CN113436680B

CN113436680B - Method for simultaneously identifying chromosome structural abnormality and carrier state of pathogenic gene of embryo

Info

Publication number: CN113436680B
Application number: CN202110566362.7A
Authority: CN
Inventors: 张硕; 雷彩霞; 孙晓溪; 徐丛剑
Original assignee: Shanghai Jiai Genetics And Infertility Diagnosis And Treatment Center Co ltd; Obstetrics and Gynecology Hospital of Fudan University
Current assignee: Shanghai Jiai Genetics And Infertility Diagnosis And Treatment Center Co ltd; Obstetrics and Gynecology Hospital of Fudan University
Priority date: 2020-05-22
Filing date: 2021-05-24
Publication date: 2022-03-25
Anticipated expiration: 2041-05-24
Also published as: CN113436680A

Abstract

A method for simultaneously identifying chromosome structural abnormality and carrier state of pathogenic gene of embryo. The present invention is in the field of genetic diagnosis and assisted reproduction by humans. The invention constructs a comprehensive universal technical method based on a family whole genome haplotype analysis model, and the method can detect not only the pathogenic gene of the embryo but also the chromosome aneuploidy and the chromosome structural abnormality of the embryo by only one detection, thereby providing guidance for the embryo accurate diagnosis of a hereditary patient and having important clinical significance.

Description

Method for simultaneously identifying chromosome structural abnormality and carrier state of pathogenic gene of embryo

The priority of the Chinese patent application entitled "a method for simultaneously identifying structural abnormalities of embryo chromosomes and carrying states of pathogenic genes" filed by the Chinese patent office at 22.5.2020 and having application number of 202010443663.6 is claimed in the present application, which is incorporated herein by reference in its entirety.

Technical Field

The invention belongs to the field of gene diagnosis and human assisted reproduction, and particularly relates to a method for simultaneously identifying the abnormal equilibrium structure of an embryo chromosome and the carrying state of a pathogenic gene.

Background

Monogenic genetic disorders refer to disorders in which a single or single pair of allelic mutations result in abnormal development or physiological function of the body structure, generally following Mendelian inheritance rules. The types of the existing definite monogenic diseases exceed 1 ten thousand, and the total morbidity of the population is about 1 percent due to the numerous types of the monogenic diseases, thereby bringing huge economic and mental burdens to tens of millions of families and patients. For a long time, monogenic diseases can be neither prevented nor treated, subject to the limitations of detection techniques. With the rapid development of molecular biology technology, many monogenic diseases can be diagnosed in fetal stage by prenatal diagnosis technology or in embryonic stage by assisted reproduction technology, so as to prevent the birth of the defective infant. However, due to the requirement of prenatal diagnosis for the gestational period and various injuries caused by induction of labor, more and more families select assisted reproduction technology to block diseases, namely selecting non-diseased embryos for transplantation after diagnosis is made at the embryo stage by embryo pre-implantation Genetic Testing-Genetic disease (PGT-M) technology.

The PGT-M detection method mainly comprises a first-generation sequencing method and a haplotype analysis method, wherein the first-generation sequencing method is earlier in application, the method can directly detect the mutation site of the embryo biopsy cells, but the Allele dropout (Allele drop-out) exists, so that the misdiagnosis rate is higher. The haplotype analysis method is to select genetic markers such as Short Tandem Repeats (STR) or Single Nucleotide Polymorphism (SNP) loci from upstream and downstream of a pathogenic gene and determine the carrying condition of the embryonic pathogenic gene in a pedigree with predecessor through linkage analysis. If STR loci are selected, STR design is carried out for each single-gene disease, and the STR loci can be used for PGD after family verification, the process is long in time and high in cost, STR genetic markers in a genome are distributed less, and insufficient STRs are not available near some pathogenic genes for haplotype analysis. Compared with STR, SNP genetic markers contain more abundant genetic information, and the number of the SNP genetic markers is 1 per 500 bases, so that the SNP genetic markers are more applied to PGT-M of monogenic diseases in recent years. However, the traditional haplotype analysis method cannot detect the ploidy of embryo chromosomes while detecting the mutation of target pathogenic genes due to the technical limitation, so that the embryos which are detected by PGT-M and are non-pathogenic genes still can be chromosome aneuploidy (including complete aneuploidy and partial aneuploidy), and further cause the bad fate of abortion, birth defects and the like after embryo transplantation, and the aneuploidy detection needs to be carried out again by experiments. And requires the presence of probands, which are difficult to block by conventional assisted reproduction techniques in cases without probands.

The chromosome structural abnormality is also called chromosome rearrangement, refers to chromosome aberration generated by chromosome or chromosome monomers through a breaking-rearrangement or interchange mechanism, mainly comprises chromosome balance translocation and chromosome inversion clinically, is closely related to bad pregnancy ending such as infertility, recurrent abortion, stillbirth, neonatal hypoevolutism and other congenital malformations, and is an important reason for causing the infertility and early recurrent abortion. The chromosome balance translocation mainly comprises reciprocal translocation and Robertsonian translocation, and the incidence rate of the chromosome balance translocation in the population is about 0.27 percent, and the incidence rate in the population with repeated spontaneous abortion can reach 3.81 percent. The chromosome inversion is divided into intrabrachial inversion and interbrachial inversion according to whether the position of the breakpoint contains centromere, and the incidence rate of pathogenic inversion in Chinese fertility-impaired people is about 0.22%. The early abortion rate can reach more than 90 percent without intervention, repeated uterine cleaning operation, infection, uterine cavity adhesion and the like are caused to female patients, and the health status of women of childbearing age in physical and mental aspects is greatly influenced. The people are difficult to naturally pregnancy, at present, the chromosome euploid embryo of the patient is screened and transplanted to improve the pregnancy outcome clinically mainly through the Genetic detection before implantation of an assisted reproduction technology (PGT-SR), the detection method mainly comprises a fluorescence in situ hybridization technology, real-time fluorescence quantitative nucleic acid amplification, a gene chip, secondary sequencing and the like, and the PGT-SR is the main pregnancy-assisting method of the couples and can reduce the birth defect problem caused by the abnormal chromosome number.

However, the PGT-SR detection methods commonly used in clinic have common limitations: the chromosome aneuploidy of the embryo can be detected only, but the chromosome structural abnormality of the embryo cannot be detected, namely, the chromosome structural abnormality in the whole-time embryo cannot be further distinguished from the embryo with a normal structure. This results in that in the newborn born by the conventional PGT-SR, 50% of the newborn born is still theoretically the carrier with abnormal chromosome structure, and the same infertility and recurrent abortion which are the same as the parents of the newborn are generated in the period from the birth of the adult to the marriage and birth, which endanger the reproductive health. Therefore, how to break through the traditional technology is to detect the chromosome structural abnormality and chromosome aneuploidy of the embryo before the embryo is implanted, and preferentially transplant the embryo with normal chromosome euploid and structure, thereby fundamentally blocking the genetic transmission of the genetic disease and simultaneously solving the current reproductive difficulty of the patient and the potential reproductive risk of the next generation after adulthood.

In recent years, some related technical reports exist in the aspect of screening chromosome structural abnormality in domestic and foreign research, but the methods have great limitations: firstly, only chromosome structural abnormality and chromosome aneuploidy of the embryo can be detected respectively, and multiple detection experiment operations are needed; secondly, individual design is needed according to the position of a fracture point of the chromosome of the patient, the technology is relatively complex, the time consumption is long, the universality is not high, and the popularization and the application in the reproductive center are difficult. The early research of the inventor creatively avoids the difficulty of directly detecting the embryo breakpoint, the genetype is constructed by two couples of patients and a reference sample through genetype sample collection, the embryo chromosome aneuploidy detection is carried out, the genetype of the chromosome with abnormal structure and the genetype of the chromosome with normal structure are determined through linkage analysis, an embryo chromosome structure abnormality detection model is established, the embryo chromosome structure is accurately distinguished by identifying whether the embryo carries the chromosome with abnormal structure or not, namely, the analysis of the chromosome structure abnormality and the chromosome aneuploidy can be simultaneously completed through one-time detection.

