CN113421611B - Animal gene positioning method - Google Patents

Animal gene positioning method Download PDF

Info

Publication number
CN113421611B
CN113421611B CN202110575589.8A CN202110575589A CN113421611B CN 113421611 B CN113421611 B CN 113421611B CN 202110575589 A CN202110575589 A CN 202110575589A CN 113421611 B CN113421611 B CN 113421611B
Authority
CN
China
Prior art keywords
gene
asmt
animal
genes
target gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110575589.8A
Other languages
Chinese (zh)
Other versions
CN113421611A (en
Inventor
刘国世
李广栋
王静
王立凯
关盛宇
阎来庆
吕东颖
张鲁
姬鹏云
马文奎
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN202110575589.8A priority Critical patent/CN113421611B/en
Publication of CN113421611A publication Critical patent/CN113421611A/en
Application granted granted Critical
Publication of CN113421611B publication Critical patent/CN113421611B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6818—Sequencing of polypeptides
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B50/00—ICT programming tools or database systems specially adapted for bioinformatics

Abstract

The invention relates to a method for positioning animal genes, in particular to a method for positioning animal ASMT genes. The animal gene positioning method provided by the invention provides valuable reference basis for the research of other unknown genes, initiatively positions the pig ASMT genes, and can provide a new reference for the research of pig melatonin biosynthesis paths.

Description

Animal gene positioning method
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a positioning method of animal genes.
Background
Melatonin (Melatonin, MT, N-acetyl-5-methoxy tryptamine) is also called "brain platinum", and is an important indole active small molecular substance synthesized and secreted by organs such as pine cone and ovary of mammals, and is widely distributed in a plurality of tissues of animals. Melatonin is a very important endocrine hormone whose synthesis is inhibited by light, exhibiting diurnal, nocturnal rhythmic oscillations, and is therefore also called "dark hormone". Melatonin has a variety of physiological and pharmacological functions, such as: improving sleep, regulating biorhythm, relieving stress, regulating immune system, enhancing immunity, resisting tumor, and resisting aging. Melatonin and its metabolites are important broad-spectrum antioxidants, and can remove oxygen Radical (ROS), high-activity nitrogen Radical (RNS) and the like in and out of animals, activate the expression of intracellular antioxidant enzyme genes and further play an antioxidant function. In addition, melatonin can protect the stability of cellular DNA, reduce the damage of lipid, maintain mitochondrial function, promote the expression of anti-apoptotic genes, etc. Melatonin is also a key reproductive hormone, and directly or indirectly regulates and controls secretion, follicular development, embryo development, attachment and the like of the reproductive hormone in animal reproductive activities, and also participates in regulating and controlling the estrus cycle of seasonal estrus animals.
The pig stock in China is the country with the largest stock of live pigs in the world, the healthy development of pig industry and the stable supply of pork are closely related to national life, and the continuous development of experimental model pigs greatly promotes the research progress of biomedicine and medicines in China. However, there is still a gap between the productivity of sow in China and the developed state. The low sow breeding efficiency is one of key factors for restricting the healthy and rapid development of pig industry in China. The melatonin has wide application in improving pig production performance, and can improve reproductive performance, resist heat stress, relieve diarrhea of piglets, improve intestinal microorganisms, enhance immunity, relieve gamete and embryo freezing injury and the like. Studies have shown that various tissues and organs of pigs can secrete synthetic melatonin, but the synthetic route is still unclear.
