CN113423826A - Herbicide-resistant polypeptide, nucleic acid and application thereof - Google Patents

Abstract

The invention provides herbicide-resistant polypeptides, nucleic acids and applications thereof, in particular herbicide-resistant genes, polypeptides and applications thereof in plant breeding, and particularly provides a mutant HPPD polypeptide, and compared with a parent HPPD polypeptide, the mutant HPPD polypeptide is mutated at the 347 th amino acid and/or 353 rd amino acid corresponding to SEQ ID NO. 1. The mutated HPPD polypeptide has strong tolerance to herbicides and has very wide application prospect in the field of improving and cultivating plants resistant to HPPD inhibitory herbicides.

Description

Herbicide-resistant polypeptide, nucleic acid and application thereof Technical Field

The invention belongs to the field of agricultural genetic engineering, and particularly relates to herbicide-resistant polypeptides, nucleic acids and applications thereof, in particular to novel mutant p-hydroxyphenyl pyruvate dioxygenase (HPPD) for endowing plants with HPPD inhibitory herbicide resistance or tolerance, nucleic acids encoding the same and applications thereof.

Background

p-Hydroxyphenylpyruvate Dioxygenase (4-Hydroxyphenylpyruvate Dioxygenase, HPPD, EC 1.13.11.27) is an important enzyme in Tyrosine metabolism in organisms, and is present in almost all aerobic organisms, in which Tyrosine (Tyrosine) produces p-Hydroxyphenylpyruvate (HPPA) by the action of Tyrosine Aminotransferase (TAT), and in the presence of oxygen HPPD catalyzes the conversion of HPPA to Homogentisate (HGA). In animals, the main function of HPPD is to promote the catabolism of tyrosine, aromatic amino acid and phenylalanine. However, the effect in plants is significantly different from that in animals, homogentisate further forms plastoquinones (plastoquinones) and tocopherols (tocopherols) (Ahrens et al, 2013). The tocopherol plays a role of a membrane-related antioxidant, is an essential antioxidant for plant growth, and can effectively enhance the stress resistance of plants. Plastoquinone is a key auxiliary factor in the process of plant photosynthesis, and promotes the synthesis of carotenoid in plants. More than 60% of chlorophyll in plants is bound to the light-harvesting antenna complex, which absorbs solar light energy and transfers excitation energy to the photosynthesis reaction center, whereas carotenoids are important components of chlorophyll-binding proteins and antenna systems in the reaction center, which play an important role in plant photosynthesis, absorbing and transferring electrons, and scavenging free radicals, playing an important role in the absorption of light-absorbing auxiliary pigments.

Inhibition of HPPD results in uncoupling of photosynthesis within plant cells, a deficiency in secondary light harvesting pigments, and also, due to the lack of photoprotection normally provided by carotenoids, destruction of chlorophyll by reactive oxygen intermediates and photooxidation, with consequent albinism of plant photosynthetic tissues, growth being inhibited until death (Beaudegnies et al, 2009).

The HPPD is an important herbicide action target after acetolactate synthase (ALS), 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) and acetyl coenzyme A carboxylase (ACCase) and has a unique action mechanism capable of effectively controlling various resistant weeds, which is determined as an herbicide target from the 90 s of the 20 th century. HPPD herbicides are popular products in recent years and have the advantages of high efficiency, low toxicity, good environmental compatibility, high safety for succeeding crops and the like. Significant differences in plant and mammalian HPPD amino acid sequence homology were found, and higher homology was found in the plant or animal kingdoms (Yang et al, 2004). The method provides a theoretical guidance basis for the subsequent development of HPPD herbicides with higher selectivity and safety. Currently, 5 HPPD-targeted herbicides have been developed according to structural classes, mainly including triketones, pyrazolones, isoxazoles, diketonitriles and benzophenones.

However, these HPPD inhibiting herbicides can also cause certain damage to crops while killing weeds, and different crops have different tolerance degrees to different HPPD herbicides, which also limits the application range of the HPPD herbicides, and thus obtaining herbicide-tolerant crops is particularly important. Current strategies, in addition to attempting to bypass HPPD-mediated homogentisate production, include over-expression of the enzyme to produce large quantities of herbicide target enzymes in plants, mitigating the inhibitory effects of herbicides. Although the over-expression of HPPD results in better pre-emergence tolerance of plants to herbicides (such as the diketonitrile derivative of isoxaflutole), this tolerance is insufficient to resist post-emergence herbicide treatment.

CRISPR/Cas gene editing technology is an emerging genetic engineering technology in recent years, which is a guideRNA-mediated DNA cleavage technology, and various editing systems have been developed for differences in Cas, including Cas9, Cpf1, Cms1, C2C1, C2C2, and the like. Three kinds of fixed point editing can be realized by the CRISPR/Cas editing technology: the first is site-directed knockout of a gene, the Cas protein recognizes and cleaves a target under the guidance of a targeting rna (grna), generating a double-stranded DNA break; fragmented DNA is usually repaired by non-homologous end joining (NHEJ); it is easy to generate frame shift mutation to destroy the gene during repair. The efficiency of fixed point knockout is high. The second is homologous substitution of the target to replace the target sequence or site-directed insertion. When a double-stranded DNA break is created, homologous substitution or site-directed insertion may occur if a homologous repair template is present nearby. Homologous substitution is less efficient and becomes even less as the length of the sequence to be substituted increases. The third is single base editing. Single base editing is a gene editing method that uses the CRISPR/Cas system to target deaminase to a specific site in the genome, thereby modifying a specific base. This method has been successfully practiced in rice.

The time for large-scale use of HPPD herbicides is short, and few reports about resistance generation by HPPD gene self-mutation exist at present. However, in combination with CRISPR technology, the screening of the resistant HPPD polypeptide can be accelerated, and the tolerance of crops to HPPD inhibitors can be improved. Has important significance for enlarging the application range of the herbicide and prolonging the service life.

Disclosure of Invention

The invention aims to provide a mutant HPPD polypeptide capable of improving the resistance or tolerance of plants to HPPD inhibiting herbicides; the invention also relates to a biological active fragment of the mutant HPPD, a polynucleotide for coding the protein or the fragment and application thereof.

In one aspect, the present invention provides a mutant polypeptide of a p-hydroxyphenylpyruvate dioxygenase (HPPD), which mutant polypeptide has a mutation at amino acid position 347 and/or at amino acid position 353, corresponding to the amino acid sequence shown in SEQ ID No.1, in comparison with the amino acid sequence of the parent p-hydroxyphenylpyruvate dioxygenase (HPPD).

In another preferred embodiment, the mutation is an insertion, deletion or substitution of an amino acid.

In another preferred embodiment, the mutant polypeptide is a herbicide resistance polypeptide.

Further, the 347 th amino acid is mutated from alanine (a) to an amino acid other than alanine, which is selected from valine (V), glycine (G), leucine (L), isoleucine (I), phenylalanine (F), tryptophan (W), tyrosine (Y), aspartic acid (D), asparagine (N), glutamic acid (E), lysine (K), glutamine (Q), methionine (M), serine (S), threonine (T), cysteine (C), proline (P), histidine (H) or arginine (R).

In another preferred embodiment, the alanine (a) at position 347 is mutated to an amino acid selected from the group consisting of: valine (V), glycine (G), leucine (L) or isoleucine (I).

In another preferred embodiment, the alanine (a) at position 347 is mutated to an amino acid selected from the group consisting of: valine (V).

Further, the 353 rd amino acid is mutated from glutamic acid (E) to an amino acid other than glutamic acid, wherein the amino acid other than glutamic acid is selected from alanine (A), valine (V), glycine (G), leucine (L), isoleucine (I), phenylalanine (F), tryptophan (W), tyrosine (Y), aspartic acid (D), asparagine (N), lysine (K), glutamine (Q), methionine (M), serine (S), threonine (T), cysteine (C), proline (P), histidine (H) or arginine (R).

In another preferred embodiment, the 353 rd glutamic acid (E) mutation is an amino acid selected from the group consisting of: lysine (K), histidine (H) or arginine (R).

In another preferred embodiment, the 353 rd glutamic acid (E) mutation is an amino acid selected from the group consisting of: lysine (K).

In another preferred embodiment, the mutant polypeptide is a polypeptide having an amino acid sequence shown in any one of SEQ ID Nos. 2 to 4, an active fragment thereof, or a conservative variant thereof.

In another preferred embodiment, the amino acid sequence of the mutant polypeptide is as shown in any one of SEQ ID Nos. 2 to 4.

In another preferred embodiment, the mutant HPPD polypeptide further comprises additional mutation sites corresponding to one or more of positions 20, 93, 103, 141, 152, 165, 170, 176, 191, 211, 220, 226, 276, 277, 336, 337, 338, 339, 340, 342, 346, 353, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence shown in SEQ ID No.1, wherein the additional mutation sites maintain or enhance tolerance or resistance of the mutant polypeptide to HPPD inhibiting herbicides or increase the applicability of the mutant HPPD polypeptide to herbicides.

In another preferred embodiment, the mutation pattern of the other mutation sites corresponding to the amino acid sequence shown in SEQ ID No.1 comprises: one or more of a20E, D152N, D170N, G176C, E353K, P211L, P336L, Y339H, Y340H, R93S, a103S, H141R/K/T, A165V, V191I, R220K, G226H, L276W, P277N, P336D/D337D, N338D/SY, G342D, R346D/D/H/S/D, I377D, P386D, L390D, M392D, E403D, K410D, K418D, G419D/L/D, N420D, E430D and Y D.

In another preferred example, the parent HPPD polypeptide is derived from a monocotyledonous and/or dicotyledonous plant.

In another preferred embodiment, the parent HPPD polypeptide is derived from one or more plants selected from the group consisting of: plants of Gramineae, Leguminosae, Chenopodiaceae, and Brassicaceae.

In another preferred embodiment, the parent HPPD polypeptide is derived from one or more plants selected from the group consisting of: arabidopsis, rice, tobacco, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rape, cabbage, strawberry.