Because the morbidity of both monogenic diseases and chromosome structural abnormalities in the population is high, the patients carrying the two genetic diseases have a certain proportion in the population, and the patients basically have no proband of the monogenic diseases, and because of the limitation of detection technology, no detection technology related to assisted reproductive therapy is reported for the patient population at present. The research hopes to construct a new detection technical method, which can carry out accurate genetic detection before embryo implantation on the cases carrying single-gene disease pathogenic mutation and chromosome structure abnormality simultaneously, namely, through one-time detection, the gene abnormality, chromosome aneuploidy and chromosome structure abnormality are detected in the embryo stage, and the embryo with normal transplanted gene and chromosome is used for fundamentally blocking the inheritance of the next generation and preventing birth defects.

Disclosure of Invention

Aiming at the blank existing in the prior art, the invention constructs a comprehensive universal technical method based on a family whole genome haplotype analysis model, and the method can detect not only the pathogenic gene of the embryo but also the chromosome aneuploidy and the chromosome structure abnormality of the embryo only by one-time detection, and the various abnormalities do not need to be detected respectively, thereby providing guidance for accurate embryo diagnosis of a genetic disease patient.

The specific technical scheme of the invention is as follows:

the invention provides a construction method of a reference sample haplotype in a family haplotype for identifying the structural abnormality of an embryo chromosome and/or the carrying state of a pathogenic gene, which comprises the following steps:

(1) genotyping of the sample: the following subjects were subjected to large-scale SNP genotype detection:

a. both couples having chromosome structural abnormality and/or carrier of pathogenic gene; and the combination of (a) and (b),

b. at least one carrier relative, progeny carrying a disease-causing gene, or a chromosomally abnormal embryo;

wherein, the carrier relatives can be relatives with the same chromosome structure abnormality and/or pathogenic genes as the carrier, and can also be relatives with normal chromosomes and/or genes;

the above a and b are referred to as reference samples;

(2) determining the SNPs site of the information:

a. when the reference sample contains carrier relatives, the carrier is heterozygous in the chromosome structural abnormality and/or the carrier of the pathogenic gene, homozygous in the partner thereof, and SNP sites that are also homozygous in the carrier relatives are the sites of the SNPs;

b. when the reference sample contains offspring carrying pathogenic genes or embryos with chromosome abnormality, the reference sample is heterozygous in chromosome structure abnormality and/or carriers of the pathogenic genes, and SNP loci which are homozygotic in partners thereof are information SNPs loci;

(3) construction of pedigree haplotypes reference sample haplotypes: and (3) gathering the SNPs sites determined in the step (2) to obtain a haplotype of the whole chromosome covering the pathogenic gene, the chromosome of the pathogenic gene and the homologous chromosome of the allele corresponding to the pathogenic gene, the two chromosome structure abnormal breakpoint regions, the whole chromosome of the structure abnormal chromosome and the homologous chromosome thereof through family linkage analysis, and obtaining the reference sample haplotype in the family haplotype.

The invention provides a construction system for identifying a reference sample haplotype in a family haplotype of an embryo chromosome structural abnormality and/or a pathogenic gene carrying state, which comprises software capable of calculating and processing sample data and hardware for bearing the software,

(1) the system also includes hardware storing genotyping data for large scale SNP genotyping detection of a reference sample; the reference samples are: a. both couples having chromosome structural abnormality and/or carrier of pathogenic gene; at least one carrier relative, progeny carrying a disease causing gene, or a chromosomally abnormal embryo; wherein, the carrier relatives can be relatives with the same chromosome structure abnormality and/or pathogenic genes as the carrier, and can also be relatives with normal chromosomes and/or genes;

(2) the software determines the sites of the information SNPs according to the following rules:

(3) the software constructs the reference sample haplotype from the family haplotype according to the following principles: and (3) gathering the SNPs sites determined in the step (2) to obtain a haplotype of the whole chromosome covering the pathogenic gene, the chromosome of the pathogenic gene and the homologous chromosome of the allele corresponding to the pathogenic gene, the two chromosome structure abnormal breakpoint regions, the whole chromosome of the structure abnormal chromosome and the homologous chromosome thereof through family linkage analysis, and obtaining the reference sample haplotype in the family haplotype.

The invention provides a construction method of a family haplotype for identifying the chromosome structural abnormality and/or the carrier state of a pathogenic gene of an embryo, which comprises the following steps:

a. both couples having chromosome structural abnormality and/or carrier of pathogenic gene;

b. at least one carrier relative, progeny carrying a disease-causing gene, or a chromosomally abnormal embryo; and the combination of (a) and (b),

c.a in vitro fertilized embryo of a carrier couple;

the above a and b are referred to as reference samples; c is called the pending sample;

(2) determining the SNPs site of the information:

(3) constructing a family haplotype: and (3) gathering the SNPs sites determined in the step (2) to obtain haplotypes of the whole chromosomes covering the pathogenic genes, the chromosomes of the pathogenic genes and the homologous chromosomes, the two chromosome structure abnormal breakpoint regions, the whole chromosomes of the structure abnormal chromosomes and the homologous chromosomes thereof corresponding to the chromosomes of the pathogenic genes through family linkage analysis, wherein the set of the haplotypes of different chromosomes is called as a family haplotype.

The invention provides a construction system for identifying a family haplotype of an embryo chromosome structural abnormality and/or a pathogenic gene carrying state, which comprises software capable of calculating and processing sample data and hardware for bearing the software,

(1) the system also includes hardware storing genotyping data for large scale SNP genotyping of a reference sample and a sample to be determined; the reference samples are: a. both couples having chromosome structural abnormality and/or carrier of pathogenic gene; at least one carrier relative, progeny carrying a disease causing gene, or a chromosomally abnormal embryo; the pending sample is an in vitro fertilized embryo of the carrier couple; wherein, the carrier relatives can be relatives with the same chromosome structure abnormality and/or pathogenic genes as the carrier, and can also be relatives with normal chromosomes and/or genes;

(3) the software constructs family haplotypes according to the following principles: the haplotype of the whole chromosome covering the pathogenic gene, the chromosome of the pathogenic gene and the homologous chromosome of the allele corresponding to the pathogenic gene, the two chromosome structure abnormal breakpoint regions, the whole chromosome of the structure abnormal chromosome and the whole chromosome of the homologous chromosome thereof is obtained by family linkage analysis according to the information SNPs sites selected by the standards on each chromosome, and the set of the haplotypes of different chromosomes is called as the family haplotype.

The method or system of the invention, wherein the chromosomal structural abnormality comprises a chromosomal balance translocation and a chromosomal inversion; the chromosomal balance translocation includes reciprocal translocation and Robertsonian translocation.

The invention provides a method for identifying chromosome structural abnormality and/or carrying state of a pathogenic gene of an embryo, which comprises the following steps:

c.a in vitro fertilized embryo of a carrier couple;

(2) determining the SNPs site of the information:

(3) constructing a family haplotype: gathering the SNPs sites determined in the step (2) to obtain haplotypes of the whole chromosomes covering the pathogenic genes, the chromosomes where the pathogenic genes are located and the homologous chromosomes where the alleles corresponding to the pathogenic genes are located, the two chromosome structure abnormal breakpoint regions, the whole chromosomes of the structure abnormal chromosomes and the homologous chromosomes of the whole chromosomes of the structure abnormal chromosomes through family linkage analysis, wherein the set of the haplotypes of different chromosomes is called as a family haplotype;

(4) data collection and analysis:

