CN110759978A - Mutant PSII D1 or psbA D1 protein, nucleic acid encoding same and application thereof - Google Patents
Mutant PSII D1 or psbA D1 protein, nucleic acid encoding same and application thereof Download PDFInfo
- Publication number
- CN110759978A CN110759978A CN201810743043.7A CN201810743043A CN110759978A CN 110759978 A CN110759978 A CN 110759978A CN 201810743043 A CN201810743043 A CN 201810743043A CN 110759978 A CN110759978 A CN 110759978A
- Authority
- CN
- China
- Prior art keywords
- gly
- leu
- ala
- ile
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
- C12N5/12—Fused cells, e.g. hybridomas
- C12N5/14—Plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/08—Fusion polypeptide containing a localisation/targetting motif containing a chloroplast localisation signal
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention belongs to the field of agricultural genetic engineering, and particularly relates to a mutant PSII D1 or psbA D1 protein, and a coding nucleic acid and application thereof. The amino acid sequence of the mutant PSII D1 or psbA D1 protein has one or more mutations selected from the group consisting of at positions corresponding to one or more of positions 219, 249, 251, 255, 256, 264, 266, and 275 in the amino acid sequence of the wild-type rice PSII D1 or psbA D1 protein set forth in SEQ id No. 04, as compared to the amino acid sequence of the wild-type rice PSII D1 or psbA D1 protein: 219I, 249A, 251V, 255Y, 256A, 264G, 264A, 264T, 266T, and 275F. The invention endows the rice with the PSII inhibition herbicide resistance through the mutation sites so as to solve the problem that severe weedy rice and other crops are phytotoxicity to the herbicide.
Description
Technical Field
The invention belongs to the field of agricultural genetic engineering, and particularly relates to a mutant PSII D1 or psbA D1 protein, and a coding nucleic acid and application thereof.
Background
Rice is one of the most important food crops in the world, and lives nearly half of the world population, and particularly, in Asia, rice is an absolute life food for Asian people. However, the cultivation of paddy rice faces serious challenges for weedy rice. Current rice varieties resistant to imidazolinone (acetolactate synthase, ALS) and acetyl-CoA carboxylase (ACCase) inhibitors, while capable of controlling weedy rice, are herbicide resistant as rice after 3-4 years of use. The herbicide resistance traits of rice can be hybridized with rice and weedy rice, namely pollen of the resistant rice is pollinated to the weedy rice with the herbicide resistance genes, so that the weedy rice also generates drug resistance, the resistant weedy rice is further developed, the problem becomes more and more serious, and the resistant weedy rice is widely distributed in south-east Asia at present.
Disclosure of Invention
In order to solve the problems, the invention creatively adopts the mutation of rice seeds to breed the rice variety of the PSII-resistant inhibition herbicide. Surprisingly, the bred mutant rice pollen pollinates other rice and weedy rice, and the generated progeny can not inherit the resistance character to herbicide. The existing weedy rice control technology is greatly changed, and a brand-new revolutionary solution is provided for the control of the weedy rice and the resistant weeds widely accepted in China, southeast Asia and the like.
In one aspect, the invention provides a mutant PSII D1 or psbA D1 protein, or a biologically active fragment thereof, wherein the amino acid sequence of the mutant PSII D1 or psbA D1 protein has one or more mutations selected from the group consisting of: 219I, 249A, 251V, 255Y, 256A, 264G, 264A, 264T, 266T, and 275F. Preferably, the amino acid sequence of the mutant PSII D1 or psbA D1 protein further has at least 90%, at least 95%, at least 98% and at least 99% sequence identity to the amino acid sequence set forth in SEQ id.04. More preferably, the mutant PSIID1 or psbA D1 protein has the amino acid sequence shown in SEQ id.04, except having one or more amino acid mutations as defined in claim 1.
In one embodiment, the amino acid sequence of the mutant PSII D1 or psbA D1 protein of the invention has one or more mutations selected from the group consisting of at positions corresponding to one or more of positions 219, 249, 251, 255, 256, 264, 266, and 275 in the amino acid sequence of the wild type rice PSII D1 or psbA D1 protein as set forth in SEQ id No. 04: V219I, V249A, a251V, F255Y, G256A, S264G, S264A, S264T, N266T and L275F.
In a further embodiment, the amino acid sequence of the mutant PSII D1 or psbA D1 protein of the invention has one or more mutations selected from the group consisting of at positions 219, 251 and 264 in the amino acid sequence corresponding to the wild-type rice PSII D1 or psbA D1 protein set forth in SEQ id No. 04: V219I, a251V and S264G, preferably the amino acid sequence of said mutant PSII D1 or psbA D1 protein has the following amino acid mutations: S264G/A251V or S264G/V219I.
In a still further embodiment, the mutant PSII D1 or psbA D1 protein of the invention has the amino acid sequence shown in SEQ id.06 or SEQ id.08 or SEQ id.10 or SEQ id.12 or SEQ id.14 or SEQ id.16 or SEQ id.18 or SEQ id.20 or SEQ id.22 or SEQ id.24 or SEQ id.26 or SEQ id.28.
The invention also provides a fusion protein, which comprises the mutant PSII D1 or psbA D1 protein or the bioactive fragment thereof and other components fused with the fusion protein. In a preferred embodiment, the additional component is a plastid targeting peptide, e.g., a peptide that targets the mutated PSII D1 or psbA D1 protein to the chloroplast. In another embodiment, the additional component is a tag peptide, such as 6 × His. In yet another embodiment, the additional component is a peptide, such as a NusA peptide, that contributes to increasing the solubility of the mutant PSII D1 or psbA D1 protein.
In another aspect, the invention also provides an isolated polynucleotide comprising a nucleic acid sequence encoding the PSII D1 or psbA D1 protein or biologically active fragment thereof, or the fusion protein, or a complement thereof. The terms "polynucleotide" and "nucleic acid" are used interchangeably and include DNA, RNA, or hybrids thereof, whether double-stranded or single-stranded. The term "isolated" polynucleotide means that the polynucleotide contains substantially no components that normally accompany it in a naturally occurring environment.
It will be apparent to those skilled in the art that due to the degeneracy of the genetic code, there are a variety of different nucleic acid sequences which can encode the amino acid sequences disclosed herein. It is within the ability of one of ordinary skill in the art to generate other nucleic acid sequences encoding the same protein, and thus the present invention encompasses nucleic acid sequences that encode the same amino acid sequence due to the degeneracy of the genetic code. For example, to achieve high expression of a heterologous gene in a target host organism, such as a plant, the gene may be optimized for better expression using codons preferred by the host organism.
Thus, the polynucleotide has a nucleic acid sequence selected from the group consisting of: (1) a nucleic acid sequence encoding any one of the amino acid sequences of SEQ ID.06 or SEQ ID.08 or SEQ ID.10 or SEQ ID.12 or SEQ ID.14 or SEQ ID.16 or SEQ ID.18 or SEQ ID.20 or SEQ ID.22 or SEQ ID.24 or SEQ ID.26 or SEQ ID.28 or a complementary sequence thereof; (2) any one of the nucleic acid sequences shown in SEQ ID.05 or SEQ ID.07 or SEQ ID.09 or SEQ ID.11 or SEQ ID.13 or SEQ ID.15 or SEQ ID.17 or SEQ ID.19 or SEQ ID.21 or SEQ ID.23 or SEQ ID.25 or SEQ ID.27, degenerate sequences thereof or complementary sequences thereof; (3) a nucleic acid sequence which hybridizes with the sequence shown in (1) or (2) under a strict condition; and (4) a nucleic acid sequence which, due to the degeneracy of the genetic code, encodes the same amino acid sequence as the sequence shown in (1) or (2), or a complementary sequence thereof. The stringent conditions may be 6M urea, 0.4% SDS, or 0.5 XSSC, or equivalent hybridization conditions, or may be more stringent conditions, such as 6M urea, 0.4% SDS, or 0.1 XSSC, or equivalent hybridization conditions. In various conditions, the temperature may be above about 40℃, for example, where higher stringency conditions are desired, the temperature may be about 50℃, and further about 65℃. In addition, the nucleic acid sequence is optimized for expression in a plant cell.
