

the amino acid sequence according to the extracellular structure of Ces1C is set forth in SEQ ID NO: 2, when the Ces1C protein expressed in the large intestine was prepared in the previous stage, it was found that the protein was purified and the protein purity was good, but the protein detection was inactive, specifically, as shown in fig. 12 to 13.

Subsequently, the inventors of the present application found through experiments that: the codon sequence is expressed by optimizing Ces1C, and the nucleotide sequence is shown as SEQ ID NO: 1, constructing a recombinant expression vector of Ces1C, obtaining high-purity mouse Ces1C protein through a eukaryotic expression system and purification, obtaining active Ces1C protein capable of being stably expressed, and successfully developing the high-yield and high-purity active Ces1C protein.

The following will explain in detail a high purity and high activity Ces1C protein, its expression vector and application in the present application by combining examples and experimental data.

Experimental materials used in the examples of the present invention

The escherichia coli cloning host bacterium TOP10 and the yeast vector pPic9K can be obtained from the market, such as the yeast vector pPic9K of the product number VT1344 of Youbao organism; cloning host bacterium TOP10 of escherichia coli of bitonic (Bio-Tool) S01001;

restriction enzymes SnaB I and Not I are purchased from Fermentas;

agar powder was purchased from national drug group chemical reagents ltd;

dNTP mix was purchased from Promega;

spanish agarose was purchased ex Biowest;

goldview was purchased ex Beijing Edley;

taq DNA polymerase and Pfu DNA polymerase are self-produced by the company;

the plasmid extraction kit is purchased from Tiandi people and Tiandi people;

LB, peptone, yeast powder purchased from OXOID;

methanol and imidazole are purchased from Chinese medicine;

column Purification packing Complete His-Tag Purification Resin from Roche;

d-sorbitol was purchased from AMRESCO;

EXAMPLE 1 construction of expression vectors

1. Synthesis of the sequence of interest

Then, a plurality of primers (40-60bp) are designed according to the optimized sequence. Overlap of more than 15bp between each pair of adjacent primers using ddH₂Diluting the primers to the concentration of 50 nmol/mu l, properly centrifuging to mix the primers uniformly, obtaining double-stranded target DNA after polymerase linking, then transforming the obtained product into a pUC57 vector, carrying out plaque picking identification and sequencing, and determining that the base sequence after sequencing is consistent with the expectation, wherein the process is completed by Wuhan Kinry bioengineering Co., Ltd.

2. Primer design

Design primer ligation to the pPic9K vector:

Ces1C-F:ATGCTACGTACATCATCACCATCACCATCACTCTTTGTTG CCACCAGT(SEQ ID NO：3)；

Ces1C-R:CGTAGCGGCCGCTTA+CTTGTGCTCAGTGTGTTCAGT (SEQ ID NO：4)；

3. carrying out the expansion and recovery of the exogenous fragment

TABLE 1

cDNA(MO-Ces1C-pUC57)	4ul
		Ces1C-F(50μM)	2ul
Ces1C-R(50μM)	2ul
		10×Pfu PCR BufferⅡ	20ul
2.5mM dNTP Mixture	16ul
		Pfu DNA polymerase	2ul
dH2O	154ul

After the addition of the pipette and mixing, PCR amplification was performed according to the following procedure:

after the amplification, the target fragment was 1608bp in length by running on a 1% agarose gel, and the identity was confirmed as shown in FIG. 1.

As can be seen from FIG. 1, after the amplification of the exogenous fragment, the gel was run on 1% agarose gel, and the target fragment length was 1608bp, which was consistent with the expected length, and the next double-restriction enzyme digestion was performed.

3. Vector double digestion

The yeast vector pPic9K was digested separately with SnaB I/Not I and the results of the double digestion were confirmed, see FIG. 2; after vector double digestion, the yeast vector pPic9K showed consistent digestion with the expected results, as shown in FIG. 2. The actual size is 9200 bp.