In mammals, the primary source of melatonin synthesis is L-tryptophan (tryptophan). L-tryptophan undergoes a TPH (tryptophane hydroxylase, tryptophan hydroxylase) catalyzed hydroxylation to produce 5-hydroxytryptophan (5-Hydroxytryptophan, 5-HTP) and then undergoes a AAAD (L-aromatic amino acid decarboxylase ) decarboxylation to become 5-hydroxytryptamine (5-Hydroxytryptamine, 5-HT), also known as serotonin (Serotonin). 5-hydroxytryptamine is reacted with AANAT (ARYLALKYLAMINE-N-ACETYLTRANSFERASE, aralkylamine N-acetyltransferase) to form N-Acetyl-5-hydroxytryptamine (N-Acetyl-Serotonin, NAS). Finally methylation occurs under catalysis of ASMT (acetylserotonin O-METHYLTRANSFERASE, acetyl-5-hydroxytryptamine-oxy-methyltransferase) to produce the final melatonin. On other animals (e.g., mice, rats, rhesus monkeys, cows, sheep, goats, chickens, ducks, fish, etc.), the synthase gene during melatonin synthesis has been successfully identified and cloned. The mouse ASMT gene is located in the pseudo-autosomal region of the X chromosome (Pseudoautosomal region, PAR) which has a high recombination and mutation rate, and thus the mouse Asmt gene was not successfully located and cloned until 2010.
For pigs of significant food and medical value, the inventors found that there was no pig ASMT gene in the NCBI database, and we speculated that the pig ASMT gene might resemble mouse ASMT, and that the high mutation rate in the complex region might lead to the pig ASMT gene not yet been successfully mined, which is also a major cause of the forefront of the study of melatonin biosynthesis pathway related in pigs.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a positioning method of unknown or information chaotic genes by applying a bioinformatics method.
The specific technical scheme is as follows:
In a first aspect, the invention provides a method for mapping an animal gene. The animal to be localized has a target gene and the location of the target gene in the genome of the animal to be localized is not disclosed or not properly disclosed.
The animal gene positioning method comprises the following steps:
(1) Selecting animal species whose target gene locus is correctly disclosed, the number of said species being not less than 2;
(2) Locating the position coordinates of the target gene on the chromosomes of the species in the step (1), and identifying genes adjacent to the target gene position and/or genes accompanying the target gene;
(3) Based on the information obtained in the step (2), adopting a comparative genomics method to analyze and obtain the rule information of target gene positioning;
(4) And judging the correct position coordinates of the target gene on the chromosome of the animal to be positioned according to the conservation of the gene and the rule information.
In the methods provided herein, the disclosure or (not) proper disclosure refers to disclosure in databases commonly used in the art, such as NCBI and Ensemble databases.
In the method provided by the invention, the number of animal species with correctly disclosed target gene positions is at least 2, and more species are helpful for obtaining more accurate rule information. The species of animal is preferably similar to the biological classification of the animal to be localized.
In some embodiments of the invention, the rule information for target gene localization includes at least: the method comprises the steps of determining the position of a target gene, determining the position coordinates of the target gene and the relative position relation between the target gene and the target gene, and/or determining the position coordinates of the target gene and the relative position relation between the target gene and the target gene. The regularization gene is the same gene which is more than 80% of the total number, preferably 100% of the correctly positioned animal species in step (1) have at the same position. On the basis of knowing the position coordinates of the regular gene and the regular gene, the position coordinates of the target gene can be judged according to the relative position relation between the regular gene and the target gene.
The method of the invention may further comprise: and determining the correct nucleotide sequence and/or the amino acid sequence corresponding to the target gene of the animal to be localized according to the correct position coordinates of the target gene on the chromosome of the animal to be localized.
The method of the invention may further comprise: based on the nature (e.g., protein structure) and/or function of the target protein, it is verified whether the target gene is correctly located.
In a second aspect, the invention provides a method for targeting an animal ASMT (acetylserotonin O-METHYLTRANSFERASE, acetyl-5-hydroxytryptamine-oxy-methyltransferase) gene. The animal to be localized has ASMT genes and the location of ASMT genes in the genome of the animal to be localized is not disclosed or is not properly disclosed.