The invention also provides an expression cassette (cassette) comprising the polynucleotide. Preferably, the expression cassette comprises a promoter region, a nucleic acid and a termination region for transcription and translation in the 5 '-3' direction of transcription. More preferably, the expression cassette is suitable for expressing a nucleic acid in a plant. Exemplary promoters include those from the CaMV35S promoter or the rice actin I gene, maize alcohol dehydrogenase gene, maize dwarf I gene, or Tobacco Mosaic Virus (TMV) omega element; exemplary transcriptional and translational termination regions include transcription termination elements or polyadenylation signals, and the like. The expression cassette may also include an origin of replication required for replication in bacteria (e.g., the ORI region from pBR322 or P15 Aori), elements required for Agrobacterium T-DNA transfer (e.g., the left and/or right borders of the T-DNA), to facilitate transformation from bacteria into plants. In addition, the expression cassette may also comprise enhancers, introns, multiple cloning sites, operators, repressor binding sites, transcription factor binding sites, etc., such as, for example, leader sequences from TMV, Maize Chlorotic Mottle Virus (MCMV) or Alfalfa Mosaic Virus (AMV) and the like as enhancers, and may, for example, comprise introns from Adh1, bronze1, actin 1 or actin 2.
The invention also provides a vector comprising the polynucleotide. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any element which ensures self-replication. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used. Alternatively, the vector may be a vector for gene editing of the PSII D1 or psbA D1 gene endogenous to the host cell.
Vectors may be of the plasmid, virus, cosmid, phage, etc. type, which are well known to those skilled in the art and are described extensively in the art. Preferably, the expression vector in the present invention is a plasmid. Expression vectors can include promoters, ribosome binding sites for translation initiation, polyadenylation sites, transcription terminators, enhancers, and the like. The expression vector may also contain one or more selectable marker genes for use in selecting host cells containing the vector. Such selectable markers include the gene encoding dihydrofolate reductase, or the gene conferring neomycin tolerance, the gene conferring resistance to tetracycline or ampicillin, and the like.
The vectors of the present invention may contain elements that allow the vector to integrate into the host cell genome or to replicate autonomously within the cell independent of the genome. For integration into the genome of a host cell, the vector may rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector suitable for integration into the genome by homologous or nonhomologous recombination. Alternatively, the vector may comprise additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at the exact location in the chromosome. To increase the likelihood of integration at a precise location, the integrational elements should preferably include a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, more preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to increase the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may integrate into the genome of the host cell by non-homologous recombination. For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicon mediating autonomous replication that functions within the cell. The term "origin of replication" or "plasmid replicon" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.
More than one copy of a polynucleotide of the invention may be inserted into a host cell to increase the yield of the gene product. An increase in the number of copies of a polynucleotide can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide, in which case cells containing amplified copies of the selectable marker gene, and thus additional copies of the polynucleotide, can be selected for by artificially culturing the cells in the presence of the appropriate selectable agent.
The nucleic acid sequences of the invention may be inserted into the vector by a variety of methods, for example by ligation following digestion of the insert and vector with appropriate restriction endonucleases. A variety of cloning techniques are known in the art and are within the knowledge of those skilled in the art.
Vectors suitable for use in the present invention include commercially available plasmids such as, but not limited to: pBR322(ATCC37017), pKK223-3(Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1(Promega Biotec, Madison, Wis., USA) pQE70, pQE60, pQE-9(Qiagen), pD10, psiX174pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5(Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pOG 1, pSG (VK 3), (pBPV, pMSG, and Strvl Pharmacia) and the like.
The invention also provides a host cell comprising said PSII D1 or psbA D1 protein or a biologically active fragment thereof, said fusion protein, said polynucleotide, said expression cassette or said vector.
The vector comprising a nucleic acid encoding the present invention is introduced into a host cell such that the vector is present as part of a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier, or the vector may be capable of gene editing the PSII D1 or psbA D1 gene endogenous to the host cell. The host cell may be any host cell familiar to the person skilled in the art, including prokaryotic cells and eukaryotic food cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells or plant cells, examples of which are Escherichia coli (E.coli), Streptomyces (Streptomyces), Bacillus subtilis (Bacillus subtilis), Salmonella typhimurium (Salmonella typhimurium), Pseudomonas (Pseudomonas), Streptomyces (Streptomyces), Staphylococcus (Staphylococcus), Spodopterasf9, CHO, COS, etc. The choice of an appropriate host cell is within the ability of those skilled in the art. Preferably, the host cell is a plant cell.
In the present invention, the term "host cell" also encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
The nucleic acid sequences, expression cassettes or expression vectors of the invention can be introduced into a host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid mediated gene delivery, as well as calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection or electroporation, and the like (see Davis, L., Dibner, M., Battey, I., Basicmethods in Molecular Biology, 1986).
In a particular embodiment, a mutant PSII D1 or psbA D1 protein of the invention can be targeted to a plastid, e.g., a chloroplast, within a plant. This can be achieved by linking in frame a nucleic acid sequence encoding a mutant PSII D1 or psbA D1 protein of the invention to a nucleic acid sequence encoding a plastid leader peptide, e.g., a chloroplast transit peptide. Alternatively, the polynucleotide, expression cassette or expression vector of the invention can be directly transformed into the chloroplast genome of a plant cell. Vectors and methods useful for transforming the chloroplast genome of a plant cell will be apparent to those skilled in the art. For example, a nucleic acid sequence encoding a mutant PSII D1 or psbA D1 protein of the invention can be integrated by bombarding leaves of a target plant with DNA-coated ions and by homologous or non-homologous recombination.
The transformed host cells may be cultured in conventional nutrient media, where appropriate. After transformation of a suitable host cell and cultivation of the host cell to an appropriate cell density, the selected promoter may be induced by appropriate means, such as temperature shift or chemical induction, and the cell may be additionally cultured for a period of time to allow production of the mutant PSII D1 or psbA D1 protein or biologically active fragment or fusion protein thereof of the invention.
The invention also provides a method for obtaining a plant resistant or tolerant to any one PSII class herbicide, comprising regenerating said plant cell into a plant. Preferably, this is done by means of transgenics, gene editing, crossing, backcrossing, selfing or asexual propagation.
In another aspect, the present invention also provides plants produced by the methods.
The present invention also provides a method of increasing resistance or tolerance to a PSII class herbicide in a plant cell, plant tissue, plant part, or plant comprising expressing in the plant cell, plant tissue, plant part, or plant the PSII D1 or psbA D1 protein or biologically active fragment thereof or the fusion protein; or comprising crossing a plant expressing said PSII D1 or psbA D1 protein or biologically active fragment thereof or said fusion protein with another plant and selecting plants or parts thereof having increased resistance or tolerance to a PSII class herbicide; or comprising genetically editing the PSII D1 or psbA D1 protein of said plant cell, plant tissue, plant part or plant to achieve expression therein of said PSII D1 or psbA D1 protein or biologically active fragment thereof or said fusion protein.
The invention also provides the use of the PSII D1 or psbA D1 protein or a biologically active fragment thereof, the fusion protein, the polynucleotide, the expression cassette or the vector for improving the resistance or tolerance of plant cells, plant tissues or the whole plant to any PSII herbicide.
The invention also provides a method of controlling weeds at a locus for growing plants, comprising applying to the locus a weed controlling effective amount of one or more PSII-type herbicides. In the present invention, the term "locus" includes a field for cultivating the plant of the present invention such as soil, and also includes, for example, plant seeds, plant seedlings and grown plants. The term "weed-controlling effective amount" refers to an amount of herbicide sufficient to affect the growth or development of a target weed, e.g., to arrest or inhibit the growth or development of a target weed, or to kill the weed. Advantageously, the weed controlling effective amount does not significantly affect the growth and/or development of the plant seeds, plant seedlings or plants of the present invention. Such an effective weed-controlling amount can be determined by one skilled in the art by routine experimentation.