In another preferred embodiment, the parent HPPD polypeptide is derived from rice and has the amino acid sequence shown as SEQ ID No. 1;

in another preferred embodiment, the amino acid sequence of said parent HPPD polypeptide has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequence as depicted in SEQ ID No. 1.

In another preferred embodiment, the mutant polypeptide (herbicide resistance polypeptide) is formed by mutating the polypeptide shown in SEQ ID No. 1.

In another preferred embodiment, the mutant polypeptide has an amino acid sequence which is identical or substantially identical to the sequence shown in SEQ ID No.1 except for the mutation (e.g., 347 or 353 or 347+ 353).

In another preferred embodiment, said substantial identity is a difference of up to 50 (preferably 1-20, more preferably 1-10, more preferably 1-5) amino acids, wherein said difference comprises a substitution, deletion or addition of an amino acid and said mutein has herbicide tolerance activity (preferably isoxazole herbicide tolerance activity).

In another preferred embodiment, the HPPD-inhibiting herbicide comprises a triketone, a diketonitrile, an isoxazole, a pyrazole, a benzophenone, or a combination thereof. The triketone herbicide is preferably one or any more of bicyclsulcotrione, mesotrione, tembotrione, tefuretrione or flurtamone, and the isoxazole herbicide is preferably one or any more of isoxaflutole, isoxachlorotole and clomazone.

In another preferred embodiment, the HPPD inhibiting herbicide is an isoxazole and the isoxazole HPPD inhibitor comprises isoxaflutole, isoxachlorotole, isoxaflutole.

In another preferred embodiment, the HPPD inhibiting herbicide is a triketone, and the triketone HPPD inhibitor comprises mesotrione, tembotrione, tefurazone or flurtamone.

In another preferred embodiment, the mutant polypeptide has a maximum tolerated concentration which is increased by at least 1.5 fold, preferably by at least 2 fold, preferably by at least 3 fold, preferably by at least 4 fold, preferably by at least 5 fold, preferably by at least 6 fold, preferably by at least 10 fold, compared to the parent HPPD polypeptide. Preferably the HPPD inhibiting herbicide is isoxaflutole, or alternatively, a triketone herbicide, preferably mesotrione.

In another preferred embodiment, the tolerance concentration of the plant containing the mutant polypeptide to isoxazole herbicides or triketone herbicides is increased by at least 2 times, preferably by 3 times, preferably by 4 times, preferably by 5 times, preferably by 6 times, preferably by 7 times, preferably by 8 times, preferably by 10 times, preferably by 12 times, preferably by 14 times, preferably by 16 times, compared to the parent plant.

In another preferred embodiment, the mutant HPPD polypeptide (347) confers upon a plant tolerance to an isoxazole herbicide or a triketone herbicide of at least 150 μ M, preferably at least 200 μ M, preferably at least 250 μ M, preferably at least 300 μ M, preferably at least 350 μ M, preferably at least 400 μ M, preferably at least 500 μ M, preferably at least 600 μ M, preferably at least 800 μ M. Isoxaflutole or mesotrione is preferred.

In another preferred embodiment, the herbicide resistance polypeptide or active fragment thereof is selected from the group consisting of:

(a) a polypeptide having an amino acid sequence as set forth in any one of SEQ ID nos. 2-4 or an active fragment thereof;

(b) a polypeptide derived from (a) having HPPD inhibiting herbicide tolerance activity, which polypeptide is formed by substituting, deleting or adding one or more (e.g. 2, 3,4, 5, 6, 7, 8, 9 or 10) amino acid residues to the amino acid sequence shown in any one of SEQ ID nos. 2 to 4 or an active fragment thereof.

In another preferred embodiment, the derived polypeptide has at least 60%, preferably at least 70%, more preferably at least 80%, most preferably at least 90%, such as 95%, 97%, 99% homology with the sequence shown in SEQ ID No. 2.

In another aspect of the invention, there is provided a fusion protein comprising said mutant polypeptide or biologically active fragment thereof, fused to another component, e.g. a tag peptide such as a histidine tag, e.g. 6 × His, or a plastid targeting peptide, e.g. a peptide that targets chloroplasts.

In another aspect of the invention, there is provided a polynucleotide encoding the mutant polypeptide or an active fragment thereof.

In another preferred embodiment, the polynucleotide is selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide as set forth in any one of SEQ ID NO. 2-4;

(b) a polynucleotide having a sequence as shown in any one of SEQ ID NO. 6-8;

(c) a polynucleotide having a nucleotide sequence homology of 80% or more (preferably 90% or more, more preferably 95% or more, most preferably 98% or more) to any of the sequences shown in SEQ ID Nos. 6 to 8, and encoding a polypeptide shown in SEQ ID No. 2;

(d) a polynucleotide complementary to any one of the polynucleotides of (a) - (c).

In another preferred embodiment, the polynucleotide is selected from the group consisting of: a genomic sequence, a cDNA sequence, an RNA sequence, or a combination thereof.

In another preferred embodiment, the polynucleotide is preferably single-stranded or double-stranded.

In another preferred embodiment, said polynucleotide additionally comprises an auxiliary element selected from the group consisting of: a signal peptide, a secretory peptide, a tag sequence (e.g., 6His), or a combination thereof.

In another preferred embodiment, the polynucleotide further comprises a promoter operably linked to the ORF sequence of the mutant polypeptide.

In another preferred embodiment, the promoter is selected from the group consisting of: a constitutive promoter, a tissue specific promoter, an inducible promoter, or a strong promoter.

In another aspect of the invention, a nucleic acid construct is provided comprising the polynucleotide operably linked to a regulatory element.

In another preferred embodiment said regulatory element is selected from one or more of the group consisting of: enhancers, transposons, promoters, terminators, leader sequences, polyadenylation sequences, marker genes.

In another aspect of the present invention, there is provided a vector comprising said polynucleotide.

In another preferred embodiment, the vector comprises an expression vector, a shuttle vector or an integration vector.

In another aspect of the invention, there is provided a host cell comprising said nucleic acid construct or said vector or genome into which said polynucleotide has been integrated.

In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell or an animal cell or a plant cell.

In another preferred embodiment, the host cell is a prokaryotic cell, such as E.coli.

In another preferred embodiment, the plant includes angiosperms and gymnosperms.

In another preferred embodiment, the plant includes a monocotyledon and a dicotyledon.

In another preferred embodiment, the plant includes herbaceous plants and woody plants.

In another preferred example, the plant comprises arabidopsis, tobacco, rice, maize, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rape, cabbage, strawberry.

In another aspect of the present invention, there is provided a method for preparing the mutant polypeptide or an active fragment thereof, the method comprising the steps of:

(a) culturing a host cell comprising said mutant polypeptide under conditions suitable for expression, thereby expressing said mutant polypeptide; and

(b) isolating said mutant polypeptide.

In another aspect of the invention, there is provided a plant cell, plant tissue, plant part, plant that is tolerant or resistant to a HPPD-inhibiting herbicide, wherein the plant cell, plant tissue, plant part, plant contains the mutant polypeptide or polynucleotide sequence thereof.

In another aspect of the present invention, there is provided a method of conferring resistance or tolerance to a HPPD-inhibiting herbicide to a plant, said method comprising the step of introducing said HPPD mutant polypeptide into a plant cell, plant tissue, plant part or plant.

In another preferred embodiment, the method wherein introducing the HPPD mutant polypeptide comprises expressing the HPPD mutant polypeptide in a plant cell, plant tissue, plant part or plant, e.g., by expression of the mutant polypeptide in an expression vector, or by expression of the mutant polypeptide by integration of the polynucleotide encoding the mutant polypeptide into the plant genome.

In another preferred embodiment, the method comprises the following steps:

(1) providing agrobacterium carrying an expression vector, wherein the expression vector contains a DNA coding sequence of the mutant polypeptide or the active fragment thereof;

(2) contacting a plant cell, plant tissue, plant part with the agrobacterium of step (1) such that the DNA coding sequence for the mutant polypeptide or active fragment thereof is transferred into the plant cell and integrated into the chromosome of the plant cell; and

(3) selecting plant cells into which the DNA coding sequence for the mutant polypeptide or active fragment thereof has been transferred.

In another preferred example, in the method, the introducing of the HPPD mutant polypeptide further comprises the step of mutating an endogenous HPPD of the plant, thereby introducing the mutant polypeptide.

In another preferred embodiment, the method wherein the introduction of the HPPD mutant polypeptide comprises the step of mutating and expressing the endogenous HPPD nucleotide sequence of the plant thereby introducing the mutant polypeptide.

In another preferred embodiment, the method for introducing mutations includes natural mutation, physical mutagenesis (e.g., ultraviolet mutagenesis, X-ray or Y-ray mutagenesis), chemical mutagenesis (e.g., nitrous acid, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (e.g., virus-or bacteria-mediated mutagenesis), and gene editing.

In another preferred embodiment, the method comprises the following steps:

(1) introducing an expression vector containing a gene editing tool into a plant cell, a plant tissue or a plant part;

(2) allowing a gene editing tool to act on its endogenous HPPD coding sequence and allowing it to express a sequence corresponding to SEQ NO: 1 at position 347 and/or 353;

(3) screening for mutated plant cells, plant tissues, plant parts;

(4) isolating said gene editing tool.

In another preferred embodiment, the gene editing tool comprises CRISPR, TALEN and ZFN.

In another aspect of the present invention, there is provided an agent useful for improving herbicide resistance or tolerance in a plant cell, plant tissue or plant, the agent comprising a mutant polypeptide of the present invention or a nucleotide encoding the mutant polypeptide.

In another aspect of the invention, there is provided the use of the mutant polypeptide, the polynucleotide, the fusion protein, the nucleic acid construct or the vector in the breeding (preparation) of plants resistant or tolerant to HPPD-inhibiting herbicides, or in the preparation of an agent or kit for breeding of plants resistant or tolerant to HPPD-inhibiting herbicides.