The animal ASMT gene locating method includes the following steps:
(1) Selecting an animal species whose ASMT gene locus is correctly disclosed, the number of said species being not less than 2;
(2) Locating the position coordinates of ASMT genes on the chromosomes of each species described in step (1) and identifying genes adjacent to the ASMT gene position and/or genes that accompany the ASMT gene;
(3) Based on the information obtained in the step (2), adopting a comparative genomics method to analyze and obtain ASMT gene positioning rule information;
(4) And judging the correct position coordinates of ASMT genes on the chromosome of the animal to be positioned according to the conservation of the genes and the rule information.
In the methods provided herein, the disclosure or (not) proper disclosure refers to disclosure in databases commonly used in the art, such as NCBI and Ensemble databases.
In the method provided by the invention, the number of animal species with correctly disclosed ASMT gene positions is at least 2, and more species numbers are helpful for obtaining more accurate rule information. The species of animal is preferably similar to the biological classification of the animal to be localized.
In some embodiments of the invention, the rule information for ASMT gene localization includes at least: a regularization gene adjacent to ASMT gene position, position coordinates of the regularization gene itself and relative position relation of the regularization gene and ASMT gene, and/or a regularization gene which is accompanied with ASMT gene, position coordinates of the regularization gene itself and relative position relation of the regularization gene and ASMT gene. The regularization gene is the same gene which is more than 80% of the total number, preferably 100% of the correctly positioned animal species in step (1) have at the same position. Based on knowing the position coordinates of the regularization gene and the gene itself, the position coordinates of the ASMT gene can be determined according to the relative position relationship between the regularization gene and the ASMT gene.
In some embodiments of the invention, the regularity gene comprises AKAP17A gene and/or ASMTL gene.
The method of the invention may further comprise: and determining the nucleotide sequence and/or the amino acid sequence corresponding to the ASMT gene of the animal to be localized according to the correct position coordinates of the ASMT gene on the chromosome of the animal to be localized.
The method of the invention may further comprise: based on the nature (e.g., protein structure) and/or function of ASMT proteins, it was verified whether the ASMT gene was correctly located.
As a specific embodiment of the present invention, the animal to be localized is a pig.
The method provided by the invention can be used for correctly positioning the ASMT gene of the pig, so that the nucleotide sequence of the ASMT gene of the pig is determined to be shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the ASMT gene of the pig is determined to be shown as SEQ ID NO. 2.
In a third aspect, the present invention provides the use of the localization method according to the second aspect for studying melatonin biosynthesis in an animal.
Compared with the prior art, the gene positioning method provided by the invention provides valuable reference basis for the research of other unknown genes. And as the biosynthesis path of the pig melatonin is still not broken up so far, the last step of the pig melatonin synthetase ASMT gene is not found so far, and the method provided by the invention initially positions the pig ASMT gene, can provide a new reference for the research of the pig melatonin biosynthesis path, and has important scientific significance for the research of pig biological rhythm, reproductive biology and neuroendocrine.
Drawings
FIG. 1 shows the results of the search for the different forms of the pig ASMT gene in NCBI;
FIG. 2 is a pig ASMT gene-related literature search and primer sequence alignment;
FIG. 3 is a longitudinal comparison of the gene coordinates of different species ASMT and the arrangement pattern on the chromosome;
FIG. 4 is a transverse and longitudinal comparison of the coordinates of the ASMT and ASMTL genes of different species and the arrangement pattern on the chromosome;
FIG. 5 is a pig ASMT gene locus;
FIG. 6 is NCBI LOC110258194 and Ensemble ENSSSCG00000032659 and UCSC search results;
FIG. 7 shows the analysis of the phylogenetic tree and protein domains of the genes of different species ASMT and ASMTL;
fig. 8 is a CDD analysis of pig ASMTL and LOC 110258194.
Detailed Description
The following examples are illustrative of the invention and are not intended to limit the scope of the invention.
Example 1: existing information retrieval
NCBI database without pig ASMT
First, the pig ASMT gene was searched in NCBI, as shown in FIG. 1A, showing No items found; then, another name HIOMT of ASMT is retrieved, as shown in FIG. 1B, again no results are retrieved; finally, the full scale acetylserotonin O-METHYLTRANSFERASE of ASMT genes was searched, resulting in the ASMTL (acetylserotonin O-METHYLTRANSFERASE-like) gene (FIG. 1C).