The present invention also provides a method for identifying a plant, comprising the steps of: a) determining whether said plant comprises said polynucleotide; or, b) determining whether said plant expresses said PSII D1 or psbA D1 protein or a biologically active fragment thereof or said fusion protein.
In the present invention, the "PSII-type herbicide" is a substance having herbicidal activity by itself or in combination with other herbicides and/or additives capable of changing the effect thereof, and can act by inhibiting photosynthesis of plants by targeting D1 protein to the action of the photosynthesis system ii (PS ii). PSII-type herbicides are well known in the art and include many types, (1) amides: chlorantraniliprole/paraquat (pentaochlor, 2307-68-8), propanil (propanil, 709-98-8); (2) benzopyrazoles: bentazone/bentazone (25057-89-0); (3) oximes/hydroxybenzonitriles: bromophenol oxime/desmofenoxim (bromofenoxim, 13181-17-4); bromoxynil (bromoxynil, 1689-84-5); ioxynil (ioxynil, 1689-83-4); (4) carbamates: desmedipham/diphenoxylate (13684-56-5), phenmedipham/diphenoxylate (13684-63-4), phenmedipham-ethyl (13684-44-1); (5) pyridazinones: chlorpyrifos (Chlorazone/Pyrazon, 1698-60-8); (6) triazolinones: amicarbazone/amicarbazone (amicarbazone, 129909-90-6); (7) uracils: bromacil (bromoacil, 314-40-9), lenacil (2164-08-1), terfenadine (terbacil, 5902-51-2); (8) phenylpyridazines: pyridazinol (pyridafol, 40020-01-7), pyridate/pyridate (pyridate, 55512-33-9), QYP02410 (structural formula:) (ii) a (9) Triazinones(including triazinediones): hexazinone (hexazinone, 51235-04-2), metamitron (41394-05-2), metribuzin/metribuzin (metribuzin, 21087-64-9); (10) triazines (including chlorotriazines and methylthiotriazines): atrazine (atrazine, 1912-24-9), ametryne (ametryne, 834-12-8), cyanazine/cyanazine (cyanazine, 21725-46-2), desmetryne (desmetryne1, 014-69-3), penoxsulam/prenetryne (dimethomon, 22936-75-0), prometryne (1610-18-0), prometryne (prometryne, 7287-19-6), prometryne (propazine, 139-40-2), simazine (simazine, 122-34-9), simetryne/cyanazine (simetryne, 1014-70-6), metoxydim/terbutyron (terbutyron, 33693-04-8), terbuthylazine (terbuthylazine, 1915-41-3), terbutryne (terbutryne/880-50-880), madazine (trietazin, 1912-26-1); (11) ureas: chlorobromoron (chlorobromoron, 13360-45-7), chlortoluron (chlorobromoron, 15545-48-9), barbituron (chloroxuron, 1982-47-4), chlortoluron/oxazolone (dimefuron, 34205-21-5), diuron (diuron, 330-54-1), sulfosulfuron (ethidimuron, 30043-49-3), fenuron (fenuron, 101-42-8), fluometuron (flutomeron, 2164-17-2), isoproturon (isoproturon, 34123-59-6), isolocron (isouron, 55861-4), linuron (linuron, 330-55-2), bromouron (metoroburonon, 3060-89-7), thiazolium/methylbenzenesulron (metolazuron, 13391-97-32), metocloprron/metamuron (metocloprron, 111578-32), metoxuron (metoxuron, 19937-59-8), chlorsulfuron (monellinon, 1746-81-2), chlorsulfuron (neburon, 555-37-3), siduron (siduron, 1982-49-6), tebuconazole/tebuthiuron (tebuthiuron, 34014-18-1), thidiazuron/thidiazuron (51707-55-2); (12) other classes: karbutilate (4849-32-5).
In the context of the present invention, "plant" is understood to be any differentiated multicellular organism capable of photosynthesis, in particular monocotyledonous or dicotyledonous plants, such as: gramineae such as rice, wheat, corn, millet or barley.
The term "wild-type" refers to a nucleic acid molecule or protein that can be found in nature. In the present invention, the wild-type protein may be derived from any plant, in particular from the aforementioned monocotyledonous or dicotyledonous plants. Several sources of wild-type protein sequences and coding sequences have been disclosed in the prior art documents, which are incorporated herein by reference. Preferably, the wild-type protein of the invention is derived from the genus oryza, in particular rice. More preferably, the wild type PSIID1 or psbA D1 protein has the amino acid sequence shown in SEQ id.04, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ id.04. The mutant PSII D1 or psbA D1 protein or biologically active fragment thereof is derived from a rice PSII D1 or psbA D1 protein and has one or more amino acid substitutions selected from the group consisting of those described above.
The terms "protein", "polypeptide" and "peptide" are used interchangeably herein to refer to a polymer of amino acid residues, including polymers in which one or more amino acid residues are chemical analogues of a natural amino acid residue. The proteins and polypeptides of the invention may be produced recombinantly or may be chemically synthesized. The term "mutein" or "mutant protein" refers to a protein having substitutions, insertions, deletions and/or additions of one or more amino acid residues compared to the amino acid sequence of the wild-type protein.
In the present invention, the term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant calli, plant pieces, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers and the like.
In the present invention, "plant cell" is understood to be any cell derived from or found in a plant, which is capable of forming, for example: undifferentiated tissue such as callus, differentiated tissue such as embryos, plant parts, plants or seeds.
For the terms used in the specification with respect to amino acid substitutions, the first letter represents the naturally occurring amino acid at a position in the specified sequence, the following numbers represent the position relative to SEQ id.04, and the second letter represents a different amino acid substituted for the natural amino acid. For example V219I shows that valine at position 219 is replaced by isoleucine with respect to the amino acid sequence of SEQ id.04. By amino acid substitution where the first letter is absent, it is meant that the natural amino acid is substituted by the amino acid represented by the letter following the number at the position corresponding to SEQ id.04, relative to the amino acid sequence of its wild-type protein. For double or multiple mutations, each mutation is separated by a "/". For example, S264G/a251V indicates that the serine at position 264 is replaced by glycine and the alanine at position 251 is replaced by valine, both mutations being present within the particular mutant PSII D1 or psbA D1 protein, relative to the amino acid sequence of SEQ id.04.
Specific amino acid positions (numbering) within the proteins of the invention are determined by aligning the amino acid sequence of the protein of interest with SEQ id.04 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is highest. Alignment scores can be calculated according to the method described in Wilbur, W.J. and Lipman, D.J, (1983) Rapid similarity searches of nucleic acid and protein data bases, Proc.Natl.Acad.Sci.USA,80: 726-730. Default parameters are preferably used in the ClustalW2(1.82) algorithm: protein gap opening penalty of 10.0; protein gap extension penalty of 0.2; protein matrix Gonnet; protein/DNA end gap-1; protein/DNAGAPDIST ═ 4.
The position of a particular amino acid within a protein according to the invention is preferably determined by aligning the amino acid sequence of the protein with SEQ ID.04 using the AlignX program (part of the vectorNTI set) with default parameters for multiple alignments (gap open penalty: 10og gap extension penalty 0.05).
The identity of amino acid sequences can be determined by conventional methods, see, e.g., Smith and Waterman,1981, adv. appl. Math.2:482, Pearson&Lipman,1988,Proc.Natl.Acad.Sci.USA 85:2444,Thompson et al.,1994,Nucleic Acids Res 22:467380, etc., by computerized operations algorithms (GAP, BESTFIT, FASTA, and TFASTA, Genetics computer Group in the Wisconsin Genetics package). The National center for Biotechnology Information available from the United states of America can also be usedwww.ncbi.nlm.nih.gov/) The BLAST algorithm obtained (Altschul et al, 1990, mol. biol.215:403-10), was determined using default parameters.