In another aspect of the invention, there is provided a method of identifying or selecting a transformed plant cell, plant tissue, plant or part thereof comprising: (i) providing a transformed plant cell, plant tissue, plant or part thereof, wherein the transformed plant cell, plant tissue, plant or part thereof comprises a polynucleotide as shown or a variant or derivative thereof, wherein the polynucleotide encodes a mutant polypeptide for use as a selectable marker, and wherein the transformed plant cell, plant tissue, plant or part thereof may comprise another isolated polynucleotide part; (ii) contacting the transformed plant cell, plant tissue, plant or part thereof with at least one HPPD inhibiting herbicide; (iii) determining whether the plant cell, plant tissue, plant or part thereof is affected by the inhibitory herbicide; and (iv) identifying or selecting a transformed plant cell, plant tissue, plant or part thereof.

In another aspect of the invention, there is provided a method of controlling an effective amount of an undesired plant at a plant cultivation site, the method comprising:

(1) providing at said cultivation site a plant comprising said mutant polypeptide or said polynucleotide or said nucleic acid construct or said vector;

(2) the plants are cultivated and an effective amount of an HPPD inhibiting herbicide is applied to the cultivation site.

Drawings

FIG. 1.Anc689BE4max-nCas9 base editor. OsU6, ZmUbi is promoter; sgRNA is guide RNA; bp-NLS is a nuclear localization signal; uracil DNA glycosylase inhibitors; NOS is a terminator.

FIG. 2. T0 generation transformed plants of HPPD-CBE-sg6 appeared C^1040,1041->Base substitution of T. The PAM sequence is underlined.

FIG. 3T 1 seedlings from HPPD-CBE-sg6 transformant were resistant to isoxaflutole.

FIG. 4T 1 seedlings from HPPD-CBE-sg6 transformant as homozygous mutants showing C in HPPD gene^1040,1041->T, resulting in an amino acid mutation A347V. The PAM sequence is underlined.

FIG. 5 emergence G of T0 transformed plants of HPPD-CBE-sg8^1056,1057->Base substitution of A. The PAM sequence is underlined.

FIG. 6. T1 seedlings from HPPD-CBE-sg8 transformant were resistant to mesotrione.

FIG. 7T 1 seedlings from HPPD-CBE-sg8 transformant as homozygous mutant showing G1 in HPPD gene^056,1057->A base substitution resulting in an amino acid mutation E353K. UnderliningThe PAM sequence is indicated.

It is to be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (e.g., examples) can be combined with each other to form a new or preferred technical solution, which is included in the scope of the present invention, is not limited to the space, and is not described in detail herein.

Detailed Description

Unless defined otherwise herein, scientific terms or terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

As used herein, the term "AxxB" means the amino acid a at position xx is changed to amino acid B, e.g., "L87I" means the amino acid L at position 87 is mutated to I, and so on. For multiple mutation types at the same site, each type is separated by "/", for example P336D/L indicates that proline at position 336 is substituted by aspartic acid or leucine with respect to the amino acid sequence of SEQ ID NO. 1. For double or multiple mutations, each mutation is separated by "/", e.g., A347V/E353K indicates that alanine at position 347 is substituted with valine, glutamic acid at position 353 is substituted with lysine, and aspartic acid at position 370 is substituted with asparagine, relative to the amino acid sequence of SEQ ID No.1, all three mutations being present in the particular mutated HPPD protein.

As used herein, the term "HPPD" refers to p-Hydroxyphenylpyruvate Dioxygenase (HPPD, EC 1.13.11.27), which is a key enzyme in catalyzing the reaction of the degradation product of tyrosine, p-Hydroxyphenylpyruvate (HPP), the oxidation of which to form Homogentisate (HGA), present in various organisms. Inhibition of HPPD results in uncoupling of photosynthesis within plant cells, a deficiency in secondary light harvesting pigments, and chlorophyll destruction due to the lack of photoprotection normally provided by carotenoids, reactive oxygen intermediates and photooxidation, with consequent albinism of plant photosynthetic tissues, growth being inhibited until death. HPPD inhibiting herbicides have proven to be very effective selective herbicides, have broad-spectrum herbicidal activity, can be used both pre-emergent and post-emergent, and have the characteristics of high activity, low residue, safety to mammals, environmental friendliness and the like.

As used herein, the terms "HPPD inhibitor", "HPPD herbicide", "HPPD inhibiting herbicide" are used interchangeably and refer to a substance that is itself herbicidally active or in combination with other herbicides and/or additives capable of modifying its effect, which acts by inhibiting HPPD, as an agent that inhibits plant growth or even dies a plant. Substances which are themselves capable of acting herbicidally by inhibiting HPPD are well known in the art and include many types, 1) triketones, for example, Sulcotrione (CAS number: 99105-77-8); mesotrione (Mesotrione, CAS number 104206-82-8); fluroxyprione (bicyclopyrone, CAS number: 352010-68-5); tembotrione (CAS number: 335104-84-2); mesotrione (tefuryltrione, CAS number 473278-76-1); benzobicylon (Benzobicyclon, CAS number: 156963-66-5); 2) diketonitriles, for example, 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-4-trifluoromethylphenyl) propane-1, 3-dione (CAS number: 143701-75-1); 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-3, 4-dichlorophenyl) propane-1, 3-dione (CAS number: 212829-55-5); 2-cyano-1- [4- (methylsulfonyl) -2-trifluoromethylphenyl ] -3- (1-methylcyclopropyl) propane-1, 3-dione (CAS number: 143659-52-3); 3) isoxazoles, for example, isoxaflutole (isoxaflutole, also known as isoxaflutole, CAS number: 141112-29-0); isoxachlorotole (isoxachlorotolole, CAS No. 141112-06-3); clomazone (CAS number: 81777-89-1); 4) pyrazoles, for example, topramezone (CAS number: 210631-68-8); sulfonylopyrazole (pyrasulfotole, CAS number: 365400-11-9); benzoxazole (pyrazoxyfen, CAS number: 71561-11-0); pyrazolate (pyrazolite, CAS number: 58011-68-0); bifenac (benzofenap, CAS number: 82692-44-2); topramezone (CAS number: 1622908-18-2); tolpyralate (CAS number: 1101132-67-5); benzoxaflutole (CAS number: 1992017-55-6); bicyclopyrone (CAS number: 1855929-45-1); mesotrione triazolate (CAS number: 1911613-97-2); 5) benzophenones; 6) other classes: lancotrione (CAS number: 1486617-21-3); fenquinolones (CAS number: 1342891-70-6). Preferably, the herbicide is an isoxazole, a triketone; preferably, the herbicide is isoxaflutole, mesotrione. The herbicides can be used in combination with the type of crop or weed to which they are applied, in controlling unwanted vegetation (e.g., weeds) before emergence, after emergence, before planting and at the time of planting.

The term "effective amount" or "effective concentration" means an amount or concentration, respectively, that is sufficient to kill or inhibit the growth of a similar parent (or wild-type) plant, plant tissue, plant cell, or host cell, but that does not kill or severely inhibit the growth of the herbicide-resistant plant, plant tissue, plant cell, and host cell of the present invention. Generally, an effective amount of herbicide is an amount routinely used in agricultural production systems to kill weeds of interest. Such amounts are known to those of ordinary skill in the art. The herbicides according to the invention exhibit herbicidal activity when applied to plants or to the locus of plants directly at any stage of growth or prior to planting or emergence. The effect observed depends on the plant species to be controlled, the growth stage of the plant, the application parameters and spray droplet size of the dilution, the particle size of the solid components, the environmental conditions at the time of use, the specific compounds used, the specific adjuvants and carriers used, the soil type, etc., and the amount of chemical applied. These and other factors can be adjusted to promote non-selective or selective herbicidal action, as is known in the art.

The term "parent nucleotide or polypeptide" refers to a nucleic acid molecule or polypeptide (protein) that can be found in nature, including wild-type nucleic acid molecules or proteins (polypeptides) that have not been artificially engineered, and also including nucleic acid molecules or proteins (polypeptides) that have been artificially engineered but do not contain the present disclosure. The nucleotide can be obtained by genetic engineering techniques, such as genome sequencing, Polymerase Chain Reaction (PCR), etc., and the amino acid sequence can be deduced from the nucleotide sequence. The "parent plant" is a plant that contains a parent nucleotide or polypeptide. The "parent nucleotide or polypeptide" may be extracted from the parent plant according to techniques well known to those skilled in the art, or may be obtained by chemical synthesis. The amino acid sequence of the parent HPPD polypeptide is shown as SEQ ID No. 1.

"tolerance" or "resistance" as used herein refers to the ability of an HPPD protein or a cell, tissue or plant containing the protein to withstand a herbicide while maintaining enzymatic activity or viability or plant growth, and can generally be characterized by parameters such as the amount or concentration of the herbicide used. Further, the HPPD enzyme of the present invention "having enhanced tolerance to an HPPD-inhibiting herbicide" or "having enhanced resistance to an HPPD-inhibiting herbicide" refers to an HPPD enzyme that exhibits at least 1.5-10 times higher maximum tolerance concentration than the parent HPPD enzyme under the same conditions as the parent HPPD enzyme, maintaining its activity of catalytically converting p-hydroxyphenylpyruvate into homogentisate. A plant that "has increased tolerance to an HPPD-inhibiting herbicide" or "has increased resistance to an HPPD-inhibiting herbicide" refers to a plant that has increased tolerance or resistance to the HPPD-inhibiting herbicide as compared to a plant containing the parent HPPD gene at a tolerant concentration that is at least 2-fold to 16-fold higher than the tolerant concentration of the parent plant. The best degree of the improvement of "tolerance" or "resistance" according to the invention is that the undesired plants can be reduced or inhibited or killed without affecting the growth or viability of the plants containing the muteins according to the invention at the same herbicide application amount or concentration.

The term "conferring resistance or tolerance to a HPPD-inhibiting herbicide" as used herein includes the improvement of tolerance to a herbicide in plants having some or less tolerance to a HPPD-inhibiting herbicide by introducing into the plant the mutant polypeptide or the nucleotide encoding the mutant polypeptide of the present invention, at concentrations of the same herbicide, in plants that do not have resistance, thereby conferring some degree of herbicide resistance or tolerance to plants having some or less tolerance to the HPPD-inhibiting herbicide.