4. Cloning

(1) The ligation reaction system (10. mu.L) of the exogenous DNA fragment and the vector enzyme digestion product is as follows:

TABLE 2

Reagent	Exogenous fragment	Carrier	Buffer	T4 ligase	Sterile water
						Sample addition amount (μ L)	4	2	1	1	2

Lightly blowing and sucking by a gun, uniformly mixing, and connecting for more than 2 hours at the temperature of 22 ℃;

(2) the competent cells were removed from the-80 ℃ freezer and thawed on ice. Gently open the lid and add ligation product (10 μ L);

(3) and (3) lightly blowing and sucking and rotating the gun head to fully and uniformly mix the DNA and the competent cells. Standing on ice for 30 min;

(4) carrying out heat shock for 90s at the temperature of 42 ℃;

(5) ice for 1 min;

(6) 800. mu.L of pre-warmed LB medium was added and placed in a shaker at 37 ℃ at 158rpm/120 min. Centrifuging at 6000rpm for 4 min;

(7) discarding 800 μ L of supernatant in a super clean bench, mixing the rest bacteria liquid uniformly, and coating on a flat plate containing corresponding antibiotics;

(8) and (5) inverting the plate, culturing in a constant-temperature incubator at 37 ℃, and allowing colonies to appear after 12-16 h.

(9) And (3) carrying out spot picking detection, wherein a specific primer (see primer design) of the Ces1C is selected as a primer in a detection system, the result is shown in figure 3, the size of a band is about 1608bp after PCR amplification, the positive rate of the yeast vector pPic9K is 4/6, and the selected positive clone conforms to the expectation after sequencing. Can be used for the induction expression of the next step.

Transforming and recombining the greatly extracted plasmid, linearizing the plasmid by using SacI, recovering and electrically transforming GS115 competence by an electric transformation instrument, and the result is shown in figure 4;

(10) and selecting four monoclonal bacteria liquid with positive results, inoculating the monoclonal bacteria liquid into 3ml of LB culture medium added with corresponding antibiotics for culture overnight, preserving the seeds the next day, and sending the seeds to Wuhan Jinkei gene engineering Co., Ltd for sequencing analysis without mutation.

5. Yeast cell expression

(1) Plasmid transformation recombination scheme

a. Inoculating the positive monoclonal bacterium liquid into 3ml LB culture medium (Amp concentration is 1mg/ml/Kan concentration is 50ug/ml), and then transferring to 300ml LB culture medium overnight;

b. extracting plasmid greatly, measuring the purity of the plasmid by an ultraviolet spectrophotometer, and ensuring that the OD260/280 value is near 1.8;

c. the recombinant plasmid is linearized by SacI, and the quality control enzyme digestion efficiency is 100%;

d. linearized recovery and conversion is shown in FIG. 4. After the quality control linearization recovery, the plasmid concentration is more than 1ug/ul, an Eppendorf electrical transformation instrument is used for electrically transforming the GS115 competence, and the electrical transformation parameters are as follows: voltage, 1500V; time 5 ms. The GS115 competence OD600 value was controlled at 0.8.

(2) Positive seed screening

a. The plasmid containing the desired sequence after electrotransformation was applied to RDB plates and screened by G418 (G418 concentration 1 mg/ml). After 4 days, about 200 single colonies grow on the 1mg/ml RDB plate, and 20 single colonies are picked from the 1mg/ml RDB plate for screening, as shown in FIG. 5, about 200 single colonies can be seen;

b. and performing PCR identification on the marked 20 single colonies, detecting whether the plasmids are transferred into the host GS115 or not, and confirming that the recombinants are expected as shown in FIG. 6, wherein the plasmids are transferred into the host GS 115.

Example 2 protein expression and purification

1. Induced amplification

(1) Selecting No. 7 positive seeds with the brightest PCR identification bands to 1ml of YPD liquid culture medium, and inoculating 10ul of bacterial liquid to 10ml of YPD liquid culture medium after 24 hours;

(2) after 24h the culture became milky white, 10ml of the culture was inoculated into 1L YPD medium (inoculum size 1%). Culturing at 30 deg.C and 230 rpm/min;

(3) OD of the culture solution was determined after about 24 hours₆₀₀During determination, the YPD culture medium is used as a control for zero adjustment, 2940ul of the YPD culture medium is sucked into a cuvette, and 60ul of culture solution is simultaneously taken and uniformly mixed in the cuvette for determination;

(4) measuring the OD of the cells by 50-fold dilution₆₀₀When the value reaches 0.6-0.7 (about 24h), the culture solution is poured into two sterilized and cooled 500ml Xiang instrument centrifuge tubes on a clean bench, the rpm is 6000/min, the temperature is 4 ℃, after centrifugation for 5min, the supernatant is poured off on the clean bench. The resuspended cells were poured into a 5L Erlenmeyer flask using 900ml YP medium, and the induction was started by adding 100ml of 1M phosphate buffer (working phosphate concentration 0.1M) sterilized and 10ml of 100% methanol (working methanol concentration 1%) added to the system;

(6) adding 10ml of 100 percent methanol into the system every 24 hours;

(7) taking the moment of adding methanol for the first time as zero time, after about 48 hours, pouring the culture solution into two 500ml Xiang instrument centrifuge tubes, and centrifuging at 6000rpm/min at 4 ℃ for 10min, and then collecting the supernatant.