Pig ASMT Gene fresh research in Google scholarar
At Google scholar, a search was made for literature on the porcine ASMT gene study, only one Bae H,Yang C,Lee J Y,et al.Melatonin improves uterine-conceptus interaction via regulation of SIRT1 during early pregnancy[J].Journal of Pineal Research,2020,69(2):e12670( figure 2A was searched. Primer-BLAST was performed based on the Primer sequences of the pig ASMT gene provided in the literature (FIG. 2B), and the result is shown in FIG. 2C, and the aligned gene is ASMTL, indicating that the article author treated pig ASMTL as ASMT gene.
Example 2: localization of pig ASMT Gene
1. AKAP17A genes of different species are often accompanied by ASMT genes and are distributed in the same direction
Longitudinal comparison of the distribution rules of the ASMT genes of different species on the chromosome is carried out, ASMT genes of different species such as human (homo sapiens), sheep (ovis aries), horse (Equus caballis), cow (Bos taurus), buffalo (Bubalus bubalis), panda (Ailuropoda melanoleuca), mouse (mus musculus), dog (Canis lupus familiaris), domestic cat (Felis catus), blue whale (Balaenopteramusculus), chicken (Gallus gallus), zebra fish (Danio rerio) and the like are searched out by utilizing NCBI database Genome DataViewer, and the positions of the genes on the chromosome and the adjacent genes on the periphery of the genes are analyzed and compared. As shown in FIG. 3, it was found that ASMT genes of mammals such as human, sheep, horse, cow, buffalo, panda, mouse, dog, cat, blue whale and the like were located on X sex chromosomes. Furthermore, it is regular that the AKAP17A gene of mammals, chickens, zebra fish and the like is accompanied by ASMT genes and the two genes are arranged in the same direction.
2. The ASMT and ASMTL genes of different species are located on the same chromosome and are in reverse arrangement rule
The distribution rules of the ASMTL genes of different species on the chromosome are compared longitudinally, and meanwhile, the distribution rules of the ASMT and ASMTL genes of different species on the chromosome are compared transversely. We found that human ASMT and ASMTL genes are on the same chromosome and adjacent. Thus, we further compared the distribution of ASMTL genes of different species on the chromosome, and also compared the distribution of ASMT and ASMTL genes of different species. As shown in FIG. 4, the P2RY8 genes of different species are usually accompanied by ASMTL genes and the two genes are also arranged in the same direction, and more importantly, the ASMT genes and the ASMTL genes of different species are all on the same chromosome and are close to each other in position, and ASMT genes and ASMTL genes are arranged in the reverse direction.
3. Pig ASMT Gene located in the PAR region of the X chromosome
Based on the above findings regarding the reverse arrangement of the ASMT and ASMTL genes in different species, we speculate that the pig should follow this rule as well. Thus, we searched for the pig ASMTL gene by NCBI Graphical Sequence Viewer, as shown in FIG. 5, according to the rule that the AKAP17A gene (indicated by purple arrow in the figure) is accompanied by the ASMT gene and the P2RY8 gene (indicated by blue arrow in the figure) is accompanied by the ASMTL gene (outlined by orange box), it was found that there was indeed A gene called LOC110258194 (outlined by red box) beside the AKAP17A gene on the X chromosome of the pig, the position arrangement rule was completely consistent with ASMT genes of other species, and that there was A gene ENSSSCG00000032659 (outlined by black box) at the same position in the Ensemble database, and that the exons of the two genes were completely overlapped (the red vertical line in the figure indicates the exon position). Next we will demonstrate that NCBI LOC110258194 and Ensemble ENSSSCG00000032659 are the pig ASMT gene.