It will also be clear to those skilled in the art that the structure of a protein may be altered without adversely affecting its activity and functionality, for example one or more conservative amino acid substitutions may be introduced in the amino acid sequence of the protein without adversely affecting the activity and/or three-dimensional configuration of the protein molecule. Examples and embodiments of conservative amino acid substitutions will be apparent to those skilled in the art. Specifically, the amino acid residue may be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., a nonpolar amino acid residue is substituted for another nonpolar amino acid residue, a polar uncharged amino acid residue is substituted for another polar uncharged amino acid residue, a basic amino acid residue is substituted for another basic amino acid residue, and an acidic amino acid residue is substituted for another acidic amino acid residue. Conservative substitutions where one amino acid is replaced with another amino acid belonging to the same group are within the scope of the present invention, as long as the substitution does not impair the biological activity of the protein.
Thus, the mutant PSII D1 or psbA D1 proteins of the invention may comprise, in addition to the above mutations, one or more further mutations in the amino acid sequence, such as conservative substitutions. In addition, mutant PSII D1 or psbA D1 proteins that also comprise one or more other non-conservative substitutions are also encompassed by the present invention, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the invention.
As is well known in the art, one or more amino acid residues may be deleted from the N-and/or C-terminus of a protein while still retaining its functional activity. Thus, in another aspect, the present invention also relates to fragments lacking one or more amino acid residues from the N-and/or C-terminus of the mutant PSII D1 or psbA D1 protein, while retaining its desired functional activity, which are also within the scope of the present invention and are referred to as biologically active fragments. In the present invention, a "biologically active fragment" refers to a portion of the mutant PSII D1 or psbA D1 protein of the invention that retains the biological activity of the mutant PSII D1 or psbA D1 protein of the invention while increasing tolerance or resistance to a PSII class herbicide. For example, a biologically active fragment of a mutant PSII D1 or psbA D1 protein may be a portion of the protein lacking one or more (e.g., 1-50, 1-25, 1-10, or 1-5, such as 1, 2, 3, 4, or 5) amino acid residues at the N-and/or C-terminus of the protein, but which still retains the biological activity of the full-length protein.
The present invention also relates to methods of producing a mutant PSII D1 or psbA D1 protein or biologically active fragment or fusion protein thereof of the invention comprising: (a) culturing the host cell under conditions conducive to the production of the mutant PSII D1 or psbA D1 protein or biologically active fragment or fusion protein thereof; and (b) recovering the mutant PSII D1 or psbA D1 protein or biologically active fragment or fusion protein thereof.
In the production methods of the invention, the cells are cultured on a nutrient medium suitable for production of the polypeptide using methods well known in the art. For example, the cells are cultured in laboratory or industrial fermentors by shake flask culture and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation is carried out on a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts using procedures known in the art. Suitable media are available from commercial suppliers or may be formulated according to published compositions (e.g., on catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the culture medium, it can be recovered from the cell lysate.
The polypeptide may be detected by methods known in the art that are specific for the polypeptide. These detection methods may include the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate.
The resulting polypeptide can be recovered by methods known in the art. For example, cells can be harvested by centrifugation, physically or chemically disrupted, and the resulting crude extract retained for further purification. Transformed host cells expressing a mutant PSII D1 or psbA D1 protein or biologically active fragment or fusion protein thereof of the invention can be lysed by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of a lytic agent. These methods are well known to those skilled in the art. The mutant PSII D1 or psbA D1 protein of the invention, or a biologically active fragment thereof, can be recovered and purified from a culture of transformed host cells by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, phytohemagglutinin chromatography, and the like.
In a particular embodiment, the present invention provides a method for producing a host organism, in particular a plant cell, plant tissue, plant part or plant, which is tolerant or resistant to a PSII class herbicide, comprising transforming said host organism with a nucleic acid sequence encoding a mutant PSIID1 or psbA D1 protein of the present invention or a biologically active fragment thereof, an expression cassette or an expression vector comprising said nucleic acid sequence. Methods for transformation of host cells, such as plant cells, are known in the art and include, for example, protoplast transformation, fusion, injection, electroporation, PEG-mediated transformation, ion bombardment, viral transformation, Agrobacterium-mediated transformation, electroporation or bombardment, and the like. A series of such transformation methods are described in the prior art, for example in EP1186666 for soybean transformation, in WO92/09696 for monocotyledonous plants, in particular rice transformation, etc. It may also be advantageous to culture plant explants with Agrobacterium tumefaciens or Agrobacterium rhizogenes to transfer DNA into plant cells. Whole plants can then be regenerated from infected plant material parts (such as leaf fragments, stem segments, roots and protoplasts or suspension-cultured cells) in a suitable medium, which may contain antibiotics or pesticides for selection. Transformed cells grow in the usual way in plants, they can form germ cells and transmit the transformed trait to progeny plants. Such plants can be grown in the normal manner and crossed with plants having the same transforming genetic element or other genetic elements. The resulting heterozygous individuals have the corresponding phenotypic characteristics.
In another embodiment, the present invention provides a method of producing host organisms, particularly plant cells, plant tissues, plant parts or plants, which are tolerant or resistant to PSII herbicides, comprising integrating and expressing nucleic acids encoding the mutant PSII D1 or psbA D1 proteins or biologically active fragments thereof of the present invention into the genome of the host organism, suitable vectors and selectable markers are well known to those skilled in the art, for example, a method of integration into the tobacco genome is described in WO06/108830, the disclosure of which is incorporated herein by reference, the gene of interest is expressed in plant cells preferably from a constitutive or inducible promoter, mRNA, once expressed, is translated into a protein, thereby incorporating the amino acid of interest into the protein, the gene encoding the protein expressed in plant cells may be under the control of a constitutive promoter, a tissue-specific promoter or an inducible promoter, the promoters encoding the protein may be used, for example, promoters derived from bacteria, such as the octopine synthase promoter, nopaline synthase promoter, mannopine synthase promoter, promoters from viruses, such as cauliflower mosaic virus (cauliflower mosaic virus), and other promoters which may be used to regulate the activity of a plant cell-specific promoter, such as a constitutive promoter, e.g. a constitutive promoter, a promoter of a plant cell-specific promoter, a promoter which may be used to regulate the plant cell-specific promoter, such as a constitutive promoter, a promoter which may be used to regulate the plant cell-specific promoter, a plant cell-specific promoter, E promoter, e.g. a promoter, a promoter which may be used to regulate the plant cell-specific promoter, a promoter which may be used to regulate the plant cell-specific promoter, a constitutive promoter, a promoter which may be used in a promoter, a promoter which may be used in a promoter, a promoter which may be used in a promoter which may.
In a specific embodiment, the method of the invention for increasing PSII herbicide tolerance or resistance in a plant cell, plant tissue, plant part or plant comprises transforming the plant or part thereof with a nucleic acid molecule comprising a nucleic acid sequence encoding a mutant PSII D1 or psbA D1 protein or biologically active fragment or fusion protein thereof of the invention and allowing expression thereof. The nucleic acid molecule may be expressed as an extrachromosomal entity or may be integrated into the genome of the plant cell for expression, in particular by homologous recombination at the location of an endogenous gene in the plant cell. These embodiments are within the scope of the present invention.
In another embodiment, the method of increasing PSII herbicide tolerance or resistance in a plant cell, plant tissue, plant part or plant of the invention comprises crossing a plant expressing a mutant PSII D1 or psbA D1 protein or biologically active fragment or fusion protein thereof of the invention with another plant and selecting a plant or part thereof having increased PSII herbicide tolerance or resistance.
In another embodiment, the method of increasing tolerance or resistance to a PSII class herbicide in a plant cell, plant tissue, plant part or plant of the invention comprises genetically editing the endogenous PSII D1 or psbA D1 protein of the plant cell, plant tissue, plant part or plant to achieve expression therein of a mutant PSII D1 or psbA D1 protein or a biologically active fragment or fusion protein thereof of the invention.
In a specific embodiment, the present invention provides a method of making a plant having increased herbicide tolerance or resistance by conventional breeding techniques comprising selfing or crossing a plant having integrated in its genome a nucleic acid sequence encoding a mutant PSII D1 or psbA D1 protein of the present invention, or a biologically active fragment thereof, and screening for progeny that comprise said encoding nucleic acid sequence heterozygous or homozygous for the progeny.