2. Protein purification

(1) Placing the gasket into the column, soaking with 20% ethanol for 10min, removing air bubbles in the gasket, transferring the gasket, and reserving a small amount of 20% ethanol in the column;

(2) sucking 2-3ml of nickel agarose gel into the column by using a pipette, opening the lower end of the column, and naturally settling the filler;

(3) washing the column with 3 column volumes of pure water;

(4) equilibrating the column with 3 column volumes of NTA-0 to bring the pH to 8.0;

(5) adjusting the pH of the centrifuged sample to 8.0 (about 300M plus 30ml of 1M Tris-HCl, pH 9.0) with 1M Tris-HCl pH 9.0, and starting the sample loading at a flow rate of 1.2 ml/min;

(6) after the sample is loaded, washing the column by NTA-0 until the peak value of the nucleic acid protein detector is unchanged and the G250 is not developed by the liquid flowing out from the lower end;

(7) collecting 250mM imidazole-eluted protein, and performing centrifugal ultrafiltration for 30min by using an ultrafiltration tube at 3500 r/min;

(8) the SDS-PAGE gel was examined, and the purified SDS-PAGE gel was shown in FIG. 7, which shows that the purity was > 90%.

Example 3 protein Activity assay

1. Determining an activity test substrate to be 4-Nitrophenyl acetate (4-NPA) through an enzymolysis principle and related documents, carrying out enzymolysis on the activity test substrate to be 4-Nitrophenol under the action of a Ces1C enzyme, and determining the sensitivity effect of the Ces1C enzyme on the substrate 4-NPA through a pre-experiment;

2. optimizing experimental reaction conditions including substrate solvent, reaction time, temperature, pH, buffering and the like. Determining a substrate solvent as DMSO; the appropriate reaction buffer system is 50-100mM Tris-HCl, pH7.0-8.0; the reaction time is 0-10 min; the temperature condition is 37 ℃;

3. setting the Ces1C enzyme concentration reaction gradient as 0.078. mu.g/ml, 0.156. mu.g/ml, 0.3125. mu.g/ml, 0.625. mu.g/ml, 1.25. mu.g/ml, and the substrate concentration as 1mM 4-NPA, setting the negative controls as reaction buffer and reaction buffer + 1% DMSO, setting the background control as buffer +1mM 4-NPA, and experimentally determining the optimal enzyme reaction concentration as 0.4. mu.g/ml, see FIG. 8;

as can be seen from FIG. 8, when 4-NPA was used as a substrate for detecting the enzymatic activity of Ces1C, the product 4-Nitrophenol could be detected at OD_405nmThe obvious signal of (A) indicates that the Ces1C protein expressed by the yeast expression system can cut the substrate and the detected OD_405nmThe signal is concentration-dependent with respect to the substrate concentration, so that subsequent measurements are selected to be continued at a substrate concentration of 0.4. mu.g/ml.

4. After determination of the optimum enzyme reaction concentration, the substrate 4-NPA gradient was set to 0.0625mM, 0.125mM, 0.25mM, 0.5mM, 1mM, 2mM, and the settings were setEnzyme concentration 0.4 μ g/ml, for substrate concentration exploration, negative controls were set to reaction buffer and reaction buffer + 1% DMSO, background control was set to buffer + 4-NPA of equal concentration gradient, according to Δ OD_405nm-T plot to determine the enzyme reaction rate Δ OD at different substrate concentrations_405nm,/T, FIG. 9;

as is clear from FIGS. 8 and 9, the optimum reaction conditions for the Ces1C enzyme reaction were found by adjusting the conditions for a plurality of times: 50-100mM Tris-HCl, pH7.0-8.0, and the Km value of Ces1C protease expressed by the yeast expression system is detected according to the condition.

5. According to C_{Concentration of substrate}-△OD_405nmThe change values of/T are plotted, and Km of the Ces1C protein expressed by the secretary system is calculated according to the Mie's equation and is shown in figure 10.