The terms "protein", "polypeptide" and "peptide" are used interchangeably herein to refer to a polymer of amino acid residues, including polymers in which one or more amino acid residues are chemical analogues of a natural amino acid residue. The proteins and polypeptides of the invention may be produced recombinantly or may be chemically synthesized. The term "mutein" or "mutein" refers to a protein having a substitution, insertion, deletion and/or addition of one or more amino acid residues as compared to the amino acid sequence of the parent protein. As used herein, the terms "herbicide-resistant polypeptide", "mutated HPPD polypeptide", "mutant HPPD protein", "mutant HPPD enzyme", "mutein", "mutant polypeptide", "polypeptide of the invention", and the like, are used interchangeably. Preferably, the mutein comprises a core amino acid mutation at position 347 corresponding to the sequence shown in SEQ ID No.1 that is associated with HPPD inhibitory herbicide resistance.

The term "amino acid" refers to a carboxylic acid containing an amino group. Each protein in an organism is composed of 20 basic amino acids. Except glycine, the amino acid is L-alpha-amino acid (wherein proline is L-alpha-imino acid), and the structural general formula of the amino acid is shown in the specification

(R group is a variable group).

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such an alignment can be determined by using, for example, the identity of the amino acid sequences by conventional methods, as taught by, for example, Smith and Waterman,1981, adv.Appl.Math.2:482, Pearson & Lipman,1988, Proc.Natl.Acad.Sci.USA 85:2444, Thompson et al, 1994, Nucleic Acids Res 22:467380, etc., by computerized operational algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package). The BLAST algorithm (Altschulet et al, 1990, mol. biol.215:403-10), available from the National Center for Biotechnology Information www.ncbi.nlm.nih.gov /), can also be used, determined using default parameters.

As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

In the present invention, a "host organism" is understood to be any unicellular or multicellular organism into which a nucleic acid encoding a mutated HPPD protein can be introduced, including, for example, bacteria such as e.coli, fungi such as yeasts (e.g. saccharomyces cerevisiae), molds (e.g. aspergillus), plant cells and plants, and the like.

In the present invention, "plant" is understood to mean any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturation or development, in particular monocotyledonous or dicotyledonous plants, such as: (1) grain crops: oryza (Oryza spp.), such as rice (Oryza sativa), broadleaf rice (Oryza latifolia), rice (Oryza sativa), and palea (Oryza glaberrima); triticum sp, such as triticum aestivum (triticum aestivum), durum wheat (t.turgidumssp. durum); hordeum spp, such as barley (Hordeum vulgare), arizona barley (Hordeum arizonicum); rye (Secale cereale); avena species (Avena spp.) such as oats (Avena sativa), wild oats (Avena fatua), barnacle oats (Avena byzantina), Avena fatuavar, sativa, hybrid oats (Avena hybrida); echinochloa spp, for example, pearl millet (Pennisetum glaucum), Sorghum (Sorghum bicolor), triticale, maize or corn, millet, rice (rice), millet, broom millet, Sorghum bicolor, millet, Fagopyrum (Fagopyrum spp.), millet (Panicum paniculatum), millet (Setaria italica), zizaniazus aquatica (Zizaniaustifolia), Icelia carinata (Eragrostis tef), millet (Panicum paniculatum), and Uncaria paniculata (Eleusco tara); (2) bean crops: glycine (Glycine spp.), for example, Glycine (Glycine max), Glycine (Soja hispida), Glycine max, Vicia (Vicia spp.), Vigna (Vigna spp.), Pisum (Pisum spp.), Pisum (field bean), Lupinus (Lupinus spp.), Vicia (Vicia), tamarind (tamarind indica), lentil (Lens culinaris), lathyrium (lathyrius spp.), physalis (Lablab lab), fava bean, mung bean, red bean, and tonka bean; (3) oil crops: peanuts (Arachis hypogaea), Arachis (Arachis spp), Sesamum spp, Helianthus (Helianthus spp), oil palm (Elaeis) such as oil palm (eiiaeis guineensis), oil palm (Elaeis palma), soybeans (soybean), oilseed rape (brassicascapus), canola, sesame, mustard (Brassicajuncea), rapeseed oil (oilsedrape), camellia oleifera, oil palm, olive, castor oil, european rape (Brassica napus L), canola (canola); (4) fiber crops: sisal (Agave sisalana), cotton (cotton, Gossypium barbadense, Gossypium hirsutum), kenaf, sisal, abaca, flax (Linum usittissimum), jute, ramie, hemp (Cannabis sativa), or hemp; (5) fruit crops: ziziphus (Ziziphus spp.), cucurbita (Cucumis spp.), passion fruit (Passiflora edulis), Vitis (Vitis spp.), Vaccinium (Vaccinium spp.), Pyrus (Pyrus communis), Prunus (Prunus spp.), Psidium guava (Psidium spp.), punica (punicagrantum), Malus (Malus spp.), watermelon (citrullus spp.), Citrus (Citrus spp.), fig (ficus Carica), chrysosporium (Fortunella spp.), strawberry (Fragaria spp.), Prunus spp.), Crataegus (Crataegus spp.), persimmon (Diospyros spp.), red fruit (Cucumis spp.), Prunus spp.), psis (cornus spp.), Prunus spp. (Prunus spp.), Prunus spp.) (Prunus spp.), Prunus spp. (cornus (Prunus spp.), Prunus spp.) (cornus spp.), Prunus spp.) (cornus (mangus spp.), Prunus spp.) (cornus spp.), Prunus spp.) (cornus (mangus spp.), Prunus spp.) (cornus spp.) (mangus spp.), Prunus spp.) (cornus spp.), Prunus spp.) (cornus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.) (Prunus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp.) (mangus spp.), Prunus spp Guava (Psidium guajava), apple peel (Mammea americana), mango (Mangifera indica), olive (oleaeuropaa), papaya (cariapaya), coconut (Cocos nucifera), acerola (Malpighia emarginata), naseberry (manikala zapota), pineapple (anaas comosus), Annona (Annona spp.), Citrus tree (Citrus spp.), aronia (Artocarpus spp.), Litchi, scirpus (lichi chinensis), scirpus (Ribes spp.), Rubus (russpp), pear, apricot, plum, bayberry, lemon, orange, strawberry, durian, berry (strawberries curry), blueberry, coconut, peach, pear, peach, pear, blueberry, peach, pear, melon, cherry, pear, peach, pear, blueberry, peach, pear, blueberry, peach, pear, melon, blueberry, melon, cherry, walnut, or walnut; (6) root crops: cassava (Manihot spp.), sweet potato (Ipomoea batatas), taro (Colocasia esculenta), tuber mustard, onion, water chestnut, nutgrass flatsedge, yam; (7) vegetable crops: spinach (Spinacia spp.), Phaseolus (Phaseolus spp.), lettuce (Lactuca sativa), Momordica charantia (Momoracia spp.), parsley (Petroselinum crispum), Capsicum (Ca psicum spp.), Solanum (Solanum spp.) (such as potato (Solanum tuberosum), red tomato (Solanum integrifolium) or tomato (Solanum lycopersicum)), Lycopersicum (Lycopersicon spp.) (such as tomato (Lycopersicon esculentum), tomato (Lycopersicon esculentum), tomato shaped tomato (Lycopersicon esculentum), potato (Lycopersicon esculentum), tomato shaped, potato (Brassica esculentum), tomato (Brassica oleracea), potato (Brassica oleracea (Brassica), potato (Brassica oleracea), potato (Columbra), potato (Columbo) and potato (Columbo) varieties), potato (Columbo) or Brassica oleracea), potato (Columbo) varieties, Brassica) and potato (Columbo, Brassica) varieties, Brassica oleracea) and potato (Columbo) and potato (Columbo) varieties (Columbo) and potato (Columbo, Brassica oleracea) varieties, Brassica) and potato (Columbo) and potato (Columbo) variety (Columbo, Brassica oleracea) and potato (Columbo, Brassica oleracea) of the same, variety (Columbo, Columbo (Columbo, Columbo (Columbo) of the same), Columbo (Columbo ) of the same, Columbo (Columbo, Columbo (Columbo, Columbo) of the same, Columbo (Columbo) of the same, Columbo (Columbo) of the same, Columbo (Columbo, Columbo (Columbo, Columbo (Columbo) of the same, Columbo (Columbo) of, White gourd (Benincasa hispida), Asparagus (Asparagus officinalis), celery (Apium graveolens), amaranthus (Ama ranthus spp.), Allium (Allium spp.), Abelmoschus (Abelmoschus spp.), cichorus (Cichorium endivia), cucurbitus (Cucurbita spp.), coriander (coriandem sativum), eruca sativa (b. carinata), radish (Rapbanus sativus), Brassica species (e.g. european rape (Brassica napus), Brassica rapa (Brassica rapa), Brassica napus (Brassica rapa), Brassica rapa, Brassica oleracea), Brassica oleracea, Brassica rapa, Brassica oleracea, Brassica rapa, Brassica oleracea, Brassica napus, Brassica oleracea, Brassica campestrica spores, Brassica campestrica, Brassica campestris, Brassica oleracea Brassica napus, Brassica oleracea, Brassica napus, Brassica oleracea Brassica napus; (8) flower crop: tropaeolum (tropaeolum minutus), trollflower (tropaeolum maju), Canna indica (Canna indica), Opuntia (Opuntia spp.), marigold (Tagetes spp.), orchid, Crinum asiaticum, kaffir lily, Calanthus, rose, China rose, jasmine, tulip, cherry blossom, morning glory, calendula, lotus, daisy, carnation, petunia, tulip, lily, plum blossom, narcissus, winter jasmine, daphne, magnolia liliiflora, magnolia liliifolia, jojoba, juniper, kaffir, peony, Chinese flowering apple, clove, azalea, calophyllum, michelia, Chinese redbud, calamus, juniper berry, golden plum blossom, rose belt, iris, yunnan yellow jasmine, cuckoo rose, cuckoo, common selfheal, dendrobium, begonia stem, butterfly, begonia, calendula, calamus; (9) medicinal crops: safflower (Carthamus tinctorius), Mentha (Mentha spp.), Rheum undulatum (Rheum rhabararum), Crocus sativus (Crocus sativus), medlar, polygonatum odoratum, rhizoma polygonati, rhizoma anemarrhenae, radix ophiopogonis, bulbus fritillariae cirrhosae, radix curcumae, fructus amomi, polygonum multiflorum, Rheum officinale, liquorice, radix astragali, ginseng, pseudo-ginseng, acanthopanax, angelica sinensis, ligusticum wallichii, radix bupleuri, stramonium, flos daturae, mint, leonurus, wrinkled gianthyssop, scutellaria baicalensis, selfheal, pyrethrum, ginkgo biloba, cinchona japonica, natural rubber trees, alfalfa and pepper; (10) raw material crops: rubber, castor (Ricinus communis), tung tree, mulberry, rose, birch, alder, sumac; (11) pasture crops: agropyron spp, axyrium spp, Miscanthus (Miscanthus sinensis), Pennisetum (Pennisetum sp.), Phalaris (Phalaris arundinacea), switchgrass (Panicum virgatum), grassland (prairie grass), Indian grass (Indian grass), Big-bristlegrass (Big bluestem grass), Phleum pratense, turfgrasses (turf), Cyperaceae (tall-fleabane, sedge (Carex pedioformis), low-bristlegrass, alfalfa, ladder grass, lucerne, tamarisk, field-grass, red duckweed, water tassel, lupine, trefoil, sargentgloryvine, water lettuce, peanut, black grass; (12) sugar crops: sugar cane (Saccharumspp.), sugar beet (Beta vulgaris); (13) beverage crops: big leaf tea (Camellia sinensis), tea tree (tea), coffee (Coffea spp.), cocoa (Theobroma cacao), hops (hops); (14) lawn plants: grass of the genus Poa (Poa spp.) of the genus Poa (Poa pratense (blue grass)), species of the genus Agrostis (Agrostis spp.) of the genus Agrostis (grass of the family Poa pratense), species of the genus Agrostis (Agrostis glumae, grass of the genus Agrostis (grass of the genus Agrostis palustris), species of the genus Lolium spp. (Lolium spp.), species of the genus Festuspa (Festuca sp.), species of the genus Hamamelis spp. (grass of the genus Zostera), species of the genus Cynodon (Cynodon spp.) (grass of the genus Bermuda, Bermuda grass of the genus Cynodon, species of the genus Stenophora seguinea (grass of the genus Oxyula), species of the genus Sphaerotheca (grass of the genus Sparganium) (grass of the genus Poa), species of the genus Sphaerotheca (grass of the genus Populus) (grass of the genus Populus (grass of the genus Poa), species of the genus Populus (grass of the genus Setarius) (grass of the genus Setarius), species of the genus Selaginella (grass of the genus Selaginella), species of the genus Populus (grass of the genus Populus) (grass of the genus Populus (Populus), species of the genus Selaginella) Shortleaf kyllinga (Kylingbraflifolia), Amur sedge (Cyperusaamuricius), erigeron canadensis (Erigerontacanderensis), Hydrocotyle sativa (Hydrocotyle polytrichoides), Orthosiphon aristatus (Kummerowiata), Euphorbia humifusa (Euphorbia humifusa), Viola odorata (Violaarvensis), Carex alba (Carex alba), Carex isoprocarpus, and Triperus viridis (turf); (15) and (3) tree crops: pinus (Pinus spp.), Salix sp., Acer spp., Hibiscus spp., Eucalyptus sp., Ginkgo biloba (Ginko biloba), Bambusa (Bambusa sp.), Populus spp., Mucuna (Populus spp.), Psophora (Prosopis spp.), Quercus spp., Davidia (Quercussp.), Abelmoschus spp., Phoenix (Phoenix spp.), Fagus spp, Melaleuca spp., Pinus (Fabryanus spp.), Pinus tanpendra, Cinnamomum camphora (Cinnamomum spp.), Potentilla (Corchorus sp.), Melongrass Reevesii (Phragus spp.), Aconitus spp., Physalsa (Phyllanthus spp.), Populus spp., Populus nigra (Cinnamomum spp.), Populus spp., Populus nigra, Populus spp., Populus nigra Sprensis, Populus spp., Eupatula spp., Populus nigra Sprensis, Populus spp., Populus chinensis, Populus spp., Populus chinensis, Populus spp., Populus trex nigra Sprenia sinensis Sprensis, Populus spp., Populus chinensis, Populus spp., Populus chinensis, Populus trex, Populus spp., Populus trex nigra, Populus trex, Populus spp., Populus trex, Populus tremulus trex, Populus trex tremulus trex, Populus tremulus Sprensis, Populus tremulus, Populus Sprensis, Populus tremulus Sprensis, Populus tremulus Sprens, Populus tremulus Sprens, Populus tremulus, Populus Sprens, Populus tremulus Sprens, Populus, Kapok, kapok java, cercis negundo, bauhinia variegata, rain tree, albizia julibrissin, densefruit pittosporum, erythrina indica, southern magnolia, cycas revolute, crape myrtle, conifer, arbor and shrub; (16) nut crop: brazil chestnut (bertholetia excelsea), Castanea (Castanea spp.), Corylus (Corylus spp.), pecan (Carya spp.), juglans (Juglasspp), pistachio (Pistaciavera), cashew (Anacardium), occidentale, Macadamia (Macadamia integrifolia), pecan nut, Macadamia nut, pistachio nut, almond and nut-producing plants; (17) and others: arabidopsis thaliana, brachiaria, tribulus terrestris, setaria viridis, eleusine indica, Cadaba farinosa, algae (algae), Carex elata, ornamental plants, pseudodamnacanthus macrophyllus (carissaceae), Cynara (Cynara spp.), wild carrot (Daucus carota), Dioscorea (diospore spp.), saccharum spp, Festuca (Erianthus sp.), Festuca (Festuca arundinacea), daylily (hemerallis spp), Lotus spp (Lotus spp), luulan sylvatica, alfalfa (Medicago sativa), sweet clover (Melilotus spp.), black mulberry (Morus nigra), tobacco (Nicotiana spp.), silla spp., lutea, callosa spp, Syzygium spp, eupatorium (trichocauliflora spp), and the like.