We searched pig LOC110258194 in the NCBI database to find that its Gene description is not ASMT but ASMTL (FIG. 6A), and ENSSSCG00000032659 searched in the Ensemble database is ASMTL (FIG. 6B) although the Gene name is ASMT. Since the pig ASMTL gene is already an independently annotated gene (FIG. 6C), it is apparent that both the NCBI and Ensemble databases misannotate pig ASMT as ASMTL. We further demonstrated that ASMT gene was found at the same location in the genomes of different species using UCSC Genome Browser (FIG. 6D).
To further confirm that the NCBI and Ensemble databases misannotate pig ASMT as ASMTL, we distinguished the two genes from the protein domain. The ASMT and ASMTL gene clades and protein domains of 42 different species were plotted using the TreeFam (https:// www.treefam.org /) tool of EMBL-EBI, as shown in FIG. 7, and the results indicated that ASMT major domain of the different species was METHYLTRANSF-2 (shown as red band), while ASMTL also had a unique conserved domain Maf (shown as light green band). Likewise, CDD (https:// www.ncbi.nlm.nih.gov/Structure/CDD. Shtml) analysis of pigs ASMTL and LOC110258194 revealed that the pig ASMTL protein contained a Maf domain (FIG. 8A) and that the corresponding protein of the LOC110258194 gene did not have a Maf domain (FIG. 8B), thus further proving the error in machine annotation of the NCBI database, that is, LOC110258194 should be annotated as ASMT rather than ASMTL, which is located on the X chromosome of pigs, with the coordinates NW_018084901.1 (909502.. 943966) located in the pseudoautosomal region of the X chromosome.
According to the position coordinates, the nucleotide sequence of the ASMT gene of the pig can be determined as shown in SEQ ID NO.1, and the amino acid sequence of the coded protein of the ASMT gene of the pig is determined as shown in SEQ ID NO. 2. The specific gene sequences are shown below:
Nucleotide sequence of pig ASMT gene (SEQ ID NO. 1):
CCAAAGGAGCTTGTGCACCGATCTCTGATTGGCTGGGGGTGGGCTCACGGGGCGGGGTCACAGGGGTTAATTCCATCCATCCTTAGGCTCCTGGAGTCCTGGGGGCTGCGGAGCTCAAGTCATTCAACCAGTAATTCATTTCTCCCACGTGGTGGTGCTTTGAGCGTTTGAAAAACAACTCGGGACCCGGGCATCAGGTTCTGTTATCCGCCTGTTTCAGGGAGGCGCTGCCGCCGACGCCGGGGTAGGGGTGGGACCGGAAGGCCCCTTGGGGTCTTGTAGGTTACCCGTCCCTGCAGCTGGGTCTCTGCAAAGCTTGCAAAGGCTGCTTTGGTTCCTGGGCGAGAGCGGGCGGCAGTTCCCCAGCGTCCCCTGGGCCGCGGGGAGGAGCAGAGGAAGGCGTGGCCCCCGCCCGCCCATCTGCCCTGCTTCGTCCAAGCCCAGGCTCACAGCCGGGGGCGGGGGGCTCCCCCCTGCTCCCCCCCTTCCCTACACCAGCTCAGGGTCTTCCGACCCTTAGAATTCCCACCCCCACGCCCCGCAGCGAGAAGCAGACTTACCTGCTGCAAGGAACAGGCGCCATCCACCACCAACCCCAACTCACCATAACTGAGTGATTCATCTTGGCTCCCTCCTGGGTCTTCAGCAAAGAGCTTCTGGCCGTCCCCCCAGTTCCCGCACACACGGTGATCCCCGAGGCCAGGACCGCTGGGGTCCCCCGAGCTGGGCCAGCCCACAGGGAAAATGGGTTCCCCGCATGATCAGGCCTACCGTCTCCTGAAGGAATATTCCAACGGCTTCATGGTCTCCCAGGTTCTCTTCGCCGCCTGTGAGCTGGGCGTGTTTGACCTTCTGGCCGAGGCCCCGGGGCCCCTAGGCTCGGCCGCAGTGGCCGCACATCTGGGCATCAGCTGCCGGGGGACGGAGCAACTGCTGGATGCCTGTGTGCTCCTGAAGCTGCTTCATGTGGAAATGAGGAGAGGAGAAGCTGTCTACGCCAACACCGAGCTGGCCAGCGCCTACCTGGCCGGGACCAGCCCCACGTCCCAGCAGCACATGCTGCTCTACGTGGCCAGGACCACCTACCTGTGCTGGGCCCACCTGGCCGAGGCCGTGAGGGAAGGGAAGAACCAGTATCTGAAGGCGTTCGGGGTTCCCTCCGAGGAGCTCTTCAGCGCCATCTACAGGTCTGAGGGGGAGCGGCTGCAGTTCCTGCGGGGCCTGGGGGACGTGTGGAGCGTGGAAGGGAGGGGCGTGCTGGCCGCCTTTGACCTGTCACCGTTCCCACTTGTCTGCGACCTCGGAGGCTGTTCAGGGGCTCTGGCCAAGGAGTGCACATCTCTCTACGCTGGATGCCACGTCACCGTGTTTGACATGCCAGATGTGGTCCAGACGGCAAAGAGGCACTTCTCCTTCCCGGAGGACGGACGGATCAGCTTCCGTGAGGGAGATTTCTTTAAAGATCCCCTCCCGGAGGCGGACCTGTACCTGCTGGCCAGGGTCCTGCACGACTGGACGGACGACAAGTGCTCCCGCCTGCTGGCCAGAATCCACGGCGCCTGCAGGACAGGCGGCGGCATCCTGGTCATTGAGAGCCTCCTGGATGCCGATGGGCGGGGCCCCCTGACCACACAGCTCTACTCGCTCAACATGCTCGTGCAGACCGAGGGCCGCGAGCGGACCCCCGCCCAGTACCTCGCGCTCCTGGCCCCCGCCGGCTTCCACGACATCCAGTGCCGCAGAACCGGGGGCACCTACGACGCCATCCTGGCCAGGAAGTGACCCCCAGCGTCATCTGAGACCCCTCACGGACTGCCCTCCAGAGGCCGTGTCTGGCACATTTCCTGGTTTTGTGCCCGGAGAGCGATGCTGAGCTTCTGCTCCCAGATGCCGACCGCCTGTCACCGTGAGGGGTGTCTTGTTTTAGTTTTTGAGTTATTTTCATTTGATTGTGTGTCATTCCAGTCCGATCTATTTTATTTCATTTCATTCCTTGCATGTGATGAAGTGAGGGGTCTGAGAGGAGGTCCCCCTGGATGAGGGGGGCCCTCCCTCCAAGGACA
Amino acid sequence of pig ASMT gene (SEQ ID NO. 2):
MGSPHDQAYRLLKEYSNGFMVSQVLFAACELGVFDLLAEAPGPLGSAAVAAHLGISCRGTEQLLDACVLLKLLHVEMRRGEAVYANTELASAYLAGTSPTSQQHMLLYVARTTYLCWAHLAEAVREGKNQYLKAFGVPSEELFSAIYRSEGERLQFLRGLGDVWSVEGRGVLAAFDLSPFPLVCDLGGCSGALAKECTSLYAGCHVTVFDMPDVVQTAKRHFSFPEDGRISFREGDFFKDPLPEADLYLLARVLHDWTDDKCSRLLARIHGACRTGGGILVIESLLDADGRGPLTTQLYSLNMLVQTEGRERTPAQYLALLAPAGFHDIQCRRTGGTYDAILARK
the experimental thought provided by the invention is not limited to ASMT genes, but is also applicable to other genes. The examples of the present invention are directed to swine subjects, but the methods of locating genes of the present invention are not only applicable to swine but also to other species.