In the experiment process, corresponding negative control and equivalent substrate concentration gradient control are set, all data are calculated after being corrected with the substrate control, and as can be seen from FIG. 10, the Km of the Ces1C protease is calculated to be 147.2-242.9 μ M.

Example 4 protein stability and run-to-run testing

The prepared 04165 batches of the Ces1C protein were placed at 37 ℃ for 7 days and 14 days, respectively. After the treatment, experiments were performed according to the activity detection conditions of 2.3.4 together with 03748 new batches of proteins produced by repeating the production process of the Ces1C protein, and the results are shown in fig. 11, which indicate that the protein stability is good, in order to determine the thermal stability and the batch-to-batch stability of the Ces1C protein.

In conclusion, the high-purity Ces1C protein can be obtained by amplifying and expressing the Ces1C through a yeast expression system, the purity of the protein reaches up to 90 percent, and the rapid and high-flux activity detection and screening of the Ces1C protein can be realized through the groped activity detection experiments. Meanwhile, the obtained protein is subjected to thermal stability (standing for 0 day, 7 days and 14 days at 37 ℃) and batch-to-batch difference experimental tests, and the results show that the protein is good in stability and small in batch-to-batch control difference, can realize yield quantification and provide an experimental basis for Ces1C enzyme related research.

Comparative example 1

This comparative example is an unoptimized Ces1C protein, the amino acid sequence according to the extracellular structure of Ces1C is shown in SEQ ID NO: 2, constructing an expression vector according to the method shown in the example 1; wherein the restriction enzyme cutting site of the vector is still pPic9K (SnaB I/Not I), and only the primer of the Ces1C protein which is Not optimized is different,

Ces1C-F:ATGCTACGTA+CATCATCACCATCACCAT+CACTCTTTGTT GCCACCAGT(SEQ ID NO：5)

Ces1C-R:CGTAGCGGCCGC+TTA+CTTGTGCTCAGTGTGTTCAGT (SEQ ID NO：6)

expression and purification were performed according to the method shown in example 2.

When the Ces1C protein expressed in the large intestine is prepared in the early stage, the protein is purified, the protein purity is good, but the protein detection is inactive.

As shown in fig. 12-13, the unoptimized Ces1C enzyme activity expressed by both large intestines was measured as follows: the Ces1C enzyme gradient of the large intestine expression system with different concentrations is set to carry out enzymolysis experiments on the 4-NPA substrate, the overall signal change of the enzyme activity experiments is small within 20min, and no obvious activity trend exists.

It should be noted that the above examples are only for further illustration and description of the technical solution of the present invention, and are not intended to further limit the technical solution of the present invention, and the method of the present invention is only a preferred embodiment, and is not intended to limit the protection scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<120> high-purity high-activity Ces1C protein, expression vector and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1608

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cactctttgt tgccaccagt tgtcgacact acccaaggta aggttctggg aaagtacatc 60