The term "unwanted plants" is understood to mean plants of no practical or practical value which influence the normal growth of the desired plant (e.g. crop plants) and may include weeds, for example dicotyledonous and monocotyledonous weeds. Dicotyledonous weeds include, but are not limited to, weeds of the genera: sinapis (Sinapis), Lepidium (Lepidium), Galium Larresiae, Stellaria (Stellaria), Matricaria (Matricaria), Anthemis (Anthemis), Echinacea (Galinsoga), Chenopodium (Chenopodium), Urtica (Urtica), Senecio (Senecio), Amaranthus (Amaranthus), Portulaca (Portulaca), Xanthium (Xanthium), Convolvulus (Conlvoulus), Ipomoea (Ipomoea), Polygonum (Polygonum), Sesbania (Sesbania), Ambrosia (Ambrosia), thistle (Cirsium), Carduus (Carduus), Sonchus (Sonchus), Solanum (Solanum), Rorippa (Rorippa), Arthroma (Rotala), Matricaria (Lindernia), Hypericum (Veronica), Abutilon (Abutilon), Terra (Emex), Datura (Datura), Viola (Viola), Sasa (Galeopsis), Papaver (Papaver), Centaurea (Centaurea), Oenothera (Trifolium), Ranunculus (Ranunculus) and Taraxacum (Taraxacum). Monocotyledonous weeds include, but are not limited to, weeds of the genera: echinochloa (Echinochloa), Setaria (Setaria), Panicum (Panicum), Digitaria (Digitaria), Phleum (Phleum), Poa pratensis (Poa), Festuca (Festuca), Eleusine (Eleusine), Brachiaria (Brachiaria), Lolium (Lolium), Bromus (Bromus), Avena (Avena), Cyperus (Cyperus), Sorghum (Sorghum), Agropyron (Agropyron), Cynodon (Cynodon), Potentilla (Monochoria), Fimbristylis (Fimbristylis), Sagittaria (Sagittaria), Eleocharis (Eleococcus), Scirpus (Scirpus), Agrimonium (Pasalaum), Sparganium (Isemula), cuspidochaeta (Sphacea), Sphacea (Spargania), and Alternaria (Alternaria). The undesirable plants may also include other plants than the plants to be cultivated, such as crops of naturally occurring parts of rice cultivated land or small quantities of soybeans.

In the present invention, the term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant calli, plant pieces, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers and the like.

In the present invention, "plant cell" is understood to be any cell derived from or found in a plant, which is capable of forming, for example: undifferentiated tissue such as callus, differentiated tissue such as embryos, plant parts, plants or seeds.

In the present invention, the term "gene editing" technology includes CRISPR technology, TALEN technology, ZFN technology. Gene editing tools referred to in CRISPR technology include guideRNA, Cas proteins (e.g., Cas9, Cpf1, Cas12b, etc.). The gene editing tool referred to in TALEN technology is a restriction enzyme that can cleave a specific DNA sequence, which includes one TAL effector DNA binding domain and one DNA cleavage domain. The gene editing tool referred to in ZFN technology is also a restriction enzyme that can cut a specific DNA sequence, and includes a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to those skilled in the art that editing of intracellular genomes can be achieved by constructing the nucleotides encoding gene editing tools and other regulatory elements into suitable vectors and transforming the cells, the types of editing including gene knock-outs, insertions, base edits.

In the present invention, the term "maximum tolerated concentration" refers to the concentration of the herbicide which can be tolerated in the case of application of the herbicide while the enzyme p-hydroxyphenylpyruvate dioxygenase (HPPD) retains its catalytic activity, i.e. the activity of the HPPD in converting p-hydroxyphenylpyruvate into homogentisate.