1) when using two couples of a carrier with chromosome structural abnormality and/or pathogenic gene and relatives with the carrier with the same chromosome structural abnormality and/or pathogenic gene as reference samples:

a. if the pathogenic gene or the chromosome structure abnormality breakpoint region of the undetermined sample does not have homologous recombination, when the haplotype information of the pathogenic gene or the chromosome structure abnormality breakpoint region of the undetermined sample is consistent with the haplotype information of the carrier and the relatives with the same chromosome structure abnormality and/or the pathogenic gene with the carrier, judging that the undetermined sample carries the pathogenic gene or the chromosome structure abnormality carries the embryo; when the haplotype information of the pathogenic gene or the chromosome structural abnormality breakpoint region of the undetermined sample is consistent with the haplotype information of the structural abnormality and/or pathogenic gene carrier in the reference sample, but is not consistent with the haplotype information of the relatives with the same chromosome structural abnormality and/or pathogenic gene with the carrier, judging that the undetermined sample is carried by the non-pathogenic gene or carries the embryo by the non-chromosome structural abnormality;

b. if homologous recombination occurs in the pathogenic gene or chromosome structure abnormal breakpoint region of the undetermined sample:

i. if the chromosome structural abnormality is chromosome balance translocation, the judgment standard is opposite to a;

if the chromosome structural abnormality is chromosome inversion, the judgment standard is that when only one end or two ends of 1 breakpoint region occur homologous recombination, the judgment rule is the same as a; when only one end of each of the 2 breakpoint regions is subjected to homologous recombination, the judgment rule is the same as a; when the two ends of the 2 breaking point regions are subjected to homologous recombination, the judgment result is opposite to a;

2) when reference is made to both couples of a carrier of a chromosomal abnormality and/or a pathogenic gene, and relatives of chromosomal normality:

a. if the pathogenic gene or the chromosome structure abnormal breakpoint region of the undetermined sample does not have homologous recombination, when the haplotype information of the pathogenic gene or the chromosome structure abnormal breakpoint region of the undetermined sample is consistent with the haplotype information of the carrier and the normal relatives of the carrier, judging that the undetermined sample is carried by the non-pathogenic gene or carries the embryo by the chromosome structure abnormality; when the haplotype information of the pathogenic gene or the chromosome structural abnormality breakpoint region of the undetermined sample is consistent with the haplotype information of the structural abnormality and/or the pathogenic gene carrier in the reference sample, but is not consistent with the haplotype information of the relatives with the same chromosome structural abnormality and/or the pathogenic gene with the carrier, judging that the undetermined sample carries the pathogenic gene or the chromosome structural abnormality carries the embryo;

3) when offspring carrying a disease-causing gene or a chromosomally abnormal embryo is taken as a reference sample:

a. if the pathogenic gene or the chromosome structure abnormality breakpoint region of the undetermined sample does not have homologous recombination, when the haplotype information of the pathogenic gene or the chromosome structure abnormality breakpoint region of the undetermined sample is consistent with the haplotype information of offspring carrying the pathogenic gene or the chromosome abnormality embryo, judging that the undetermined sample carries the pathogenic gene or the chromosome structure abnormality embryo; if the two are inconsistent, the undetermined sample is judged to be carried by a non-pathogenic gene or carried by an abnormal chromosome structure;

if the chromosome structural abnormality is chromosome inversion, the judgment standard is that when only one end or two ends of 1 breakpoint region occur homologous recombination, the judgment rule is the same as a; when only one end of each of the 2 breakpoint regions is subjected to homologous recombination, the judgment rule is the same as a; when homologous recombination occurs at both ends of the 2 breakpoint regions, the determination result is opposite to a.

The invention provides a system for identifying embryo chromosome structural abnormality and/or pathogenic gene carrying state, the system comprises software capable of calculating and processing sample data and hardware for carrying the software,

(3) the software constructs family haplotypes according to the following principles: the haplotype of the whole chromosome covering the pathogenic gene, the chromosome of the pathogenic gene and the homologous chromosome of the allele corresponding to the pathogenic gene, the two chromosome structure abnormal breakpoint regions, the whole chromosome of the structure abnormal chromosome and the whole chromosome of the homologous chromosome is obtained by family linkage analysis according to the information SNPs sites selected by the standards on each chromosome, and the set of the haplotypes of different chromosomes is called as the family haplotype;

(4) the software compares the haplotype information of the chromosome structure abnormal breakpoint region in the sample to be determined with the haplotype information of the chromosome of the reference sample, and the judgment rule is as follows:

The large-scale SNP genotype detection of the invention covers 23 pairs of chromosomes; the large-scale SNP genotype detection method preferably selects a gene chip or gene sequencing.

In the embryo biopsy, 1-10 cells are obtained as a detection sample of the undetermined sample in biopsy when the embryo develops to 3-7 days; preferably cells derived from an embryonic blastomere biopsy or blastocyst trophectoderm biopsy. Cracking the cells obtained by biopsy, and carrying out whole genome amplification; the whole genome amplification method may be selected from the MDA method, the MALBAC method, or other whole genome amplification methods.

The detection sample source of the reference sample is somatic cells, and peripheral blood is preferred.

According to the method or the system, when the positions of the information SNPs are determined, the information SNPs covering a pathogenic gene, a chromosome where the pathogenic gene is located, a homologous chromosome where an allele corresponding to the pathogenic gene is located, a chromosome structure abnormal breakpoint, a structure abnormal chromosome and a normal homologous chromosome corresponding to the chromosome are selected; selecting at least 1 informative SNP per Mb of the chromosome; in the region covering the breaking point, the information SNPs are selected from the range of 1-30Mb upstream and downstream of the breaking point; preferably, the region of the chromosomal abnormality breakpoint is covered, and the SNPs as the information are selected from the region of 2-4Mb upstream and downstream of the chromosomal abnormality breakpoint, preferably from the region of 2Mb upstream and downstream of the chromosomal abnormality breakpoint.

In the method or system of the present invention, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 information SNPs per Mb of chromosome are selected when determining the sites of the information SNPs.

In the method or system of the present invention, the SNPs are selected from the range of 1 to 5Mb, or 5 to 30Mb upstream and downstream of the breakpoint.

The method for simultaneously identifying the chromosome structural abnormality and the carrying state of the pathogenic gene of the embryo has the following advantages:

(1) the method is not only suitable for patients with both chromosomal disorders and monogenic disorders, but also suitable for patients with only chromosomal disorders or monogenic disorders, and various abnormalities need to be detected only once without being detected separately, so that the method is a comprehensive and general technique;

(2) the method can complete accurate detection of the embryo pathogenic gene, the chromosome aneuploid and the chromosome structural abnormality at the same time through only one detection without a preliminary experiment;

(3) the method can construct the whole genome haplotype of the patient family, has universality, does not need individualized design, and is suitable for all types of monogenic diseases and patients with chromosome structure abnormality;

(4) the method of the invention innovatively carries out detection analysis on the embryo genes and chromosomes through indirect haplotype linkage analysis, and effectively avoids the technical barrier that the pathogenic gene mutation sites and the breakpoint are difficult to be directly detected on the limited embryo cells.

(5) The method of the invention can detect the pathogenic gene of the embryo monogenic disease without proband.

(6) The method disclosed by the invention is short in detection time, can complete all experiments and analysis within 2-3 days, and is suitable for clinical popularization and application.

(7) The accurate treatment of the patient is realized, the pain of the offspring caused by the monogenic disease is blocked, the potential birth defects of the offspring caused by the chromosome structural abnormality are blocked, the good prenatal and postnatal care is really realized, and the health level of the offspring is improved.

Drawings

FIG. 1 is a flow chart of blastocyst culture, biopsy and whole genome amplification.

FIG. 2 is a diagram of a detection and analysis model.

FIG. 3 is a flow chart of validity verification of the detection method of the present invention.

FIG. 4 shows the qPCR quality control site results of DNA products after whole genome amplification of embryo biopsy cells: a represents that the detection result of the sample is positive; b represents that the detection result of the sample is negative; c represents the result of the positive control sample; d represents the result of the negative control sample.

Figure 5 family graph of 6 cases of ovulation induction.

FIG. 6 shows the results of analysis of the model and embryonal haplotype (case-6 for example).

FIG. 7 shows the results of the detection of embryo aneuploidy (case-6).

Detailed Description

1. Case inclusion and pedigree sample collection

When a couple carries a disease-causing gene mutation and a chromosome structural abnormality (the probability of the chromosome structural abnormality is very low in both couples, generally, one couple) at the same time, parents of both couples of a case carry out disease-causing gene mutation and chromosome karyotype analysis respectively, so that the source of the disease-causing gene mutation and the chromosome structural abnormality of both couples of the case is determined, namely, the disease-causing gene mutation or the family inheritance is determined. Collecting peripheral blood samples of parents of both couples and both couples, constructing a basic family and laying a foundation for constructing an analysis model. In the event that a patient parental sample has not been available (e.g., expired), peripheral blood substitutes for the patient's sibling may be collected, but the collection of a sibling sample other than the parental and sibling is not recommended.