tccttggagg gtttcgaaca accagtcgct gttttcttgg gtgttccatt tgctaagcca 120

ccattgggtt ccttgagatt cgctccacca caaccagctg aaccatggtc ttttgttaag 180

aacgccactt cttacccacc aatgtgttct caagatgctg gttgggctaa gatcctgtct 240

gacatgttct ccaccgagaa agagatcctg ccattgaaga tttccgagga ctgcctgtac 300

ctgaacatct actctccagc tgacttgacc aagtcctctc agttgccagt tatggtttgg 360

attcacggtg gtggtttggt tattggtggt gcttctccat acaacggttt ggctttgtct 420

gctcacgaga acgttgttgt tgtcaccatc cagtacagac ttggtatctg gggtttgttc 480

tctactggtg acgaacactc tccaggtaac tgggctcatt tggatcaatt ggctgccttg 540

agatgggtcc aagacaacat tgctaacttc ggtggtaacc cagactccgt cactattttc 600

ggtgaatcct ctggtggtat ctccgtttcc gttttggttt tgtccccact tggtaaggac 660

ttgttccaca gagctatttc cgagtccggt gttgtcatca acactaacgt cggtaagaag 720

aacatccagg ccgtcaacga gattatcgct actttgtccc agtgtaacga cacttcttcc 780

gctgctatgg ttcagtgctt gagacaaaag actgagtccg agctgttgga gatttccggt 840

aagttggtcc agtacaacat ctccctgtcc actatgatcg acggtgtcgt tttgccaaag 900

gctccagaag aaatcttggc cgagaagtcc ttcaacaccg ttccttacat cgtcggtttc 960

aacaagcaag agttcggttg gatcatccca atgatgttgc agaacttgct gccagagggt 1020

aagatgaacg aagagactgc ttccttgctg ctgagaagat tccactccga gttgaacatc 1080

tccgagtcca tgattccagc tgtcatcgag caatacttga gaggtgttga cgacccagct 1140

aagaagtctg agttgatctt ggacatgttc ggtgacattt tcttcggtat cccagccgtc 1200

ttgttgtcca gatctttgag agatgccggt gtctccactt acatgtacga gttcagatac 1260

agaccatcct tcgtgtctga caagaggcca caaactgttg aaggtgatca cggtgacgag 1320

atctttttcg ttttcggtgc cccattgctg aaagaaggtg cttctgaaga ggaaactaac 1380

ctgtctaaga tggtcatgaa gttctgggcc aacttcgcca gaaacggtaa cccaaatggt 1440

gaaggtttgc cacactggcc agaatacgat gaacaagagg gttacttgca gatcggtgct 1500

actactcaac aggcccaaag attgaaggct gaagaggttg ctttctggac cgagttgttg 1560

gctaagaacc caccagaaac tgacccaact gaacacactg agcacaag 1608

<210> 2

<211> 536

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

His Ser Leu Leu Pro Pro Val Val Asp Thr Thr Gln Gly Lys Val Leu

1 5 10 15

Gly Lys Tyr Ile Ser Leu Glu Gly Phe Glu Gln Pro Val Ala Val Phe

20 25 30

Leu Gly Val Pro Phe Ala Lys Pro Pro Leu Gly Ser Leu Arg Phe Ala

35 40 45

Pro Pro Gln Pro Ala Glu Pro Trp Ser Phe Val Lys Asn Ala Thr Ser

50 55 60

Tyr Pro Pro Met Cys Ser Gln Asp Ala Gly Trp Ala Lys Ile Leu Ser

65 70 75 80

Asp Met Phe Ser Thr Glu Lys Glu Ile Leu Pro Leu Lys Ile Ser Glu

85 90 95

Asp Cys Leu Tyr Leu Asn Ile Tyr Ser Pro Ala Asp Leu Thr Lys Ser

100 105 110

Ser Gln Leu Pro Val Met Val Trp Ile His Gly Gly Gly Leu Val Ile

115 120 125

Gly Gly Ala Ser Pro Tyr Asn Gly Leu Ala Leu Ser Ala His Glu Asn

130 135 140

Val Val Val Val Thr Ile Gln Tyr Arg Leu Gly Ile Trp Gly Leu Phe

145 150 155 160

Ser Thr Gly Asp Glu His Ser Pro Gly Asn Trp Ala His Leu Asp Gln

165 170 175

Leu Ala Ala Leu Arg Trp Val Gln Asp Asn Ile Ala Asn Phe Gly Gly

180 185 190

Asn Pro Asp Ser Val Thr Ile Phe Gly Glu Ser Ser Gly Gly Ile Ser

195 200 205

Val Ser Val Leu Val Leu Ser Pro Leu Gly Lys Asp Leu Phe His Arg

210 215 220

Ala Ile Ser Glu Ser Gly Val Val Ile Asn Thr Asn Val Gly Lys Lys

225 230 235 240

Asn Ile Gln Ala Val Asn Glu Ile Ile Ala Thr Leu Ser Gln Cys Asn

245 250 255

Asp Thr Ser Ser Ala Ala Met Val Gln Cys Leu Arg Gln Lys Thr Glu

260 265 270

Ser Glu Leu Leu Glu Ile Ser Gly Lys Leu Val Gln Tyr Asn Ile Ser

275 280 285

Leu Ser Thr Met Ile Asp Gly Val Val Leu Pro Lys Ala Pro Glu Glu

290 295 300

Ile Leu Ala Glu Lys Ser Phe Asn Thr Val Pro Tyr Ile Val Gly Phe

305 310 315 320

Asn Lys Gln Glu Phe Gly Trp Ile Ile Pro Met Met Leu Gln Asn Leu

325 330 335

Leu Pro Glu Gly Lys Met Asn Glu Glu Thr Ala Ser Leu Leu Leu Arg

340 345 350

Arg Phe His Ser Glu Leu Asn Ile Ser Glu Ser Met Ile Pro Ala Val

355 360 365

Ile Glu Gln Tyr Leu Arg Gly Val Asp Asp Pro Ala Lys Lys Ser Glu

370 375 380

Leu Ile Leu Asp Met Phe Gly Asp Ile Phe Phe Gly Ile Pro Ala Val

385 390 395 400

Leu Leu Ser Arg Ser Leu Arg Asp Ala Gly Val Ser Thr Tyr Met Tyr

405 410 415

Glu Phe Arg Tyr Arg Pro Ser Phe Val Ser Asp Lys Arg Pro Gln Thr