Muteins of the invention and nucleic acids encoding the same

The invention discloses a mutant HPPD protein or a biologically active fragment thereof, which has improved resistance or tolerance to HPPD inhibiting herbicides compared with a parent HPPD protein. In particular, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the invention is mutated, compared to the parent HPPD protein, at amino acids 347 and/or 353 of the sequence corresponding to SEQ ID No. 1. Further, the mutant HPPD polypeptide may be mutated at one or more of positions corresponding to positions 20, 152, 170, 176, 211, 347, 353, 339 and 340 in the sequence shown in SEQ ID No. 1. Preferably, the types of mutations include a20E, D152N, D170N, G176C, P211L, P336L, Y339H, Y340H, a347V and E353K. Further muteins of the present invention may also comprise other HPPD resistance sites and mutation patterns corresponding to SEQ ID No.1, which have been disclosed in the prior art, such as those described in WO2019233349A1, the disclosure of which in connection with HPPD resistance is incorporated herein by reference.

Preferably, the amino acid sequence of the mutated HPPD protein further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequence depicted in SEQ ID No. 1.

The specific amino acid position (numbering) within the proteins of the invention is determined by aligning the amino acid sequence of the protein of interest with SEQ ID No.1 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is highest. Alignment scores can be calculated according to the method described in Wilbur, W.J. and Lipman, D.J, (1983) Rapid similarity searches of nucleic acid and protein data bases, Proc.Natl.Acad.Sci.USA,80: 726-730. Default parameters are preferably used in the ClustalW2(1.82) algorithm: protein gap opening penalty of 10.0; protein gap extension penalty of 0.2; protein matrix Gonnet; protein/DNA end gap-1; protein/DNAGAPDIST ═ 4. The position of a particular amino acid within a protein according to the invention is preferably determined by comparing the amino acid sequence of the protein with SEQ ID NO.1 using the AlignX program (part of the vectorNTI set) with default parameters (gap opening penalty: 10og gap extension penalty 0.05) that are suitable for multiple alignments. For example, by sequence alignment, it was determined that in the case of the barley crop (accession number CAA04245.1) the 347 th position corresponding to the sequence of SEQ ID NO.1 is 335 th position, and so on, in the case of the maize crop (accession number NP-001105782.2) the 342 th position, in the case of the tomato crop (accession number XP-004240171.1) the 341 th position, and in the case of the soybean crop (accession number NP-001235148.2) the 396 th position. As another example, it was determined by sequence alignment that 353 in the barley crop (accession number CAA04245.1) corresponding to the sequence of SEQ ID NO.1 was 341, and so on, 348 in the maize crop (accession number NP-001105782.2).

It is understood that the amino acid numbering in the muteins of the invention is based on SEQ ID No.1, and that when a particular mutein has 80% or more homology to the sequence indicated in SEQ ID No.1, the amino acid numbering of the mutein may be subject to misalignment with respect to the amino acid numbering of SEQ ID No.1, such as 1-5 positions toward the N-terminus or C-terminus of the amino acid, and that, using sequence alignment techniques conventional in the art, it is generally understood by those skilled in the art that such misalignment is within a reasonable range, and that muteins having the same or similar herbicide tolerance activity that have 80% (e.g., 90%, 95%, 98%) homology due to the misalignment of the amino acid numbering should not be within the scope of the muteins of the invention.

In the present invention, the parent hydroxyphenylpyruvate dioxygenase protein may be derived from any plant, in particular from the aforementioned monocotyledonous or dicotyledonous plants. The sequences of the parent (e.g., wild-type) hydroxyphenylpyruvate dioxygenase protein, from several sources, as well as the coding sequences, have been disclosed in the prior art documents, which are incorporated herein by reference.

Preferably, the parent hydroxyphenylpyruvate dioxygenase protein according to the invention is derived from rice, in particular rice. More preferably, said parent hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence shown in SEQ ID No.1 or an amino acid sequence which has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID No. 1.

The invention also includes the mutant polypeptides (proteins) and also active fragments, variants, derivatives and analogues thereof, including those resulting from any substitution, mutation or modification of the proteins described below.

For example, it will also be apparent to those skilled in the art that the structure of a protein may be altered without adversely affecting its activity and functionality, e.g., one or more conservative amino acid substitutions may be introduced into the amino acid sequence of the protein without adversely affecting the activity and/or three-dimensional configuration of the protein molecule. Examples and embodiments of conservative amino acid substitutions will be apparent to those skilled in the art. Specifically, the amino acid residue may be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., a nonpolar amino acid residue is substituted for another nonpolar amino acid residue, a polar uncharged amino acid residue is substituted for another polar uncharged amino acid residue, a basic amino acid residue is substituted for another basic amino acid residue, and an acidic amino acid residue is substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions where one amino acid is replaced with another amino acid belonging to the same group are within the scope of the present invention, as long as the substitution does not impair the biological activity of the protein. Thus, the mutated HPPD proteins of the invention may comprise, in addition to the above mentioned mutations, one or more further mutations, such as conservative substitutions, in the amino acid sequence. In addition, mutant HPPD proteins that also comprise one or more other non-conservative substitutions are also encompassed by the present invention, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the invention.

As is well known in the art, one or more amino acid residues may be deleted from the N-and/or C-terminus of a protein while still retaining its functional activity. Thus, in another aspect, the present invention also relates to fragments (such as amino acid fragments containing the mutation site of the present invention) which have one or more amino acid residues deleted from the N-and/or C-terminus of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein, while retaining its desired functional activity, and which are also within the scope of the present invention, referred to as biologically active fragments. In the present invention, a "biologically active fragment" refers to a part of a mutated HPPD protein of the invention which retains the biological activity of the mutated HPPD protein of the invention, while having an increased tolerance or resistance to HPPD inhibitors compared to a HPPD fragment not having said mutation. For example, a biologically active fragment of a mutant HPPD protein may be a portion of the protein lacking one or more (e.g., 1-50, 1-25, 1-10, or 1-5, e.g., 1, 2, 3,4, or 5) amino acid residues at the N-and/or C-terminus, but which still retains the biological activity of the full-length protein.

In addition, the mutant protein can be modified. Modified (generally without altering primary structure) forms include: chemically derivatized forms of the mutein such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications during synthesis and processing of the mutein or during further processing steps. Such modification may be accomplished by exposing the mutein to an enzyme that performs glycosylation, such as mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are muteins which have been modified to increase their resistance to proteolysis or to optimize solubility.

The invention also provides a fusion protein comprising the mutant HPPD protein of the invention, or a biologically active fragment thereof, and further components fused thereto. In a preferred embodiment, the further component is a plastid targeting peptide, e.g. a peptide that targets the mutated HPPD protein to the chloroplast. In another embodiment, the additional component is a tag peptide, such as 6 × His. In yet another embodiment, the further component is a peptide, e.g. a NusA peptide, that contributes to increasing the solubility of the mutant HPPD protein.

The invention also provides polynucleotides encoding the mutant HPPD polypeptides, and may also include additional coding and/or non-coding sequences. Preferably, the mutant HPPD polypeptide is shown as SEQ NO. 2. It will be apparent to those skilled in the art that due to the degeneracy of the genetic code, there are a variety of different nucleic acid sequences which encode the amino acid sequences disclosed herein. It is within the ability of one of ordinary skill in the art to generate other nucleic acid sequences encoding the same protein, and thus the present invention encompasses nucleic acid sequences that encode the same amino acid sequence due to the degeneracy of the genetic code. For example, to achieve high expression of a heterologous gene in a target host organism, such as a plant, the gene may be optimized for better expression using codons preferred by the host organism.

The present invention also includes polynucleotides that hybridize to the polynucleotide sequences described above under stringent conditions and have a degree of match between the two sequences of at least 50%, preferably at least 70%, and more preferably at least 80%. Preferably, the stringent conditions may refer to 6M urea, 0.4% SDS, 0.5 XSSC or their equivalent hybridization conditions, or may refer to conditions with higher stringency, such as 6M urea, 0.4% SDS, 0.1 XSSC or their equivalent hybridization conditions, or the hybridization with denaturant, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 ℃. In various conditions, the temperature may be above about 40℃, for example, where higher stringency conditions are desired, the temperature may be about 50℃, and further about 65℃.

The muteins and polynucleotides of the present invention are preferably provided in isolated form, and more preferably, purified to homogeneity.

The full-length sequence of the polynucleotide of the present invention can be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. The obtained nucleotide sequence can be cloned into a vector, then transferred into cells, and then separated from the proliferated host cells by a conventional method to obtain a large batch of related sequences. The mutation sites of the present invention can also be introduced by artificial synthesis.

Nucleic acid constructs, vectors

The present invention also provides a nucleic acid construct comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein of the invention, or a biologically active fragment or fusion protein thereof, operably linked to one or more regulatory elements. The term "regulatory element" as used herein refers to a nucleic acid sequence capable of regulating the transcription and/or translation of a nucleic acid to which it is operably linked. The regulatory elements comprise a promoter , a terminator sequence, a leader sequence, a polyadenylation sequence, a signal peptide coding region, a marker gene and the like.

The promoter of the present invention may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. As the promoter to be expressed in plant cells or plants, a promoter native to p-hydroxyphenylpyruvate dioxygenase or a heterologous promoter active in plants may be used. The promoter may be constitutively expressed or may be inducible. Examples of the promoter include, for example, a histone promoter, a rice actin promoter, a plant virus promoter such as a cauliflower mosaic virus promoter, and the like.

The invention also provides an expression vector, which comprises a nucleic acid sequence for encoding the mutant p-hydroxyphenyl pyruvate dioxygenase protein or a biologically active fragment or fusion protein thereof and an expression control element operably connected with the nucleic acid sequence. The expression vector also contains at least one origin of replication for self-replication. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any element which ensures self-replication. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used. Alternatively, the vector may be a vector for gene editing of an HPPD gene endogenous to the host cell.

Vectors may be of the type, for example, plasmids, viruses, cosmids, phages, etc., which are well known to those skilled in the art and are described extensively in the art. Preferably, the expression vector in the present invention is a plasmid. Expression vectors can include promoters, ribosome binding sites for translation initiation, polyadenylation sites, transcription terminators, enhancers, and the like. The expression vector may also contain one or more selectable marker genes for use in selecting host cells containing the vector. Such selectable markers include the gene encoding dihydrofolate reductase, or the gene conferring neomycin tolerance, the gene conferring resistance to tetracycline or ampicillin, and the like.