While the invention has been described in detail in the foregoing general description, embodiments and experiments, it will be apparent to those skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
SEQUENCE LISTING
<110> Chinese university of agriculture
<120> A method for localizing animal genes
<130> RYP2111189.3
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 2063
<212> DNA
<213> Sus scrofa
<400> 1
ccaaaggagc ttgtgcaccg atctctgatt ggctgggggt gggctcacgg ggcggggtca 60
caggggttaa ttccatccat ccttaggctc ctggagtcct gggggctgcg gagctcaagt 120
cattcaacca gtaattcatt tctcccacgt ggtggtgctt tgagcgtttg aaaaacaact 180
cgggacccgg gcatcaggtt ctgttatccg cctgtttcag ggaggcgctg ccgccgacgc 240
cggggtaggg gtgggaccgg aaggcccctt ggggtcttgt aggttacccg tccctgcagc 300
tgggtctctg caaagcttgc aaaggctgct ttggttcctg ggcgagagcg ggcggcagtt 360
ccccagcgtc ccctgggccg cggggaggag cagaggaagg cgtggccccc gcccgcccat 420
ctgccctgct tcgtccaagc ccaggctcac agccgggggc ggggggctcc cccctgctcc 480
cccccttccc tacaccagct cagggtcttc cgacccttag aattcccacc cccacgcccc 540
gcagcgagaa gcagacttac ctgctgcaag gaacaggcgc catccaccac caaccccaac 600
tcaccataac tgagtgattc atcttggctc cctcctgggt cttcagcaaa gagcttctgg 660
ccgtcccccc agttcccgca cacacggtga tccccgaggc caggaccgct ggggtccccc 720
gagctgggcc agcccacagg gaaaatgggt tccccgcatg atcaggccta ccgtctcctg 780
aaggaatatt ccaacggctt catggtctcc caggttctct tcgccgcctg tgagctgggc 840
gtgtttgacc ttctggccga ggccccgggg cccctaggct cggccgcagt ggccgcacat 900
ctgggcatca gctgccgggg gacggagcaa ctgctggatg cctgtgtgct cctgaagctg 960
cttcatgtgg aaatgaggag aggagaagct gtctacgcca acaccgagct ggccagcgcc 1020
tacctggccg ggaccagccc cacgtcccag cagcacatgc tgctctacgt ggccaggacc 1080
acctacctgt gctgggccca cctggccgag gccgtgaggg aagggaagaa ccagtatctg 1140
aaggcgttcg gggttccctc cgaggagctc ttcagcgcca tctacaggtc tgagggggag 1200
cggctgcagt tcctgcgggg cctgggggac gtgtggagcg tggaagggag gggcgtgctg 1260
gccgcctttg acctgtcacc gttcccactt gtctgcgacc tcggaggctg ttcaggggct 1320
ctggccaagg agtgcacatc tctctacgct ggatgccacg tcaccgtgtt tgacatgcca 1380
gatgtggtcc agacggcaaa gaggcacttc tccttcccgg aggacggacg gatcagcttc 1440
cgtgagggag atttctttaa agatcccctc ccggaggcgg acctgtacct gctggccagg 1500
gtcctgcacg actggacgga cgacaagtgc tcccgcctgc tggccagaat ccacggcgcc 1560
tgcaggacag gcggcggcat cctggtcatt gagagcctcc tggatgccga tgggcggggc 1620
cccctgacca cacagctcta ctcgctcaac atgctcgtgc agaccgaggg ccgcgagcgg 1680
acccccgccc agtacctcgc gctcctggcc cccgccggct tccacgacat ccagtgccgc 1740
agaaccgggg gcacctacga cgccatcctg gccaggaagt gacccccagc gtcatctgag 1800
acccctcacg gactgccctc cagaggccgt gtctggcaca tttcctggtt ttgtgcccgg 1860
agagcgatgc tgagcttctg ctcccagatg ccgaccgcct gtcaccgtga ggggtgtctt 1920
gttttagttt ttgagttatt ttcatttgat tgtgtgtcat tccagtccga tctattttat 1980