The invention further relates to plant cells, plant tissues, plant parts and plants, and progeny thereof, obtainable by the above process. Preferably, plant cells, plant tissues or plant parts transformed with a polynucleotide of the present invention can be regenerated into whole plants. The invention includes cell cultures, including tissue cell cultures, liquid cultures, and solid plate cultures. Seeds produced by and/or used to regenerate the plants of the invention are also included within the scope of the invention. Other plant tissues and parts are also encompassed by the present invention. The invention likewise includes methods for producing plants or cells which contain the nucleic acid molecules according to the invention. One preferred method of producing such plants is by planting the seeds of the invention. Plants transformed in this way can acquire resistance to a variety of herbicides with different modes of action.
For example, for transforming a plant cell with Agrobacterium, the explant can be mixed with the transformed Agrobacterium and incubated for a sufficient time to allow transformation thereof. After transformation, the Agrobacterium is killed by selection with the appropriate antibiotic and the plant cells are cultured in the appropriate selection medium. Once callus is formed, shoot formation can be promoted by the use of appropriate plant hormones according to methods well known in the art of plant tissue culture and plant regeneration. However, the callus intermediate stage is not always necessary. After bud formation, the plant cells may be transferred to a medium that promotes root formation, thereby completing plant regeneration. The plant may then be grown to produce seeds that may be used to establish future generations. Regardless of the transformation technique, it is preferred that the gene encoding the bacterial protein be incorporated into a gene transfer vector adapted for expression of the gene in a plant cell by incorporating into the vector plant promoter regulatory elements and a 3' untranslated transcription termination region (e.g., Nos, etc.).
As used herein, the terms "a", "an" and "the" mean "at least one" unless specifically stated or implied. All patents, patent applications, and publications mentioned or cited herein are incorporated by reference in their entirety to the same extent as if individually incorporated.
The invention endows the rice with the PSII inhibition herbicide resistance through the mutation sites so as to solve the problem that severe weedy rice and other crops are phytotoxicity to the herbicide.
Detailed Description
The methods used in the following examples are those described in molecular biology, tissue culture techniques and agricultural manuals, unless otherwise specified.
Example 1
The method comprises the following steps of planting mutagenized rice seeds to obtain a large amount of seeds, sowing the seeds to obtain a large amount of second-generation rice seedlings, spraying PSII herbicides, sequencing and analyzing the survival seedlings, and specifically comprises the following steps:
100 kg of Huai rice No. 5 and 100 kg of Huanghuazhan seeds are purchased from the market, soaked in water for 22 hours in a climatic chamber at 28 ℃, then fished out, dried and floated, and then soaked in 0.7% Ethyl Methane Sulfonate (EMS) for 12 hours. During this period, the seeds were stirred every hour to allow the ethyl methanesulfonate to be absorbed sufficiently uniformly by the seeds. Another part of the seeds was again soaked in water for 12 hours and treated as a control without addition of ethyl methanesulfonate. After 12 hours, the seeds were removed, the ethyl methanesulfonate solution was discarded, and the mixture was repeatedly washed with a large amount of tap water for 2 hours. Taking out and spreading on wet grass paper to germinate in a climatic chamber at 28 ℃. After germination, the seeds are sowed in the leveled rice field. The white seedling rate was checked after two weeks, and Huai rice No. 5 and Huanghua accounted for 3.7% and 4.2% of the white seedling rate treated with ethyl methanesulfonate, while the white seedling rate of the control was zero. And (5) growing the rice seedlings to blossom, bear and mature according to conventional management. And (5) respectively harvesting the rice according to varieties. When the water content is lower than 8% after being dried in the air, the seeds are sowed separately according to the variety, and the mixing is avoided. About 1.8 ten thousand seeds are sown per square meter. One third of the area was sprayed on each of the two varieties with each herbicide for 6 treatments, plus two additional controls from non-mutagenized treatments (two acres each). When the seedlings grow to 3-4 leaf stage, the seedlings are respectively sprayed with atrazine, diuron and herbicide QYP02410 produced by the company to kill the seedlings, and the spraying dosages are respectively 1500 g/hectare, 900 g/hectare and 1000 g/hectare, and 1500 g of the vegetable oil auxiliary agent is added. After three weeks, the seedlings were examined for dead seedlings and found that the seedlings mutagenized with ethyl methanesulfonate did not die completely, but a few seedlings were still alive, whereas the control field had few live seedlings and almost died completely. Representative robust surviving seedlings were recorded as atrazine-, diuron-and QYP 02410-resistant mutants, respectively, and carefully transferred to a greenhouse for seed cultivation. Meanwhile, part of leaves are cut to extract DNA for analysis. The above experiment was repeated several times to test all seeds.
The rice genomic DNA was extracted from each sample according to a conventional method. The DNA samples from each strain were PCR amplified to yield approximately 1kb of PSII D1-encoding DNA. The sequences of a pair of primers used were identical: psbAF (SEQ ID.01) and psbAR (SEQ ID.02). The DNA polymerase used was Q5DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplification conditions were: 2 minutes at 98 ℃; repeating the steps for 35 times at 98 deg.C for 20 seconds, 55 deg.C for 30 seconds and 72 deg.C for 60 seconds; finally, 2 minutes at 72 ℃. The amplified fragment showed-1 Kb on agarose gel electrophoresis, and its DNA concentration was determined by uv absorption after recovery.
These PCR-amplified DNAs were sequenced by the sanger method. The sequencing results revealed that these DNAs were indeed the PSIID1 coding sequence of rice and differed from the wild type. In short, we have found amino acid changes at multiple sites. The PSIID1 protein has amino acid mutation substitutions at positions 219, 249, 251, 255, 256, 264, 266 and 275. These mutant substitutions are V219I, V249A, a251V, F255Y, G256A, S264G, S264A, S264T, N266T and L275F. In addition to single-site mutations, there are two-site mutations, such as S264G + A251V and S264G + V219I. It is clear that these amino acid substitutions confer resistance to these herbicides on rice.
The invention further provides transgenic rice to express the mutant psbA genes. Wild type and various mutant rice OspsbA are transferred into rice for expression by adopting a standard transgenic method. The vector used was pcambia1301, the promoter was ZmUbiI and the terminator was CaMV35 SpolyA. Infecting rice calluses by agrobacterium, transforming the recombinant vector to a rice genome, screening the infected calluses on a screening culture medium containing hygromycin for 3 times, and then differentiating the calluses into seedlings; spraying herbicide to the seedling to identify its resistance, shearing part of leaves from the surviving rice seedling, identifying target gene DNA with PCR, and identifying PSII D1 expression with western blot. These transgenic rice seedlings expressing mutant PSII D1 showed resistance to PSII-inhibiting herbicides such as atrazine, diuron, or QYP 02419. Meanwhile, we are adopting a gene editing method to further develop PSII herbicide-resistant non-transgenic rice with gene editing.
Example 2
The method comprises the steps of breeding resistant rice seedlings, hybridizing with wild type rice seedlings, finding that the mutant type rice seedlings are used as female parents, pollinating the mutant type rice seedlings by wild type pollen, and obtaining new seeds which inherit the drug resistance to PSII inhibitors; in turn, the wild type is used as female parent, and the wild type is pollinated with mutant plant pollen, and the obtained plants are all killed. The specific method comprises the following steps:
according to the sequencing result of rice seedlings, two groups of hybridization experiments are directly carried out by using the current generation of survival plants and wild plants. One group contained Huai rice No. 5 containing the S264G mutation from the atrazine selection and Huai rice No. 5 of the wild type, and the other group contained Huanghua occupation containing the V219I mutation from the diuron selection and Huanghua occupation of the wild type. 50 healthy rice plants with similar growth periods were selected from the mutant type rice plants and the wild type rice plants, and the rice plants were marked as test materials. At the flowering stage, the 50 plants were divided into two groups, 25 plants each, as male and female parents. The mutant rice plant as female parent is emasculated manually, and pollen of the wild male parent is pollinated to the stigmas of the emasculated mutant female parent for artificial hybridization. Similarly, the wild type rice plant as the female parent is artificially emasculated, and pollen of the mutant male parent is pollinated to the stigma of the emasculated wild type female parent to perform artificial hybridization. Bagging and isolating, after the seeds are mature, harvesting by plants, airing and storing.