The vectors of the present invention may contain elements that allow the vector to integrate into the host cell genome or to replicate autonomously within the cell independent of the genome. For integration into the genome of a host cell, the vector may rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector suitable for integration into the genome by homologous or nonhomologous recombination. Alternatively, the vector may comprise additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at the exact location in the chromosome. To increase the likelihood of integration at a precise location, the integrational elements should preferably include a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, more preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to increase the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may integrate into the genome of the host cell by non-homologous recombination. For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicon mediating autonomous replication that functions within the cell. The term "origin of replication" or "plasmid replicon" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.

More than one copy of a polynucleotide of the invention may be inserted into a host cell to increase the yield of the gene product. An increase in the number of copies of a polynucleotide can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide, in which case cells containing amplified copies of the selectable marker gene, and thus additional copies of the polynucleotide, can be selected for by artificially culturing the cells in the presence of the appropriate selectable agent.

Methods well known to those skilled in the art can be used to construct vectors containing a DNA sequence encoding a herbicide resistance polypeptide and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in a vector to direct mRNA synthesis. The vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Vectors suitable for use in the present invention include commercially available plasmids such as, but not limited to: pBR322(ATCC37017), pKK223-3(Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1(Promega Biotec, Madison, Wis., USA) pQE70, pQE60, pQE-9(Qiagen), pD10, psiX174pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5(Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pOG 1, pSG (VK 3), (pBPV, pMSG, and Strvl Pharmacia) and the like.

The invention also provides host cells comprising a nucleic acid sequence, nucleic acid construct or expression vector of the invention. The vector comprising the vector encoding the present invention is introduced into a host cell such that the vector is present as part of a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier, or the vector may be capable of gene editing an HPPD gene endogenous to the host cell. The host cell may be any host cell familiar to those skilled in the art, including prokaryotic cells and eukaryotic cells.

The nucleic acid sequences, nucleic acid constructs or expression vectors of the invention can be introduced into a host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid mediated gene delivery, as well as calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection, electroporation, and the like.

The invention also relates to methods of producing mutant HPPD proteins or biologically active fragments thereof. The method comprises the following steps: (a) under conditions conducive to the production of the mutated HPPD protein or a biologically active fragment or fusion protein thereof

Culturing the host cell; and (b) isolating the mutated HPPD protein or biologically active fragment or fusion protein thereof.

In the production methods of the invention, the cells are cultured on a nutrient medium suitable for production of the polypeptide using methods well known in the art. If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the culture medium, it can be recovered from the cell lysate.

The polypeptide may be detected by methods known in the art that are specific for the polypeptide. These detection methods may include the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate.

The resulting polypeptide can be recovered by methods known in the art. For example, cells can be harvested by centrifugation, physically or chemically disrupted, and the resulting crude extract retained for further purification. Transformed host cells expressing a mutated HPPD protein or biologically active fragment or fusion protein thereof of the invention may be lysed by any convenient method, including freeze-thaw cycles, sonication, mechanical disruption, or use of a lytic agent. These methods are well known to those skilled in the art. The mutant HPPD proteins or biologically active fragments thereof of the present invention can be recovered and purified from cultures of transformed host cells by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and phytohemagglutinin chromatography, among others.

The present invention also relates to a method for producing a host organism, in particular a plant cell, plant tissue, plant part or plant, which is tolerant or resistant to HPPD-inhibiting herbicides, comprising transforming said host organism with a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein of the invention or a biologically active fragment thereof, a nucleic acid construct or an expression vector comprising said nucleic acid sequence, suitable vectors and selection markers being well known to the person skilled in the art. Methods for transformation of host cells, such as plant cells, are known in the art and include, for example, protoplast transformation, fusion, injection, electroporation, PEG-mediated transformation, ion bombardment, viral transformation, Agrobacterium-mediated transformation, electroporation or bombardment, and the like. A series of such transformation methods are described in the prior art, for example in EP1186666 for soybean transformation, in WO 92/09696 for monocotyledonous plants, in particular rice transformation, and the like. It may also be advantageous to culture plant explants with Agrobacterium tumefaciens or Agrobacterium rhizogenes to transfer DNA into plant cells. Whole plants can then be regenerated from infected plant material parts (such as leaf fragments, stem segments, roots and protoplasts or suspension-cultured cells) in a suitable medium, which may contain antibiotics or pesticides for selection. Transformed cells grow in the usual way in plants, they can form germ cells and transmit the transformed trait to progeny plants. Such plants can be grown in the normal manner and crossed with plants having the same transforming genetic element or other genetic elements. The resulting heterozygous individuals have the corresponding phenotypic characteristics.

The present invention also provides a method for increasing the tolerance or resistance of a plant cell, plant tissue, plant part or plant to an HPPD-inhibiting herbicide, which comprises transforming said plant or part thereof with a nucleic acid molecule comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein, or a biologically active fragment or fusion protein thereof, of the invention and allowing expression thereof. The nucleic acid molecule may be expressed as an extrachromosomal entity or may be integrated into the genome of the plant cell for expression, in particular by homologous recombination at the location of an endogenous gene in the plant cell.

The present invention also provides a method of increasing HPPD-inhibiting herbicide tolerance or resistance in a plant or part thereof, comprising crossing a plant expressing a mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein, or a biologically active fragment or fusion protein thereof, according to the invention, with another plant, and screening for plants or parts thereof having increased HPPD-inhibiting herbicide tolerance or resistance.

The present invention also provides a method of increasing HPPD-inhibiting herbicide tolerance or resistance in a plant cell, plant tissue, plant part or plant comprising genetically editing an endogenous HPPD protein of said plant cell, plant tissue, plant part or plant to effect expression therein of a mutant p-hydroxyphenylpyruvate dioxygenase protein, or a biologically active fragment or fusion protein thereof, of the present invention.

The invention further relates to plant cells, plant tissues, plant parts and plants, and progeny thereof, obtained by the above method. Preferably, plant cells, plant tissues or plant parts transformed with a polynucleotide of the present invention can be regenerated into whole plants. The invention includes cell cultures, including tissue cell cultures, liquid cultures, and solid plate cultures. Seeds produced by and/or used to regenerate the plants of the invention are also included within the scope of the invention. Other plant tissues and parts are also encompassed by the present invention. The invention likewise includes methods for producing plants or cells which contain the nucleic acid molecules according to the invention. One preferred method of producing such plants is by planting the seeds of the invention. Plants transformed in this way can acquire resistance to a variety of herbicides with different modes of action.

The invention also provides a method of controlling undesired vegetation in a plant-cultivated area in an amount effective for controlling undesired vegetation, which comprises applying to the cultivated area comprising a plant or seed of the invention an amount effective for controlling undesired vegetation of one or more HPPD-inhibiting herbicides.

In the present invention, the term "cultivated land" includes a field for cultivating the plant of the present invention such as soil, and also includes, for example, plant seeds, plant seedlings and grown plants. The term "an effective amount to control undesired vegetation" refers to an amount of herbicide sufficient to affect the growth or development of undesired vegetation, such as weeds, for example, to prevent or inhibit the growth or development of undesired vegetation, or to kill the undesired vegetation. Advantageously, such controlling of the undesired plant does not significantly affect the growth and/or development of the plant seeds, plant seedlings or plants of the present invention in an effective amount. One skilled in the art can determine such an amount of undesired vegetation effective for control by routine experimentation.

The present invention provides a method of use for identifying isoxazole HPPD herbicides by using mutant HPPDs having the polypeptide or active fragment shown in SEQ ID No. 2. The method comprises the following steps: providing a mutant HPPD polypeptide, or a cell or plant (test panel) expressing a mutant HPPD polypeptide; applying the test compound to a mutant HPPD polypeptide, or a cell or plant expressing a mutant HPPD polypeptide and a control group of parent (e.g., wild-type) proteins, cells, or plants; determining the activity or growth or viability of the test and control groups; selecting a test compound that causes a reduction in activity or growth or viability of the control group as compared to the test group.

The invention has the main advantages that:

1. the HPPD mutant polypeptide with higher resistance to isoxazole herbicides or triketone herbicides is screened out.

2. Plants containing the mutant HPPD polypeptides of the invention have at least 2-16 fold increased tolerance to isoxazole or triketone herbicides as compared to the parent plant. A tolerant concentration of at least 150 μ M to at least 800 μ M to a tolerant concentration of isoxazole herbicides or triketone herbicides to plants.

Sequence listing

SEQ ID NO.:	Description of the invention
1	Rice wild type HPPD amino acid sequence
2	A347V mutant HPPD amino acid sequence
3	E353K mutant HPPD amino acid sequence
4	Amino acid sequence of A347V + E353K mutant HPPD
5	Rice wild type HPPD nucleic acid sequence
6	A347V mutant HPPD nucleic acid sequence
7	E353K mutant HPPD nucleic acid sequence
8	A347V + E353K mutant HPPD nucleic acid sequence

Detailed description of the preferred embodiments

The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.

Example 1 construction of Gene editing vector and screening of herbicide resistant mutant site

1. Construction of Anc689BE4max-nCas9 base editor of rice endogenous HPPD gene

The CBE base editor can realize the base conversion of C/G- > T/A (Komor et al, 2016) within a certain sequence window, while the Anc689BE4max-nCas9 base editor (shown in figure 1) is optimized on the basis of the first generation CBE, and the application result in rice shows that the base conversion efficiency can BE greatly improved (Wang et al, 2019). The invention takes an Anc689BE4max-nCas9 base editor as a vector, designs a plurality of sgRNAs (taking sgRNAs shown in Table 1 as an example) in a rice endogenous HPPD gene, respectively clones the sgRNAs to the Anc689BE4max-nCas9 vector, and forms a plurality of base editors targeting the rice endogenous HPPD gene, wherein the specific preparation method is shown in (Wang et al,2019), and the amino acid coded by the rice endogenous HPPD gene is shown in SEQ ID No. 1.