2. Construction of embryo detection analysis model

(1) Three family haplotype analysis models

Carrying out SNP typing on a family sample by using a whole genome SNP chip, defining an information SNP (informative SNP) selection standard, carrying out family haplotype linkage analysis on a family information SNP genetic marker, distinguishing two haplotypes of patient alleles or homologous chromosomes through the haplotype analysis, determining the haplotype carrying a pathogenic gene and the haplotype not carrying the pathogenic gene through the linkage analysis, determining the haplotype of a structurally abnormal chromosome and the haplotype of a structurally normal chromosome, and constructing an embryo detection analysis model.

Selection of haplotype analysis region size: in analyzing the breakpoint region, it is sufficient that there are sufficient genetic markers for linkage analysis of the structurally abnormal breakpoint region; when analyzing the whole chromosome haplotype, attention is paid to identifying the homologous recombination condition in the germ cell reduction classification process, and misdiagnosis caused by homologous recombination is avoided. Meanwhile, the uniformity of the distribution of the genetic markers is noticed, and the effective genetic markers exist in the analyzed region.

Different analysis models can be constructed according to different reference samples, the different analysis models have different selection standards for the SNP, and three different analysis models are provided below. The chromosomal origin of each of the effective information SNPs is judged based on the mendelian law of inheritance, and the in-phase (in-phase) and out-of-phase (out-of-phase) are determined according to the genotype of the reference sample (at each effective locus, according to whether the chromosome inherited from each embryo from the chromosomal abnormality and/or the chromosome of the carrier of the causative gene is the same as the chromosome of the reference parent/offspring, if so, the in-phase, and if not, the out-of-phase).

(1-A)When the parent carrying the disease-causing gene or chromosomal structural abnormality is used as a reference, it is required to be satisfied with the disease SNPs that are heterozygous in the patient, homozygous in the patient's spouse and reference; (1-B) when not carrying a pathogenic gene or staining When the normal parent side is used as a reference, the requirements are satisfied that the patient is heterozygous and the patient is pure in the patient spouse and the reference The resultant SNPs.As shown in the following table, the effective site information is shown in the following table, wherein male is a carrier, male father or male mother is a reference relative. (if the female is the carrier, the female father or mother is the reference, the principle is similar.) A represents the pathogenic gene on one chromosome or a certain SNP type of the chromosome, and B represents the corresponding allele type of A on the other homologous chromosome.

(1-C)When offspring carrying a disease-causing gene or a chromosome-abnormal embryo is used as a reference, it is required to satisfy both SNPs heterozygous in patients and homozygous in patient partners(ii) a For example, the male is the carrier, and the unbalanced embryo or offspring is the reference, and the effective locus information is as the following table. (similar principle if the female is the carrier.)

(2) Haplotype-assisted CNV analysis: representing different haplotypes using different colors, respectively

1) Repeated segments-from two chromosomes: if homologous chromosomes from the mother or from the father are repeated, the effective sites in the segment are distributed across the homologous chromosomes, resulting in a mixed two-color typing result. If the mother comes from the mother repeatedly, the color cross distribution of the parting result of the mother is reflected; similarly, if the parent origin is obtained, the color cross distribution is shown as the result of the typing of the parent.

2) Repeated segments-two copies from one chromosome: if multiple copies of one strand from the mother or father are repeated, the effective site in the segment is unchanged and the color distribution is unchanged.

3) Deletion section: assuming that the deletion is from a mother chain, if the filial generation is taken as a reference, the father source effective site (father is AB) in the section is unchanged, and the color distribution of the father chain is unchanged; the maternal active site (AB for mother) was not effective, as reflected by the cross-color distribution of the maternal chain. If the female parent is taken as a reference, the section is represented as a dot-free section because the maternal valid site is invalid.

4) Chimeric deletions and chimeric repeats: although the distribution trend of BAF at sites is different from that of conventional chimeric deletions and chimeric repeats, low proportion of chimerism does not alter the genotype, so there is no abnormality in the distribution of haplotype color of the chimeric segments.

In addition, when the karyotype of the parent peripheral blood chromosome is normal, the chromosome structure abnormality is new variation, and at the moment, only unbalanced embryos can be selected as a reference to establish a family (such as (1-B) above); when the karyotype of the peripheral blood chromosome of one parent is identical, the chromosomal structural abnormality is hereditary, and both the parent (such as (1-A) described above) and the unbalanced embryo (such as (1-B) described above) can be used as references to establish a family.

3. Pre-embryo implantation genetic screening

(1) Carrying out biopsy on in-vitro normal inseminated embryos under a microscope to obtain embryo ectoderm cells by ovulation promotion, carrying out pre-implantation genetic detection on a sample by using the same SNP gene chip after whole genome amplification, and carrying out chromosome aneuploidy detection by SNP allele frequency, namely selecting euploid embryos, wherein triploid and Uniparental diploid (UPD) of the embryos can be detected by the method; meanwhile, diagnosing the genotype of the embryo pathogenic gene to be detected by utilizing an embryo detection analysis model and identifying the haplotype information near the embryo pathogenic gene; and meanwhile, distinguishing the chromosome structural abnormality and the structural normality of the embryo to be detected by identifying the haplotype information near the rearrangement breakpoint of the embryo.

(2) And analyzing the condition of the embryo chromosome by using the haplotypes of the two breakpoint regions of the structurally abnormal chromosome respectively, and comparing the consistency of the detection results of the haplotypes of the breakpoint regions of the two different chromosomes.

(3) The consistency of the embryo detection results of the models constructed under different reference samples was examined when analysis models were constructed using (1-A) parents carrying the same disease-causing gene or chromosomal abnormality as the cases, (1-B) parents not carrying the disease-causing gene or chromosomal abnormality, and (1-C) offspring carrying the disease-causing gene or chromosomal abnormality, respectively.

4. Follow-up of embryo transplantation and verification of model validity

And after the embryo pair which is detected is transplanted, follow-up is carried out, the pregnant woman in the middle of pregnancy is subjected to fetus amniotic puncture prenatal diagnosis, the pathogenic mutation genotype and the chromosome karyotype of the fetus amniotic cells are confirmed, and the effectiveness of the detection analysis model is evaluated. Meanwhile, important physiological indexes of the fetus are monitored and recorded after the fetus comes out.

Unless otherwise specified, specific technical means used in the present invention are conventional technical means which can be grasped by those skilled in the art. The embodiments of the present invention are not intended as specific limitations on the practice of the invention.

Example 1: blastocyst culture, biopsy and whole genome amplification method

After ovulation promotion, intracytoplasmic sperm injection and blastocyst biopsy of a patient, placing biopsy cells in a PCR tube filled with alkaline denaturation buffer solution (KOH) for cell lysis, then carrying out whole genome amplification, and culturing and biopsy of the blastocyst by adopting a clinical conventional method. Genomic DNA from pg scale was amplified to at least ng scale for subsequent experiments. The efficiency of DNA amplification was examined by fluorescence PCR and capillary electrophoresis, and the procedure is detailed in FIG. 1.

MDA method single cell whole genome amplification

1. Two 0.2mL inlet EP tubes were prepared and 2.5. mu.L and 4. mu.L of water were added as volume control tubes for use.

2. And centrifuging the sample for 1min, checking the volume of the liquid, comparing the volume of the liquid with a control tube, photographing and storing the comparison result, recording the comparison result in a book, and making the sample volume traceable.

3. If the sample volume is less than 4 μ L, make up to 4 μ L using PBS; if the sample volume is more than 4 mu L, the sample needs to be reported in time, and after the experiment can be continued, MDA amplification is carried out.

4. Buffer D2 was prepared (the volume of Buffer D2 given in the table below was sufficient for 12 reactions and could be stored at-20 ℃ without complete exhaustion of one experiment, but the storage time could not exceed 3 months).