Then, the hybrid seeds are sown in flowerpots to breed seedlings and the drug resistance is measured. Each treatment had 10 pots, 10 seedlings per pot, and a total of 100 seedlings. At the 3-4 leaf stage, 1500 g/hectare of atrazine and 1500 g of vegetable oil auxiliary agent, 900 g and 1500 g of diuron and QYP 024101000 g and 1500 g of vegetable oil auxiliary agent are respectively sprayed. The results of the experiments recorded after three weeks show that the resistance of the first generation hybrid of the wild type rice and the mutant rice is only related to the female parent, namely, the progeny of the resistant female parent are all resistant, and the progeny of the non-resistant female parent are all non-resistant. The resistant male parent does not have resistance to the progeny of the non-resistant female parent.
Meanwhile, the paddy pollen with resistance character is pollinated to the weed rice manually, the obtained seeds are sowed in a flowerpot to cultivate and emerge, and the drug resistance is measured. Each treatment had 10 pots, 10 seedlings per pot, and a total of 100 seedlings. Spraying the pesticide respectively in the 3-4 leaf stage. The results of the experiment were recorded after three weeks as shown in tables 1 and 2 (where data is the number of remaining plants):
TABLE 1 resistance profiles of progeny of mutant rice plants of the present invention
TABLE 2 resistance of imidazolinone-resistant rice progeny
Therefore, the mutant variety bred by the invention can not cause the weedy rice to obtain the resistance character along with the hybridization of the pollen and the weedy rice, and the progeny of the seeds pollinated by the pollen of the rice with the imidazolinone resistance (such as the rice seed system of basf) can completely have the imidazolinone herbicide resistance. The method is a revolutionary technology for preventing and killing weed rice in the paddy field, and greatly improves the income of direct seeding rice in Asia-Pacific region.
In addition, greenhouse planting tests are also carried out in the Qingdao yellow island area. Resistant biotypes and common rice are planted in 500-square-meter paddy fields, weed rice (a plurality of types collected in Jiangsu, Zhejiang, Jiangxi and Hunan), barnyard grass, moleplant seeds, digitaria sanguinalis, monochoria vaginalis, lophatherum gracile and the like are sown in the fields, 25 g of atrazine dispersible oil suspending agent 200 g and 6% of triazophos dispersible oil suspending agent 200 g (produced by the company) are sprayed on 3-4 leaves of the post-emergence paddy rice per mu, and a single dose of 6% of triazophos OD200 g is used as a control. Statistics were taken 25 days after the experiment.
The results show that: 200 g of 25% atrazine dispersible oil suspending agent and 200 g of 6% triazophone dispersible oil suspending agent have 99% control effect on field weed rice, common rice, barnyard grass, moleplant seed, large crabgrass, monochoria vaginalis and lophatherum gracile. The control has no effect on weedy rice and common rice, and has poor control effect on large crabgrass and water bamboo leaves.
Sequence listing
<110> Qingdao Qingyuan Compound Co., Ltd
<120> mutant PSII D1 or psbA D1 protein, nucleic acid encoding same and application thereof
<130>2018.7.9
<160>28
<170>SIPOSequenceListing 1.0
<210>1
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atgactgcaa ttttagagag acgcgaaag 29
<210>2
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ttatccatta agagatggaa cttcaagag 29
<210>3
<211>1062
<212>DNA
<213> open reading frame sequence of psbA Gene of wild-type Rice (OspsbA WT)
<400>3
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttggccg attaatcttc 780
caatatgcta gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>4
<211>353
<212>PRT
<213> wild type Rice psbA protein amino acid sequence (OspsbA WT)
<400>4
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>5
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA V219I)
<400>5
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttgataacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttggccg attaatcttc 780
caatatgcta gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>6
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA V219I)
<400>6
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr AlaThr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe GlyGly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Ile Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>7
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA V249A)
<400>7
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgcggcc gctcatggtt attttggccg attaatcttc 780
caatatgcta gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>8
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA V249A)
<400>8
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Ala Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>9
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA 251V)
<400>9
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gttcatggtt attttggccg attaatcttc 780
caatatgcta gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>10
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA 251V)
<400>10
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Val His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>11
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA F255Y)
<400>11
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attatggccg attaatcttc 780
caatatgcta gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>12
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA F255Y)
<400>12
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Tyr Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>13
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA G256A)
<400>13
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttgcgcg attaatcttc 780
caatatgcta gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>14
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA G256A)
<400>14
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Ala
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340345 350
Gly
<210>15
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA S264G)
<400>15
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttggccg attaatcttc 780
caatatgctg gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>16
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA S264G)
<400>16
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Gly Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>17
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA S264A)
<400>17
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttggccg attaatcttc 780
caatatgctg cttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>18
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA S264A)
<400>18
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg LeuTyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His AsnIle
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ala Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>19
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA S264T)
<400>19
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttggccg attaatcttc 780
caatatgcta cttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>20
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA S264T)
<400>20
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala SerVal Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr AlaThr Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>21
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA N266T)
<400>21
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttggccg attaatcttc 780
caatatgcta gttttaccaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>22
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA N266T)
<400>22
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ser Phe Thr Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>23
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA L275F)
<400>23
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttggccg attaatcttc 780
caatatgcta gttttaacaa ctctcgttct ttacacttct tctttgctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>24
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA L275F)
<400>24
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 9095
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Phe Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>25
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA V219I/S264G)
<400>25
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatattatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttgataacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gctcatggtt attttggccg attaatcttc 780
caatatgctg gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>26
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA V219I/S264G)
<400>26
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Ile Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Gly Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
<210>27
<211>1062
<212>DNA
<213> open reading frame sequence of rice psbA mutant (OspsbA 251V/S264G)
<400>27
atgactgcaa ttttagagag acgcgaaagt acaagcctgt ggggtcgctt ctgcaactgg 60
ataactagca ccgaaaaccg tctttacatc ggatggttcg gtgttttgat gatccctacc 120
ttattgaccg caacttctgt atttattatc gccttcatcg ctgcccctcc agtagatatt 180
gatggtattc gtgagcctgt ttctggttct ttactttacg gaaacaatat tatctctggt 240
gccattattc ctacttctgc ggcgatcgga ttgcactttt acccaatttg ggaagctgca 300
tctgttgatg agtggttata caatggtggt ccttatgagc taattgttct acacttctta 360
cttggtgtag cttgttatat gggtcgtgag tgggaactga gtttccgtct gggtatgcgt 420
ccttggattg ctgttgcata ttcagctcct gttgcagctg ctactgctgt tttcttgatt 480
taccctattg gtcaaggaag tttctctgat ggtatgcctt taggaatatc tggtactttc 540
aactttatga ttgtattcca ggcagagcat aacatcctta tgcatccatt tcacatgtta 600
ggtgtagctg gtgtattcgg cggttcccta ttcagtgcta tgcatggttc cttggtaacc 660
tctagtttga tcagggaaac cactgaaaac gaatctgcta atgagggtta cagatttggt 720
caagaggaag aaacttataa tattgtggcc gttcatggtt attttggccg attaatcttc 780
caatatgctg gttttaacaa ctctcgttct ttacacttct tcttggctgc ttggcctgta 840
gtagggattt ggttcactgc tttaggtatt agtactatgg ctttcaatct aaacggattc 900
aatttcaacc aatctgtagt tgatagccaa ggtcgcgtta ttaatacttg ggctgatatc 960
atcaaccgtg ctaatcttgg tatggaagta atgcacgaac gtaatgctca caacttccct 1020
ctagacctag ctgctcttga agttccatct cttaatggat aa 1062
<210>28
<211>353
<212>PRT
<213> Rice psbA mutant amino acid sequence (OspsbA 251V/S264G)
<400>28
Met Thr Ala Ile Leu Glu Arg Arg Glu Ser Thr Ser Leu Trp Gly Arg
1 5 10 15
Phe Cys Asn Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr Ile Gly Trp
20 25 30
Phe Gly Val Leu Met Ile Pro Thr Leu Leu Thr Ala Thr Ser Val Phe
35 40 45
Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp Gly Ile Arg
50 55 60
Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile Ile Ser Gly
65 70 75 80
Ala Ile Ile Pro Thr Ser Ala Ala Ile Gly Leu His Phe Tyr Pro Ile
85 90 95
Trp Glu Ala Ala Ser Val Asp Glu Trp Leu Tyr Asn Gly Gly Pro Tyr
100 105 110
Glu Leu Ile Val Leu His Phe Leu Leu Gly Val Ala Cys Tyr Met Gly
115 120 125
Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro Trp Ile Ala
130 135 140
Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Thr Ala Val Phe Leu Ile
145 150 155 160
Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro Leu Gly Ile
165 170 175
Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu His Asn Ile
180 185 190
Leu Met His Pro Phe His Met Leu Gly Val Ala Gly Val Phe Gly Gly
195 200 205
Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser Ser Leu Ile
210 215 220
Arg Glu Thr Thr Glu Asn Glu Ser Ala Asn Glu Gly Tyr Arg Phe Gly
225 230 235 240
Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Val His Gly Tyr Phe Gly
245 250 255
Arg Leu Ile Phe Gln Tyr Ala Gly Phe Asn Asn Ser Arg Ser Leu His
260 265 270
Phe Phe Leu Ala Ala Trp Pro Val Val Gly Ile Trp Phe Thr Ala Leu
275 280 285
Gly Ile Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn Phe Asn Gln
290 295 300
Ser Val Val Asp Ser Gln Gly Arg Val Ile Asn Thr Trp Ala Asp Ile
305 310 315 320
Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu Arg Asn Ala
325 330 335
His Asn Phe Pro Leu Asp Leu Ala Ala Leu Glu Val Pro Ser Leu Asn
340 345 350
Gly
Claims (21)
1. A mutant PSII D1 or psbA D1 protein, or a biologically active fragment thereof, wherein the amino acid sequence of said mutant PSII D1 or psbA D1 protein has one or more mutations selected from the group consisting of: 219I, 249A, 251V, 255Y, 256A, 264G, 264A, 264T, 266T, and 275F.