420 425 430

Val Glu Gly Asp His Gly Asp Glu Ile Phe Phe Val Phe Gly Ala Pro

435 440 445

Leu Leu Lys Glu Gly Ala Ser Glu Glu Glu Thr Asn Leu Ser Lys Met

450 455 460

Val Met Lys Phe Trp Ala Asn Phe Ala Arg Asn Gly Asn Pro Asn Gly

465 470 475 480

Glu Gly Leu Pro His Trp Pro Glu Tyr Asp Glu Gln Glu Gly Tyr Leu

485 490 495

Gln Ile Gly Ala Thr Thr Gln Gln Ala Gln Arg Leu Lys Ala Glu Glu

500 505 510

Val Ala Phe Trp Thr Glu Leu Leu Ala Lys Asn Pro Pro Glu Thr Asp

515 520 525

Pro Thr Glu His Thr Glu His Lys

530 535

<210> 3

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgctacgta catcatcacc atcaccatca ctctttgttg ccaccagt 48

<210> 4

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgtagcggcc gcttacttgt gctcagtgtg ttcagt 36

<210> 5

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgctacgta catcatcacc atcaccatca ctctttgttg ccaccagt 48

<210> 6

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgtagcggcc gcttacttgt gctcagtgtg ttcagt 36

Claims (10)

1. The high-purity high-activity Ces1C protein is characterized in that the nucleotide sequence for coding the high-purity high-activity Ces1C protein is shown as SEQ ID NO: 1 is shown.

2. A nucleic acid molecule encoding the Ces1C protein of claim 1, wherein the nucleic acid molecule has the nucleotide sequence set forth in SEQ ID NO: 1 is shown.

3. A recombinant expression vector of the highly pure and highly active Ces1C protein according to claim 1, wherein the recombinant expression vector is obtained by inserting the nucleic acid molecule according to claim 2 into a multiple cloning site of the expression vector.

4. The recombinant expression vector of claim 3, wherein the expression vector further comprises a coding tag sequence upstream of the nucleic acid molecule, wherein the coding tag sequence comprises one of a His tag, an HA tag, and a Flag tag.

5. The recombinant expression vector of Ces1C protein with high purity and high activity according to any one of claims 3-4, wherein the expression vector comprises one of prokaryotic expression vector, eukaryotic expression vector and viral expression vector.

6. A method for preparing a recombinant expression vector of Ces1C protein with high purity and high activity, which comprises the following steps:

obtaining the peptide shown as SEQ ID NO: 1, a target gene segment shown in the specification;

adopting the target gene fragment as SEQ ID NO: 3-4, carrying out PCR to obtain a PCR product;

and carrying out double enzyme digestion on the yeast vector pPic9K by SnaB I/Not I, and then carrying out enzyme ligation on the PCR product to obtain an expression vector pPic9K-Ces 1C.

7. A recombinant cell line or recombinant expression strain for expressing the high-purity and high-activity Ces1C protein of claim 1, comprising the recombinant expression vector prepared by the method of any one of claims 3 to 4 or claim 5.

8. A method for preparing the high purity and high activity Ces1C protein according to claim 1, comprising: the recombinant cell line or recombinant expression bacterium of high purity and high activity of Ces1C protein of claim 7, which is obtained by inducing, expressing and purifying.

9. The use of the high purity and high activity Ces1C protein of claim 1 for screening for Ces inhibitor products and/or for preparing toxin-clearing products.

10. A method for detecting the activity of Ces1C protein, which comprises the following steps:

dissolving a substrate 4-NPA with the concentration of C in a substrate solvent and a buffer solution to obtain a mixed solution; wherein the buffer solution comprises 50-100mM Tris-HCl, pH7.0-8.0; the concentration C of the substrate 4-NPA is 0.3125-0.625 mug/ml;

adding the Ces1C protein to be detected for activity into the mixed solution for enzymolysis reaction to obtain an enzyme reaction speed;

according to the concentration C of the substrate 4-NPA and the enzyme reaction speed, the Km value of the Ces1C protein is obtained.

Images