Components	Volume of
		DTT，1M	3μL
Reconstituted Buffer DLB	33μL
		Total volume	36μL

5. Add 3. mu.L Buffer D2 to each sample tube, mix the tube walls evenly by flicking and centrifuge briefly to collect at the bottom of the tube, and place the centrifuged sample tube into the PCR ice box.

Note that: please ensure that the liquid in the tube does not adhere to the wall of the tube, and do not blow with a pipette, so as to avoid the cell sample adhering to the suction head of the pipette.

6. The PCR instrument was turned on and the PCR program was set as follows: 10min at 65 ℃; hold (hot lid temperature: 105 ℃ C.).

7. And (3) placing the sample tube in a PCR instrument for carrying out a cracking reaction, quickly adding 3 mu L of Stop Solution after the PCR reaction is finished, flicking the tube wall, uniformly mixing and centrifuging for a short time. The sample was placed on an ice box before the next reaction mixture was ready.

8. Preparing a reaction mixed solution:

components	Volume of
		H₂O sc	9μL
REPLI-g sc Reaction Buffer	29μL
		REPLI-g sc DNA Polymerase	2μL
Total volume	40μL

9. Immediately, 40. mu.L of the reaction mixture was added to the prepared 10. mu.L of DNA sample (step 4.2.7), thoroughly shaken and mixed, and collected by brief centrifugation.

10. Putting the sample into a PCR instrument for single cell amplification reaction, wherein the PCR program is as follows:

59min59s 8cycles at 30 ℃; 3min at 65 ℃; 4 ℃ Hold (Hot lid temperature: 70 ℃ C.)

11. The amplification product was stored at-20 ℃ for future use.

(II) measurement of concentration of amplification product

1. Quantification with Qubit: and (4) carrying out concentration determination on the MDA amplification product after 10-fold dilution without nuclease water.

2. Qualified requirements of concentration quality inspection: all samples were assayed at concentrations ≥ 300 ng/. mu.L. If the concentration is below this range, no subsequent experiment is performed.

(III) quality inspection of MDA amplification product

1. Preparation before experiment

1) Personal protection: and (4) changing the experimental clothes, wearing the hat, the mask and the shoe covers to enter the laboratory according to the relevant program contents of the safety protection of the laboratory.

2) Ultraviolet disinfection: and (3) turning on an ultraviolet lamp in the ultra-clean workbench, sterilizing for 30min, turning off the ultraviolet lamp, turning on a fan, blowing for 3 levels, and ventilating for 10 min.

3) Printing related materials: experimental operation record sheet, bar code, etc.

4) Preparing an instrument: and (4) checking whether the equipment is normal or not, wherein the equipment comprises a palm three-tube centrifugal machine, a micro-bench centrifugal machine, a qPCR instrument and the like.

5) Preparation of reagents: comprises qPCR reagent and nuclease-free water, checks whether each component in the kit is complete and intact within the effective period, and places the kit on an ice box for dissolving for later use.

6) Preparing consumables: the special suction head comprises filter element suction heads with various specifications, 1.5mL inlet EP pipes, 2mL inlet EP pipes, eight connecting pipes and pipe covers special for QPCR, a double-sided plate and an ice box.

7) Sample preparation: and (5) verifying whether the name and the number of the sample are consistent, and placing the sample on an ice box for standby after the name and the number are consistent.

2. Primer preparation

When the quality inspection primers are designed, the completeness of the single-cell amplification product and the difference of the amplification efficiency of different amplicons are considered, so that the amplification products are distributed on different chromosomes as far as possible, and the lengths of the amplification products are different.

The specific primers correspond to the DNA sequences of the amplification products as follows:

MQ1：

GCCTGCCCAGACCTAGTAATTGCTGTAGTCTTTTCCTTTTGGATTCCTAGCAGTGGATGCTTGAATACAAATACCAAGTGGGCTCCAGCCAGTGAGGGTAATAGTGTACAGCAGTAAACTGTCTGTTAGCTGATGCTTACATTTCAGACAAATTGAGGAGGTTGTCAAAGGCATTAGCTTCTATCCTTTCCAGGGAATCAATCTGAGAGATTTCACTAGGGAAGAGAGGAGGGGGAAAAAGAGAAAGAAACATGAAAGAAATGACCGTGTCTGCATGATTATGAGCTATGTGTGTGACCCAACAACTGGGGACACCACTGTGTCCCCCTGAAAAGAACAAAGATGTGCAAGTTGTCCCCAAATCATACAGTGCTAACATCTCCCTTTAGGAGCACTGATGGGCA

MQ2：

TTGGAGGAAGCAGATAACATTGCTAGTATCCCACTTGAACCTGGAAAAGAGCAGCAACTAAAAGAAAAGCTTGAGCAAGTCAAGGTAATTTTATTTTCTCAAATCCCCCAGGGCCTGCTTGCATAAAGAAGTATATGAATCTATTTTTTAATTCAATCATTGGTTTTCTGCCCATTAGGTTATTCA

MQ3：

TTTCGACATGGAGGCCACTGGCTTGCCCTTCTCCCAGCCCAAGGTCACGGAGCTGTGCCTGCTGGCTGTCCACAGATGTGCCCTGGAGAGCCCCCCCACCTCTCAGGGGCCACCTCCCACAGTTCCTCCACCACCGCGTGTGGTAGACAAGCTCTCCCTGTGTGTGGCTCCGGGGAAGGCCTGCAGCCCTGCAGCCAGCGAGATCACAGGTCTGAGCACAGCTGTGCTGGCAGCGCATGGGCGTCAATGTTTTGATGACAACCTGGCCAACCTGCTCCTAGCCTTCCTGCGGCGCCAGCCACAGCCCTGGTGCCTGGTGGCACACAATGGTGACCGCTACGACTTCCCCCTGCTCCAAGCAGAGCTGGCTATGCTGGGCCTCACCAGTGCTCTGGATGGTGCCTTCTGTGTGGATAGCATCACTGCGCTGAAGGCCCTGGAGCGAGCAAGCAGCCCCTCAGAACACGGCCCAAGGAAGAGCTATAGCCTAGGCAGCATCTACACTCGCCTGTATGGGCAGTCCCCTCCAGACTCGCACACGGCTGAGGGTGATGTCCTGGCCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGCTCACGCCAGGCCTTTCGGCACCATCAGGCCCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGCACACCTGGCCACAACCAGGAACACTAGTCCCAGCCT

MQ4：

GGGTTGTCCCCTGGATATAGGAGGGGTGAGGTGGGTCAGAGGGTGCCGGGAGGGGCCTGGATCAGCACTTCAAAAGGTGGGTGCCCGCCACCCAGGGGTGGCCCCAAGGAGAGGAGAGGAGCTGGCCATGTGCAGAGATGGGGCCCTGTGATGCAGACACACCTCGGTACCAGTTGCGCAGGGAGGTCATGACGAAGAAGCGGATGGCCTGGTTCGAGCCCTGCTTCAGGACAGTGGCTGTGAGGCCCTGGTACGTCCCCTTCAGCCCTGCGGGAAGGCAGGCACGGGGTTACCCTGCAGCCTCTCAGGCCCCGGTTGGGAATTGGTGTGTGTGGGGGGTGGGTGTTGCACAAAGCCCAAGGCAGGATGGGAGGTGCAGGCCCTTCCCACCCTGGCCCAGGTCCCTGAGCCCTATCAGGAAGGTCGAGTGGCTCACCTTGTTCCCGCACAATCTCCCTAACCCCGTGGAAGAATCCTCTGTACTTGGGGTTTGGGGAGGTCTGGTCGTGGATGAACTT

MQ5：

TCAAGTTTCCTCTCACCTTTATTCTACTTCCTCATTAACAAGTCATCGGTTTGATACATTAATCATGGCAAAAAAATCACAGAGGAAGCACTAATCTGTCATTTTTTTCTGTGACCTGCAGACTCTTTGACACCCGGTACAGCATCCGGGAGAATGGGCAGCTCCTCACCATCCTGAGTGTGGAAGACAGTGATGATGGC