2. The mutant PSII D1 or psbA D1 protein or biologically active fragment thereof of claim 1, wherein the amino acid sequence of the mutant PSII D1 or psbA D1 protein further has at least 90%, at least 95%, at least 98%, and at least 99% sequence identity to the amino acid sequence set forth in SEQ ID.04.
3. The mutant PSII D1 or psbA D1 protein or biologically active fragment thereof of claim 1 or 2, wherein the mutant PSII D1 or psbA D1 protein has the amino acid sequence set forth in SEQ ID.04, except for having one or more amino acid mutations defined in claim 1.
4. The mutant PSII D1 or psbA D1 protein or biologically active fragment thereof according to any one of claims 1-3, wherein the amino acid sequence of said mutant PSII D1 or psbA D1 protein has one or more mutations selected from the group consisting of: V219I, V249A, a251V, F255Y, G256A, S264G, S264A, S264T, N266T and L275F.
5. The mutant PSII D1 or psbA D1 protein or biologically active fragment thereof according to claim 4, wherein the amino acid sequence of said mutant PSII D1 or psbA D1 protein has one or more mutations selected from the group consisting of: V219I, a251V and S264G, preferably the amino acid sequence of said mutant PSII D1 or psbA D1 protein has the following amino acid mutations: S264G/A251V or S264G/V219I.
6. The mutant PSII D1 or psbA D1 protein or biologically active fragment thereof of any one of claims 1-5, wherein the mutant PSII D1 or psbA D1 protein has the amino acid sequence set forth in SEQ ID.06 or SEQ ID.08 or SEQ ID.10 or SEQ ID.12 or SEQ ID.14 or SEQ ID.16 or SEQ ID.18 or SEQ ID.20 or SEQ ID.22 or SEQ ID.24 or SEQ ID.26 or SEQ ID.28.
7. A fusion protein comprising a mutant PSII D1 or psbA D1 protein or biologically active fragment thereof according to any one of claims 1-6, fused to another component, e.g. a tag peptide such as 6 xhis, or a plastid targeting peptide such as a peptide that targets chloroplasts.
8. An isolated polynucleotide comprising a nucleic acid sequence encoding the PSII D1 or psbAD1 protein of any one of claims 1-6 or a biologically active fragment thereof, or the fusion protein of claim 7, or a complement thereof, preferably wherein said polynucleotide is DNA, RNA, or a hybrid thereof; the polynucleotide is single-stranded or double-stranded.
9. The polynucleotide of claim 8 having a nucleic acid sequence selected from the group consisting of:
(1) a nucleic acid sequence encoding any one of the amino acid sequences of SEQ ID.06 or SEQ ID.08 or SEQ ID.10 or SEQ ID.12 or SEQ ID.14 or SEQ ID.16 or SEQ ID.18 or SEQ ID.20 or SEQ ID.22 or SEQ ID.24 or SEQ ID.26 or SEQ ID.28 or a complementary sequence thereof;
(2) any one of the nucleic acid sequences shown in SEQ ID.05 or SEQ ID.07 or SEQ ID.09 or SEQ ID.11 or SEQ ID.13 or SEQ ID.15 or SEQ ID.17 or SEQ ID.19 or SEQ ID.21 or SEQ ID.23 or SEQ ID.25 or SEQ ID.27 or the complementary sequence thereof;
(3) a nucleic acid sequence which hybridizes with the sequence shown in (1) or (2) under a strict condition; and
(4) a nucleic acid sequence which encodes the same amino acid sequence as that of the sequence shown in (1) or (2) due to the degeneracy of the genetic code, or a complementary sequence thereof.
10. The polynucleotide of claim 8 or 9, said nucleic acid sequence being optimized for expression in a plant cell.
11. An expression cassette comprising the polynucleotide of any one of claims 8-10.
12. A vector comprising the polynucleotide of any one of claims 8-10.
13. A host cell comprising the PSII D1 or psbA D1 protein of any one of claims 1-6 or a biologically active fragment thereof, the fusion protein of claim 7, the polynucleotide of any one of claims 8-10, the expression cassette of claim 11, or the vector of claim 12, preferably wherein said host cell is a plant cell.
14. A method of obtaining a plant resistant or tolerant to any one of the PSII herbicides comprising regenerating the plant cell of claim 13 into a plant, preferably wherein the method is performed by transgenic, gene editing, crossing, backcrossing, selfing or asexual propagation.
15. A plant produced by the method of claim 14.
16. A method of conferring resistance or tolerance to a PSII-type herbicide to a plant cell, plant tissue, plant part, or plant, wherein (1) comprises expressing in the plant cell, plant tissue, plant part, or plant the PSII D1 or psbA D1 protein or biologically active fragment thereof of any one of claims 1-6 or the fusion protein of claim 7; or (2) comprising crossing a plant expressing the PSII D1 or psbA D1 protein or biologically active fragment thereof of any one of claims 1-6 or the fusion protein of claim 7 with another plant and selecting plants or parts thereof with increased resistance or tolerance to PSII class herbicides; or (3) comprising gene editing of a PSII D1 or psbA D1 protein of said plant cell, plant tissue, plant part or plant to effect expression therein of a PSII D1 or psbA D1 protein of any one of claims 1-6 or a biologically active fragment thereof, or a fusion protein of claim 7.
17. Use of the PSII D1 or psbA D1 protein of any one of claims 1-6, or a biologically active fragment thereof, the fusion protein of claim 7, the polynucleotide of any one of claims 8-10, the expression cassette of claim 11, or the vector of claim 12 for conferring resistance or tolerance to any one PSII class herbicide on a plant cell, plant tissue, whole plant.
18. A method of controlling weeds at a plant locus, wherein the plants comprise the plant of claim 15 or the plant prepared by the method of claim 14 or 16, the method comprising applying to the locus a weed controlling effective amount of one or more PSII-type herbicides.