TABLE 1 sgRNA sequence targeting rice HPPD Gene

sgRNA numbering	guide-PAM sequence (5 '-3')
HPPD-CBE-sg6	GCGCGCCGGGGACGTGCTCT CGG
HPPD-CBE-sg8	GTCCTCCGAGAGCACGTCCC CGG

2. Rice genetic transformation and transgenic plant identification

Taking a Nipponbare rice variety as an experimental material, and respectively transferring the base editors constructed above through agrobacteriumAnd transforming to obtain T0 transgenic plants. The plants are identified by PCR and sequencing, and some plants are found to have expected base substitutions in the target range, such as transformed plants with HPPD-CBE-sg 6C 1040,1041->A base substitution of T resulting in an amino acid mutation A347V (FIG. 2); transformed plants of HPPD-CBE-sg8 developed G^1056,1057->A base substitution resulting in another amino acid mutation E353K (fig. 5);

3. herbicide resistance screening of rice T1 generation seeds

Plants of T0 generation were planted, harvested seeds of T1 generation were husked and sterilized and inoculated onto 1/2MS medium supplemented with herbicide Isoxaflutole (Isoxaflutole) or Mesotrione (Mesotrione) to a final concentration of 400 nM. And observing and counting the germination state and the growth state of the seedlings 10 days after inoculation.

4. Results of the experiment

Seeds from T1 generations of HPPD-CBE-sg6 transformants germinated normally and seedlings remained green on Isoxaflutole (Isoxaflutole) -supplemented medium (fig. 3), whereas rice seedlings on mesotrione-supplemented medium germinated and appeared albino, and wild-type rice seedlings also showed significant albino symptoms on both screened media. Through PCR and sequencing identification, the seedlings are homozygous mutants, and compared with a wild-type sequence SEQID No. 5, the HPPD gene of the seedlings has C^1040,1041->T, resulting in an amino acid mutation A347V, the mutated HPPD amino acid sequence being shown in SEQ ID No.2 (FIG. 4).

Seeds from T1 generations of HPPD-CBE-sg8 transformants germinated normally and seedlings remained green on Mesotrione (Mesotrione) -supplemented medium (fig. 6), whereas rice seedlings on isoxaflutole-supplemented medium germinated and appeared albino, and wild-type rice seedlings also showed significant albino symptoms on both selection media. Through PCR and sequencing identification, the seedlings are homozygous mutants, and the HPPD gene of the seedlings has G compared with the wild type sequence SEQ ID No. 5^1056,1057->A base substitution resulting in an amino acid mutation E353KThe mutated HPPD amino acid sequence is shown in SEQ ID No.3 (FIG. 7). These results indicate that the HPPD (E353K) mutant is herbicide resistant to mesotrione.

5. Conclusion of the experiment

The mutation of the 347 th amino acid site of the OsHPPD polypeptide can endow plants with herbicide resistance, particularly to isoxazole herbicides; the 353 rd amino acid site mutation of the OsHPPD polypeptide can endow the plants with herbicide resistance, particularly to triketone herbicides; the invention has important application value in culturing HPPD inhibiting herbicide resistant crops.

Reference to the literature

Ahrens H,Lange G,Muller T,Rosinger C,Willms L and van Almsick A(2013).4-Hydroxyphenylpyruvate dioxygenase inhibitors in combination with safeners:solutions for modern and sustainable agriculture.ANGEW CHEM INT ED ENGL 52:9388-9398.

Beaudegnies R,Edmunds AJF,Fraser TEM,Hall RG,Hawkes TR,Mitchell G,Schaetzer J,Wendeborn S and Wibley J(2009)Herbicidal 4-hydroxyphenylpyruvate dioxygenase inhibitors-A review of the triketone chemistry story from a Syngenta perspective.BIOORGAN MED CHEM 17:4134-4152.

Yang C,Pflugrath JW,Camper DL,Foster ML,Pernich DJ and Walsh TA(2004)Structural basis for herbicidal inhibitor selectivity revealed by comparison of crystal structures of plant and mammalian 4-hydroxyphenylpyruvate dioxygenases.BIOCHEMISTRY-US 43:10414-10423.

Komor,A.C.,Kim,Y.B.,Packer,M.S.,Zuris,J.A.,and Liu,D.R.(2016).Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.NATURE 533:420–424.

Mugui Wang,Zhidan Wang,Yanfei Mao,Yuming Lu,Ruifang Yang,Xiaoping Tao and Jian-Kang Zhu(2019).Optimizing base editors for improved efficiency and expanded editing scope in rice.PLANT BIOTECHNOLOGY JOURNAL 17:1697-1699.

Hideo Maeda*,Kazumasa Murata*,Nozomi Sakuma,Satomi Takei,Akihiko Yamazaki,Md.

Rezaul Karim,Motoshige Kawata,Sakiko Hirose,Makiko Kawagishi-Kobayashi,Yojiro

Taniguchi,Satoru Suzuki,Keisuke Sekino,Masahiro Ohshima,Hiroshi Kato,Hitoshi Yoshida,Yuzuru Tozawa(2019).A rice gene that confers broad-spectrum resistance toβ-triketone herbicides.Science 365,395:393-396

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims (16)

1. A mutant polypeptide of a p-hydroxyphenylpyruvate dioxygenase (HPPD), which mutant polypeptide has a mutation at amino acid position 347 and/or 353, corresponding to the amino acid sequence shown in SEQ ID No.1, compared to the amino acid sequence of the parent p-hydroxyphenylpyruvate dioxygenase (HPPD).
2. The mutant polypeptide of claim 1, wherein the 347 th amino acid is mutated from alanine (a) to an amino acid other than alanine; the 353 rd amino acid is mutated into a non-glutamic acid amino acid from glutamic acid (E);

   preferably, the alanine (a) at position 347 is mutated to an amino acid selected from the group consisting of: valine (V), glycine (G), leucine (L), or isoleucine (I);

   preferably, the 353 rd glutamic acid (E) mutation is an amino acid selected from the group consisting of: lysine (K), histidine (H) or arginine (R);

   preferably, the alanine (a) at position 347 is mutated to an amino acid selected from the group consisting of: valine (V);

   preferably, the 353 rd glutamic acid (E) mutation is an amino acid selected from the group consisting of: lysine (K).
3. A mutant polypeptide according to claim 1 or 2, wherein the parent HPPD is derived from a monocotyledonous or dicotyledonous plant;

   preferably, the parent HPPD is derived from rice.
4. A polynucleotide encoding the mutant polypeptide of any one of claims 1-3.
5. A nucleic acid construct comprising the polynucleotide of claim 4 operably linked to a regulatory element;

   preferably, the regulatory element is selected from one or any of the following groups: enhancers, transposons, promoters, terminators, leader sequences, polynucleotide sequences, marker genes.
6. A vector comprising the polynucleotide of claim 4.
7. A host cell comprising the nucleic acid construct of claim 5 or the vector or genome of claim 6 having the polynucleotide of claim 4 integrated therein.
8. A method of making the mutant polypeptide of claim 1, the method comprising the steps of:

   (a) culturing the host cell of claim 7 under conditions suitable for expression, thereby expressing the mutant polypeptide; and

   (b) isolating said mutant polypeptide.
9. A method for conferring resistance or tolerance to a HPPD-inhibiting herbicide to a plant, said method comprising the step of introducing into a plant cell, plant tissue, plant part or plant the mutant polypeptide of any one of claims 1-3.
10. The method of claim 9, comprising the step of expressing the mutant polypeptide of any one of claims 1-3 in a plant cell, plant tissue, plant part, or plant.
11. The method of claim 10, wherein the expressing comprises the step of expressing the mutant polypeptide by an expression vector or comprises the step of expressing the polynucleotide encoding the mutant polypeptide by integrating it into the genome of the plant.
12. Method according to claim 9, characterized in that it comprises the step of mutating the endogenous HPPD of the plant so as to introduce said mutant polypeptide.
13. The method of any one of claims 9 to 12, wherein said HPPD-inhibiting herbicide is selected from the group consisting of triketones, diketonitriles, isoxazoles, pyrazoles, benzophenones, or combinations thereof;

    preferably, the triketone herbicide is preferably one or any more of bicyclsulcotrione, mesotrione, tembotrione, tefurazone or flurtamone; the isoxazole herbicide is preferably one or more of isoxaflutole, isoxachlortole and clomazone; the pyrazole herbicide is preferably one or more of pyraclonil, pyraflutole, pyraflufen-ethyl, sulfonylopyrazole or topramezone.
14. Use of a mutant polypeptide according to any one of claims 1 to 3, a polynucleotide according to claim 4, a nucleic acid construct according to claim 5 or a vector according to claim 6 or a host cell according to claim 7 for the preparation of a plant resistant or tolerant to an HPPD-inhibiting herbicide;

    preferably, the HPPD-inhibiting herbicide is selected from the group consisting of triketone, isoxazole, diketonitrile or hydroxypyrazole herbicides.
15. A method of identifying or selecting a transformed plant cell, plant tissue, plant or part thereof comprising: (i) providing a transformed plant cell, plant tissue, plant or part thereof, wherein the transformed plant cell, plant tissue, plant or part thereof comprises a polynucleotide as set forth in claim 4, wherein the polynucleotide encodes a mutant HPPD polypeptide for use as a selectable marker, and wherein the transformed plant cell, plant tissue, plant or part thereof may comprise another isolated polynucleotide part; (ii) contacting the transformed plant cell, plant tissue, plant or part thereof with at least one herbicide; (iii) determining whether a plant cell, plant tissue, plant or part thereof is affected by an inhibitory compound; and (iv) identifying or selecting a transformed plant cell, plant tissue, plant or part thereof.
16. A method of controlling unwanted vegetation at a plant cultivation site, the method comprising:

    (1) providing a plant comprising the mutant polypeptide of any one of claims 1-3 or the polynucleotide of claim 4 or the nucleic acid construct of claim 5 or the vector of claim 6, or providing a plant obtained by the method of claims 9-12;

    (2) cultivating the plant of step (1) and applying an HPPD inhibiting herbicide to the cultivation site.

Images