MQ6：

GCGATCGATGCAGTGGACATGGTACTCATGGGAACAAGGTAGTTTACGAAGTTTGTTGCCTTCTGTATATTCTGTAATGCAAACACTACAGGTTTTTAATGCATCATTTTCACCAAAACTTCTCATTGCCAAGTTGTCAATCTGTTCTTTGGTGAGTCCTCTAGGTTGGTCATCATCATCCTCATTTAAGAGGAAAAACTGAGCCAGGCTAAGGAAGGGCAAAGAGCCACTTTCATCAAATGTGACTGGGGCCCTATGTCGACCCTCTCGCCTGGCACCTGATGAGCCTGATGATGAGCTTCCTTCATTACTGCCTTCAAATAAATCTGAGCTAGTTTCTGAACTTTCACCACCGGAACTGGAACTAGGACTGGAACTGGAACTTGAACTGGAACTGGAACTCGAACTGGAACTGGAACTCGAACTGGAACCAGAACTACTACCACCACCAGAACCTCCTCTTCCACTCCGTGACTCTGCCCTTTCCATATTTCGATTTGAGACTGAGCCAGTAGGCTCTGAGTCGCTATCACTGTACATAAAATAGCTTAACTCACCAAAACCTGTCATTATCTGCCTTAACATGGTCTGAATTGCAACAGATGTAGTCTCACTTAAACCAGTATTTAAGATTCTACGAATGGGAATTCTGATGGTACT

MQ7：

CTCAAGACGTGGAGGCATCTGGGCTTAGCTGAGGTCACACTACTAGTGGGACCTACAGAAAAACCCAGGTGTGTCACCAGCAGGGCGGGCACCATCTCTGCAGCCGACACCAGCTTCCCCAACCTCCAGACAGGAGAAAGCATGAGGGTCCCCACTGAAATTCTGGCTCACAGAGTCACCTCCTATGCTGTGGCTTTTTTCAATCCCAGAGTTTGTCCAGCGAGGCAAAGACCTGGTCACGGCGTCTCTGGCTCACCAGGTGGAGGGAACGGCAAAACTCACGCTGGCCCAAGAGGAGGAACAGAGAAGCTTCCTGGCTGAGGCCCAGCCGACTGCTGACCCGGAAAAGTTTCTCGAGGTGACTCACATCCCCAGCCTCTGCACATGTGGGTGAGCCAGTTGTAGCTCTGTTCCCGTGACTGAGCACGGGACGCCGGAGGTATTCATCAGGCATGAGGTTATCTGCCTACTTCCCATGTGTCAG

MQ8：

GTGCTCCAGATCTGATGGAACTGAGCCGGCCTGGGGCTGGGTGGGCCTGAGGGGTGGTGGGGCTCACCGGATGGTGCCGCTGAAGAGGACGGGGTCCTGCAGGATGATGGAGAGGCGTGAGCGCAGGGTGTGCAGCGGCAGTTTGGCGATGTCAATGCCATCAATGATGATGTGCCCTGCATGG

1) centrifuging 8 pairs of primer dry powder at 12,000rpm for 1min, adding nuclease-free water to dilute to 100 μ M mother solution, and storing at-20 deg.C for a long time; when in use, a small amount of mother liquor is diluted to 2 mu M of working solution, and the working solution is stored at the temperature of minus 20 ℃ for later use.

2) And (3) primer selection: generally, all 8 pairs or part of primers are used for MDA amplification products to carry out quality inspection verification, the verification coverage is comprehensive, and the reliability is high.

3. Template preparation

1) MDA amplification product: and diluting the MDA amplification product which meets the requirements after quantification by 10 times by using nuclease-free water to serve as a QPCR reaction template.

2) Positive quality control: mixed human peripheral blood or human cell line genomic DNA at a concentration ≈ 50 ng/. mu.L.

3) Negative quality control: nuclease-free water.

4. Configuring a PCR reaction system

The following table is the qPCR reaction system.

Name of reagent	Single tube system (20ul)	Remarks for note
			KAPA SYBR Mix 2×	10μL	Mix containing SYBR fluorescent dye
Template DNA	2μL	Note: MDA product needs to be diluted by 10 times
			Primer F, 2. mu.M	3μL
Primer R, 2. mu.M	3μL
			High Rox	0.4μL	Note: selecting according to different instruments
ddH2O	1.6μL

5. PCR cycling parameters are shown in the following Table

6. Analysis of results

1) Judging and labeling:

a. positive results: the melting peak of the amplification product is single and sharp, and the expected range of the Tm value is fixed; the amplification curve is typically sigmoidal and the typical Ct value is ≦ 28 (unable to > 30).

That is, if 4 conditions (single sharp melting peak, fixed Tm value range, S-shaped curve, Ct value less than or equal to 28) are satisfied simultaneously, the product is positive; if the conditions (especially Ct value and melting peak pattern) are not satisfied, the sample is negative or weakly positive.

b. Negative results: the amplification product has a plurality of melting peaks or no single sharp main peak, and the Tm value is not in the expected range; the amplification curve is not typically sigmoidal, with a typical Ct value > 30.

That is, if any one of the above 4 conditions exists, the test strip is negative or weakly positive; in particular, Ct values >30 must be negative, multiple melting peaks and no main peak must be negative.

2) And (3) result analysis flow:

a. according to the principle of 'judgment standard', positive quality control and negative quality control are firstly analyzed, and the positive quality control result is ensured to be positive, and the negative quality control result is ensured to be negative. If the negative and positive quality control results are incorrect, it indicates improper operation or the quality of the reagent is problematic, and the reason needs to be eliminated and re-verified.

b. And analyzing the MDA amplification products after the positive and negative quality control results are correct, comparing the positive and negative results according to the 'judgment standard' principle, and analyzing each MDA amplification product one by one.

c. And (5) sorting and summarizing analysis results, and keeping quality inspection records.

Example 2: constructing a detection analysis model

Carrying out whole genome SNP typing on a family sample, defining an information SNP selection standard, carrying out haplotype linkage analysis on an information SNP genetic marker, distinguishing different haplotypes of a patient pathogenic gene allele and a homologous chromosome through the haplotype analysis, determining the haplotype carrying a pathogenic gene and a non-pathogenic gene through the linkage analysis, determining the haplotype of a structurally abnormal chromosome and the haplotype of a structurally normal chromosome, and constructing an embryo detection analysis model.

The method comprises the steps of substituting SNP data of a whole genome of an embryo to be detected into a detection analysis model, analyzing chromosome aneuploidy of the embryo through SNP Allele Frequency (B Allele Frequency), determining the haplotype of the embryo through the detection analysis model, and detecting the carrying states of the embryo pathogenic gene and the chromosome by analyzing whether the embryo carries the haplotype of a pathogenic gene and a structural abnormal chromosome breaking point and whether homologous recombination occurs in a breaking point region. See the detailed detection analysis model diagram of FIG. 2 (taking male as an example of the carrier).

1) When the carrier is abnormal in chromosome structure and/or pathogenic gene, the carrier has the same staining effect as the carrier Color body knotWhen the relatives of the constitutional abnormality and/or the pathogenic gene are reference samples:

2) when the carrier of chromosome structural abnormality and/or pathogenic gene is used as both couples and the relatives of chromosome normal When in reference:

Example 3: embryo detection and pregnancy outcome follow-up

After analysis by the detection and analysis model, embryos were diagnosed:

(1) for the embryo carrying only one pathogenic gene haplotype of both couples, the pathogenic gene carrying embryo is diagnosed;

(2) diagnosing abnormal diseased embryos for embryos carrying both husband and wife pathogenic gene haplotypes simultaneously;

(3) diagnosing the embryo which does not carry the haplotype of the pathogenic genes of both couples as the normal embryo of the pathogenic gene;

(4) for embryos not carrying the haplotypes with the abnormal chromosome structure of the couples, embryos with the normal chromosome structure are diagnosed;

(5) for embryos carrying the haplotypes with the chromosomal abnormality of the couple, embryos with the chromosomal abnormality are diagnosed;

(6) abnormal embryos are directly diagnosed for chromosomal unbalanced translocations or chromosomal aneuploidy embryos.