19. A method for identifying a plant comprising the steps of:
a) determining whether the plant comprises a polynucleotide of any one of claims 8-10; or the like, or, alternatively,
b) determining whether said plant expresses the PSII D1 or psbA D1 protein or biologically active fragment thereof according to any one of claims 1-6 or the fusion protein according to claim 7.
20. The method of any one of claims 14, 16 and 18 or the use of claim 17, wherein the PSII-class herbicide comprises at least one of the following active ingredients:
(1) amides: mechloranilide, propanil;
(2) benzopyrazoles: bentazone;
(3) oximes/hydroxybenzonitriles: phytocide, bromoxynil and ioxynil;
(4) carbamates: desmedipham, diphenoxylate;
(5) pyridazinones: killing phytocide;
(6) triazolinones: amicarbazone;
(7) uracils: weeding, weeding and weeding;
(8) phenylpyridazines: pyridazinol, pyridate, QYP 02410;
(9) triazinones: hexazinone, metamitron, metribuzin;
(10) triazines: atrazine, ametryn, cyanazine, dimethomon, pentrazine, prometon, prometryn, simazine, simetryn, terbuthylazine, terbutryn, and prodazine;
(11) ureas: chlorsulfuron, chlortoluron, chlorsulfuron, oxazolone, diuron, sulfosulfuron, fensulfuron, fluometuron, isoproturon, clomazone, linuron, bromuron, thiazoluron, metoxuron, chlorsulfuron, glusulfuron, cycuron, tebuconazole, thidiazuron;
(12) other classes: kacaoling.
21. The method of any one of claims 14, 16 and 18 to 19, the plant of claim 15 or the use of claim 17, wherein the plant is a graminaceous plant such as rice, wheat, maize, millet or barley.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810743043.7A CN110759978A (en) | 2018-07-09 | 2018-07-09 | Mutant PSII D1 or psbA D1 protein, nucleic acid encoding same and application thereof |
PCT/CN2019/095083 WO2020011127A1 (en) | 2018-07-09 | 2019-07-08 | Mutant psii d1 or psba d1 protein, coding nucleic acid thereof and use thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810743043.7A CN110759978A (en) | 2018-07-09 | 2018-07-09 | Mutant PSII D1 or psbA D1 protein, nucleic acid encoding same and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN110759978A true CN110759978A (en) | 2020-02-07 |
Family
ID=69142084
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810743043.7A Pending CN110759978A (en) | 2018-07-09 | 2018-07-09 | Mutant PSII D1 or psbA D1 protein, nucleic acid encoding same and application thereof |
Country Status (2)
Country | Link |
---|---|
CN (1) | CN110759978A (en) |
WO (1) | WO2020011127A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113755457A (en) * | 2020-09-23 | 2021-12-07 | 山东舜丰生物科技有限公司 | Herbicide-resistant acetyl coenzyme A carboxylase mutant and application thereof |
CN114107553A (en) * | 2022-01-24 | 2022-03-01 | 华智生物技术有限公司 | Identification method for detecting triazine herbicide tolerant rape with high throughput and low cost |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101437844A (en) * | 2006-03-09 | 2009-05-20 | 纳幕尔杜邦公司 | Polynucleotide encoding a maize herbicide resistance gene and methods for use |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1571907A4 (en) * | 2002-12-16 | 2006-03-15 | Valent Biosciences Corp | Herbicidal composition comprising a ps-ii inhibitor and sar inducer |
US11219216B2 (en) * | 2015-04-02 | 2022-01-11 | The Board Of Trustees Of The University Of Arkansas | Method of improving tolerance of plants to herbicides using seed insecticide treatments |
CN106119369A (en) * | 2016-07-04 | 2016-11-16 | 山东省农业科学院植物保护研究所 | The PCR detection method of anti-Inhibitors of photosystem II class herbicide Herba Digitariae |
-
2018
- 2018-07-09 CN CN201810743043.7A patent/CN110759978A/en active Pending
-
2019
- 2019-07-08 WO PCT/CN2019/095083 patent/WO2020011127A1/en active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101437844A (en) * | 2006-03-09 | 2009-05-20 | 纳幕尔杜邦公司 | Polynucleotide encoding a maize herbicide resistance gene and methods for use |
Non-Patent Citations (8)
Title |
---|
D. H. PERRY等: ""Triazine-Resistant Annual Bluegrass (Poa annua) Populations with Ser264 Mutation Are Resistant to Amicarbazone"", 《WEED SCIENCE》 * |
DIEKMANN,K.等: ""YP_001531263.1"", 《GENBANK》 * |
LEMMA W MENGISTU等: ""psbA Mutation (valine219 to isoleucine) in Poa annua resistant to metribuzin and diuron"", 《PEST MANAGEMENT SCIENCE》 * |
LIU, MY等: ""Characterization of multiple-herbicide-resistant Italian ryegrass (Lolium perenne spp. multiflorum)"", 《PEST MANAGEMENT SCIENCE》 * |
M I FRAGA & M G TASENDE: ""Mechanisms of resistance to simazine in Sonchus oleraceus"", 《WEED RESEARCH》 * |
MORTON,B.R.等: ""NP_039360.1"", 《GENBANK》 * |
RAFAEL M PEDROSO等: ""A psbA mutation (Val219 to Ile) causes resistance to propanil and increased susceptibility to bentazon in Cyperus difformis"", 《PEST MANAG SCI》 * |
佚名: ""WP_102661101.1"", 《GENBANK》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113755457A (en) * | 2020-09-23 | 2021-12-07 | 山东舜丰生物科技有限公司 | Herbicide-resistant acetyl coenzyme A carboxylase mutant and application thereof |
CN114107553A (en) * | 2022-01-24 | 2022-03-01 | 华智生物技术有限公司 | Identification method for detecting triazine herbicide tolerant rape with high throughput and low cost |
Also Published As
Publication number | Publication date |
---|---|
WO2020011127A1 (en) | 2020-01-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101460626B (en) | Method for selection of transformed cells | |
ES2743420T3 (en) | Rice plants that have increased tolerance against imidazolinone herbicides | |
AU2016399292B2 (en) | Herbicide tolerant protein, encoding gene and use thereof | |
CN110904071B (en) | Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance | |
US10633669B2 (en) | Herbicide-resistant protein, encoding gene and use thereof | |
CN105746255B (en) | The purposes of herbicide tolerant protein | |
WO2021051265A1 (en) | Mutant hydroxyphenylpyruvate dioxygenase polypeptide, encoding gene thereof and use thereof | |
CN105724139A (en) | Application of herbicide tolerance protein | |
CN105766992A (en) | Application of protein having tolerance to herbicides | |
RU2681162C1 (en) | Herbicides resistance protein encoding genes thereof and application thereof | |
US9657307B2 (en) | Herbicide resistance gene and use thereof | |
CN102816777A (en) | Plant glyphosate-resistant gene and applications thereof | |
CN110628733B (en) | Herbicide tolerance protein, coding gene and application thereof | |
US10562944B2 (en) | Herbicide-resistant protein, encoding gene and use thereof | |
CN110759978A (en) | Mutant PSII D1 or psbA D1 protein, nucleic acid encoding same and application thereof | |
CN111304178B (en) | Herbicide tolerance protein, coding gene and application thereof | |
MX2014007711A (en) | Methods for improving crop yield. | |
HUT62333A (en) | Process ofr producing herbicide-resistant mutants of acetohydroxy acid synthesis enzyme | |
CN110628732A (en) | Herbicide tolerance protein, coding gene and application thereof | |
CN110656094A (en) | Herbicide tolerance protein, coding gene and application thereof | |
CN117210474B (en) | Late blight resistance gene, biological material and application | |
LU501061B1 (en) | USE OF SOYBEAN PROTEIN KINASE GENE GmSTK_IRAK | |
WO2023108495A1 (en) | Mutated hydroxyphenylpyruvate dioxygenase polypeptide, and coding gene and use thereof | |
CN115786297A (en) | AhALS2 mutant protein based on gene editing technology and application of gene thereof in peanut breeding | |
CN113403321A (en) | Application of OsAKR4C10 in creating non-transgenic glyphosate-resistant rice germplasm resources |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200207 |
|
RJ01 | Rejection of invention patent application after publication |