Considering the pathogenic gene, chromosome structure and aneuploidy detection result of embryo comprehensively, embryos can be classified into three types according to the detection result, namely non-transplantable (for example, (2) and/or (6) above), transplantable and preferentially transplantable, and embryos not carried by transplantation (for example, (3) and/or (4) above) are preferentially considered. The genotype of the pathogenic gene of amniotic fluid cells and the karyotype result of the fetus at the middle term of pregnancy are followed up by the family of successful pregnancy after transplantation, and compared with the result of the detection and analysis model, the effectiveness (or called as "validity") of the detection method is analyzed, and the specific method is detailed in a flow chart 3.

Preparation method of amniotic fluid cell chromosome (in situ method)

A. Cell culture

1) Transfer amniotic fluid (about 20ml) into a sterile centrifuge tube and centrifuge at 1000rpm for 10 minutes;

2) removing the supernatant for other analysis, keeping about 0.5-1 ml of cell suspension, and uniformly mixing the cell suspension with a culture medium to about 2-2.5 ml;

3) bisecting the cell suspension into 2-4 Chromslide culture dishes;

4) after 24/48 hours of culture, add approximately 2.5ml of amniotic fluid medium to each Chromslide dish;

5) observing the growth condition of the cells after 5-6 days of culture, and replacing a new culture medium;

6) observing the growth condition of the cells after 1-2 days, if the clone number of the cells is enough, adding colchicine into a culture dish, harvesting the cells, and determining the treatment time according to the concentration of the colza water solution.

B. Chromosome preparation

1) Tilting the Chromslide cell culture dish to completely remove the culture medium;

2) adding 3-4 ml of hypotonic solution into each culture dish, and treating for 10 minutes at room temperature;

3) directly adding 0.5-0.7 ml of fixing solution into the hypotonic solution, and treating for 5 minutes at room temperature;

4) removing the supernatant, adding 3-4 ml of fresh stationary liquid, and treating at room temperature;

5) repeating the fourth step for 1-2 times;

6) removing the fixing solution, and performing chromosome dispersion process in a Maxchrome chromosome disperser (setting appropriate parameters);

7) after drying, the slides were aged and banding was evident.

The preparation method of the peripheral blood chromosome comprises the following steps:

1. cell culture

1) Blood sampling: disinfecting skin with alcohol, collecting blood from elbow vein, making injection needle directly pass through rubber plug of culture flask, injecting 30-40 drops of whole blood into 10ml of culture medium, shaking up, and culturing in 37 deg.C incubator.

2) Culturing: the time period required was 68 hours. During the culture period, the cells are shaken up periodically to make the cells fully contact with the culture medium.

3) Colchicine treatment: 2-4 hours before terminating the culture, colchicine was added to the culture (2 drops were added dropwise with 1ml syringe No. 5 needle tip to a final concentration of 0.07. mu.g/ml).

The above steps all need aseptic operation.

2. Chromosome preparation

1) Collecting cells: the whole culture was transferred to a clean centrifuge tube, centrifuged at 1000rpm for 8-10 minutes, and the supernatant was discarded.

2) Hypotonic treatment: adding 8ml of low-permeability liquid with the pre-temperature of 37 ℃ into a graduated centrifuge tube, uniformly mixing by using a dropper, and performing low-permeability for 15-25 minutes in a constant-temperature water bath with the temperature of 37 ℃.

3) Pre-fixing: after hypotonic, 0.5ml of stationary liquid is added, mixed gently and centrifuged at 1000rpm for 8-10 minutes.

4) A fixing: the supernatant was discarded, 5ml of the fixative was added, gently mixed, and allowed to stand for 20 minutes. Centrifuge at 1000rpm and discard the supernatant.

5) Fixing II and fixing III: the same is fixed.

6) Preparing a suspension: after the supernatant is discarded, a proper amount of stationary liquid is added according to the number of cells to prepare cell suspension.

7) Dropping sheet: the cell suspension is sucked from the height of 10-20cm and dropped on a dry and clean glass slide, and the glass slide is lightly blown to disperse and is air-dried.

8) Dyeing: dyeing for 5-10 minutes by 1:10Giemsa, washing off excessive dye liquor by fine water, and air-drying.

9) Microscopic examination: and (5) searching for a split phase with good dispersion and moderate dyeing under a low power microscope, and observing the form of the chromosome under an oil microscope and counting.

Example 4: analysis results of 6 actual cases

1. The study was approved by the ethical committee of the affiliated obstetrical and gynecological hospital of the university of Compound Dane, and 6 cases of families meeting the inclusion criteria were included. The inclusion criteria were: it is necessary to satisfy the cases that both couples carry a certain pathogenic gene and that one couple carries chromosomal abnormality (both couples have low probability of chromosomal abnormality, and generally one couple). The chromosome structural abnormality and the pathogenic gene related to the 6 families meeting the inclusion criteria are respectively as follows:

family serial number	Structural abnormality of chromosome	Pathogenic gene
			1	46,XY,t(6；14)(q22；q13)	PAH
2	46,XX,inv(3)(p26q21)	USH2A
			3	46,XX,t(4；16)(q25；q13)	SLC25A13
4	46,XX,t(13；18)(q21；q12)	TYR
			5	46,XX,t(6；18)(p23；q23)	GJB2
6	45,XX,der(14；15)(q10；q10)	SLC26A4

Ovulation promotion, fertilization and blastocyst cell biopsy are all completed at present, and single cell amplification is all completed smoothly. The qPCR quality control site results of DNA products after whole genome amplification of embryo biopsy cells are shown in FIG. 4, and the result judgment standard is as follows:

(1) positive results: the melting peak of the amplification product is single and sharp, and the expected range of the Tm value is fixed; the amplification curve is typical S-shaped, and the Ct value is less than or equal to 25 in general. If any one of the conditions is not met, the sample is negative or weakly positive (if the Ct value is between 25 and 30, the sample is weakly positive).

(2) Negative results: the amplification product has a plurality of melting peaks or no single sharp main peak, and the Tm value is not in the expected range; the amplification curve is not typically sigmoidal, with typical Ct values > 30.

2. A family map of 6 cases of ovulation induction has been completed as shown in figure 5:

3. detection analysis models were successfully constructed in 6 cases, and embryo detection was completed. The results of analysis are shown in FIG. 6 (case-6 for example), in which the left side of FIG. 3 shows the results of haplotype of the disease-causing gene of the patient family embryonic monogenic genetic disease and the right side shows the results of haplotype of the chromosome with abnormal structure of the patient family embryo.

4. Taking case-6 as an example, fig. 7 shows the results of embryo aneuploidy detection, and the result of embryo No. 1 is 4p16.3q24 x 3; 4q24q35.2 x 1; 12 x 1; 16p13.3q12.2 × 1; 16q12.2q24.3 × 3, No. 4 embryos gave results of euploidy, No. 9 embryos gave results of 4p16.3q24 × 1; the result for embryo No. 16p13.3q12.2 x 3, No. 10 was euploid.

The results of the aneuploidy detection and the haplotype detection of the embryos are combined to judge that the No. 1 embryo and the No. 9 embryo are the aneuploidy embryos with unbalanced translocation, and the No. 4 embryo and the No. 9 embryo are both chromosome structure abnormal carrying embryos.

5. The 6 cases have completed the transplantation and succeeded pregnancy, and the embryo detection analysis results of the 6 cases are consistent with the prenatal diagnosis results through follow-up visits, and as shown in table 1, the analysis method provided by the invention is proved to be accurate in result and suitable for clinical application.

TABLE 1 comparison of embryo test results and prenatal diagnosis results after transplantation

Claims

1. A method for constructing a reference sample haplotype from family haplotypes used for identifying structural abnormalities of embryo chromosomes and carrying states of pathogenic genes, which comprises the following steps:

a. both the sex and the couple who carries the chromosome structural abnormality and the pathogenic gene; and the combination of (a) and (b),

wherein, the carrier relatives can be relatives with the same chromosome structure abnormality and pathogenic genes as the carrier, and can also be relatives with normal chromosome and genes;

the above a and b are referred to as reference samples;

(2) determining the SNPs site of the information:

a. when the reference sample contains carrier relatives, it is heterozygous among carriers with chromosome structural abnormality and pathogenic genes, it is homozygous among partners thereof, and SNP sites that are also homozygous among carrier relatives are information SNPs sites;

b. when the reference sample contains offspring carrying pathogenic genes or embryos with chromosome abnormality, the reference sample is heterozygous in chromosome structure abnormality and carriers of the pathogenic genes, and SNP loci which are homozygotic in the partners thereof are information SNPs loci;

2. A construction system for identifying a reference sample haplotype in a family haplotype of an embryo chromosome structural abnormality and a carrier state of a pathogenic gene, the system comprising software capable of computing and processing sample data and hardware for carrying the software, characterized in that,

(1) the system also includes hardware storing genotyping data for large scale SNP genotyping detection of a reference sample; the reference samples are: a. both the sex and the couple who carries the chromosome structural abnormality and the pathogenic gene; at least one carrier relative, progeny carrying a disease causing gene, or a chromosomally abnormal embryo; wherein, the carrier relatives can be relatives with the same chromosome structure abnormality and pathogenic genes as the carrier, and can also be relatives with normal chromosome and genes;

3. A construction method of family haplotype for identifying chromosome structural abnormality and carrier state of pathogenic genes of embryo is characterized by comprising the following steps:

a. both the sex and the couple who carries the chromosome structural abnormality and the pathogenic gene;

c.a in vitro fertilized embryo of a carrier couple;

(2) determining the SNPs site of the information:

4. A construction system for identifying a family haplotype of an embryo chromosome structural abnormality and a carrier state of a pathogenic gene, the system comprising software capable of calculating processing sample data and hardware for carrying the software, characterized in that,

(1) the system also includes hardware storing genotyping data for large scale SNP genotyping of a reference sample and a sample to be determined; the reference samples are: a. both the sex and the couple who carries the chromosome structural abnormality and the pathogenic gene; at least one carrier relative, progeny carrying a disease causing gene, or a chromosomally abnormal embryo; the pending sample is an in vitro fertilized embryo of the carrier couple; wherein, the carrier relatives can be relatives with the same chromosome structure abnormality and pathogenic genes as the carrier, and can also be relatives with normal chromosome and genes;

(3) the software constructs family haplotypes according to the following principles: the haplotype of the whole chromosome covering the pathogenic gene, the chromosome of the pathogenic gene and the homologous chromosome of the allele corresponding to the pathogenic gene, the two chromosome structure abnormal breakpoint regions, the whole chromosome of the structure abnormal chromosome and the whole chromosome of the homologous chromosome thereof is obtained by family linkage analysis according to the information SNPs sites selected by the rule on each chromosome, and the set of the haplotypes of different chromosomes is called as the family haplotype.

5. A system for identifying structural abnormalities of embryo chromosomes and carrying states of pathogenic genes, said system comprising software capable of computing sample data for processing, and hardware for carrying said software,

(3) the software constructs family haplotypes according to the following principles: the haplotype of the whole chromosome covering the pathogenic gene, the chromosome of the pathogenic gene and the homologous chromosome of the allele corresponding to the pathogenic gene, the two chromosome structure abnormal breakpoint regions, the whole chromosome of the structure abnormal chromosome and the whole chromosome of the homologous chromosome is obtained by family linkage analysis according to the information SNPs sites selected by the rule on each chromosome, and the set of the haplotypes of different chromosomes is called as the family haplotype;

1) when the reference sample is the female couple with chromosome structural abnormality and pathogenic gene carrier, and the relatives with the same chromosome structural abnormality and pathogenic gene as the carrier:

a. if the pathogenic gene or the chromosome structure abnormality breakpoint region of the undetermined sample does not have homologous recombination, when the haplotype information of the pathogenic gene or the chromosome structure abnormality breakpoint region of the undetermined sample is consistent with the haplotype information of the carrier and the relatives with the same chromosome structure abnormality and the pathogenic gene with the carrier, judging that the undetermined sample carries the pathogenic gene or the chromosome structure abnormality carries the embryo; when the haplotype information of the pathogenic gene or the chromosome structural abnormality breakpoint region of the undetermined sample is consistent with the haplotype information of the structural abnormality and the pathogenic gene carrier in the reference sample, but is inconsistent with the haplotype information of the relatives with the same chromosome structural abnormality and the pathogenic gene with the carrier, judging that the undetermined sample is carried by the non-pathogenic gene or carries the embryo by the chromosome structural abnormality;

i. if the chromosome structural abnormality is chromosome balance translocation, the judgment rule is opposite to a;

if the chromosome structural abnormality is chromosome inversion, judging that the rule is the same as a if only one end or two ends of 1 breakpoint region are subjected to homologous recombination; when only one end of each of the 2 breakpoint regions is subjected to homologous recombination, the judgment rule is the same as a; when the two ends of the 2 breaking point regions are subjected to homologous recombination, the judgment result is opposite to a;

2) when the reference is made to both the couples and the couples who have chromosome structural abnormality and carriers of pathogenic genes, and the relatives with normal chromosomes:

a. if the pathogenic gene or the chromosome structure abnormal breakpoint region of the undetermined sample does not have homologous recombination, when the haplotype information of the pathogenic gene or the chromosome structure abnormal breakpoint region of the undetermined sample is consistent with the haplotype information of the carrier and the normal relatives of the carrier, judging that the undetermined sample is carried by the non-pathogenic gene or carries the embryo by the chromosome structure abnormality; when the haplotype information of the pathogenic gene or the chromosome structural abnormality breakpoint region of the undetermined sample is consistent with the haplotype information of the structural abnormality and the pathogenic gene carrier in the reference sample, but is inconsistent with the haplotype information of the relatives with the same chromosome structural abnormality and the pathogenic gene as the carrier, judging that the undetermined sample carries the pathogenic gene or the chromosome structural abnormality carries the embryo;

if the chromosome structural abnormality is chromosome inversion, judging that the rule is the same as a if only one end or two ends of 1 breakpoint region are subjected to homologous recombination; when only one end of each of the 2 breakpoint regions is subjected to homologous recombination, the judgment rule is the same as a; when homologous recombination occurs at both ends of the 2 breakpoint regions, the determination result is opposite to a.

6. The method or system of any one of claims 1 to 5, wherein the chromosomal structural abnormality comprises a balanced chromosomal translocation and a chromosomal inversion.

7. The method or system of claim 6, wherein the chromosomal balance translocation comprises a reciprocal translocation and a Robertsonian translocation.

8. The method or system of any of claims 1-5, wherein the large-scale SNP genotyping detection covers 23 pairs of chromosomes; the large-scale SNP genotype detection method is gene chip or gene sequencing.

9. The method or system of any of claims 3 to 5, wherein 1 to 10 cells are biopsied as test samples for said sample to be determined when the embryo develops by days 3 to 7; the cells are derived from an embryonic blastomere biopsy or a blastocyst trophectoderm biopsy.

10. The method or system of claim 9, wherein the cells obtained from the biopsy are lysed and subjected to whole genome amplification; the whole genome amplification method may be selected from the MDA method or the MALBAC method.

11. The method or system of any one of claims 1 to 5, wherein the test sample source of the reference sample is a somatic cell.

12. The method or system of claim 11, wherein the test sample source of the reference sample is peripheral blood.

13. The method or system according to any one of claims 1 to 5, wherein the sites of the information SNPs are determined by selecting the information SNPs covering the pathogenic gene, the chromosome in which the pathogenic gene is present and the homologous chromosome in which the allele corresponding thereto is present, the chromosomal abnormality breakpoint, the structural abnormality chromosome and the normal homologous chromosome corresponding thereto; selecting at least 1 informative SNP per Mb of the chromosome; in the region covering the breaking point, the SNPs are selected from the range of 1-30Mb upstream and downstream of the breaking point.

14. The method or system according to claim 13, wherein a chromosomal structural abnormality breakpoint region is covered and the SNPs are selected from the range of 2-4Mb upstream and downstream of the chromosomal structural abnormality breakpoint.

15. The method or system of any one of claims 1 to 5, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 informative-SNPs are selected per Mb of chromosome for determining the location of the informative-SNPs.