ttcatttcat tccttgcatg tgatgaagtg aggggtctga gaggaggtcc ccctggatga 2040
ggggggccct ccctccaagg aca 2063
<210> 2
<211> 345
<212> PRT
<213> Sus scrofa
<400> 2
Met Gly Ser Pro His Asp Gln Ala Tyr Arg Leu Leu Lys Glu Tyr Ser
1 5 10 15
Asn Gly Phe Met Val Ser Gln Val Leu Phe Ala Ala Cys Glu Leu Gly
20 25 30
Val Phe Asp Leu Leu Ala Glu Ala Pro Gly Pro Leu Gly Ser Ala Ala
35 40 45
Val Ala Ala His Leu Gly Ile Ser Cys Arg Gly Thr Glu Gln Leu Leu
50 55 60
Asp Ala Cys Val Leu Leu Lys Leu Leu His Val Glu Met Arg Arg Gly
65 70 75 80
Glu Ala Val Tyr Ala Asn Thr Glu Leu Ala Ser Ala Tyr Leu Ala Gly
85 90 95
Thr Ser Pro Thr Ser Gln Gln His Met Leu Leu Tyr Val Ala Arg Thr
100 105 110
Thr Tyr Leu Cys Trp Ala His Leu Ala Glu Ala Val Arg Glu Gly Lys
115 120 125
Asn Gln Tyr Leu Lys Ala Phe Gly Val Pro Ser Glu Glu Leu Phe Ser
130 135 140
Ala Ile Tyr Arg Ser Glu Gly Glu Arg Leu Gln Phe Leu Arg Gly Leu
145 150 155 160
Gly Asp Val Trp Ser Val Glu Gly Arg Gly Val Leu Ala Ala Phe Asp
165 170 175
Leu Ser Pro Phe Pro Leu Val Cys Asp Leu Gly Gly Cys Ser Gly Ala
180 185 190
Leu Ala Lys Glu Cys Thr Ser Leu Tyr Ala Gly Cys His Val Thr Val
195 200 205
Phe Asp Met Pro Asp Val Val Gln Thr Ala Lys Arg His Phe Ser Phe
210 215 220
Pro Glu Asp Gly Arg Ile Ser Phe Arg Glu Gly Asp Phe Phe Lys Asp
225 230 235 240
Pro Leu Pro Glu Ala Asp Leu Tyr Leu Leu Ala Arg Val Leu His Asp
245 250 255
Trp Thr Asp Asp Lys Cys Ser Arg Leu Leu Ala Arg Ile His Gly Ala
260 265 270
Cys Arg Thr Gly Gly Gly Ile Leu Val Ile Glu Ser Leu Leu Asp Ala
275 280 285
Asp Gly Arg Gly Pro Leu Thr Thr Gln Leu Tyr Ser Leu Asn Met Leu
290 295 300
Val Gln Thr Glu Gly Arg Glu Arg Thr Pro Ala Gln Tyr Leu Ala Leu
305 310 315 320
Leu Ala Pro Ala Gly Phe His Asp Ile Gln Cys Arg Arg Thr Gly Gly
325 330 335
Thr Tyr Asp Ala Ile Leu Ala Arg Lys
340 345

Claims (9)

1. A method for locating an animal gene, characterized in that an animal to be located has a target gene, and the position of the target gene in the genome of the animal to be located is not disclosed or is not correctly disclosed; the positioning method comprises the following steps:
(1) Selecting animal species whose target gene locus is correctly disclosed, the number of said species being not less than 2;
(2) Locating the position coordinates of the target gene on the chromosomes of the species in the step (1), and identifying genes adjacent to the target gene position and/or genes accompanying the target gene;
(3) Based on the information obtained in the step (2), adopting a comparative genomics method to analyze and obtain the rule information of target gene positioning;
(4) Judging the correct position coordinates of the target gene on the chromosome of the animal to be positioned according to the conservation of the gene and the rule information;
The rule information of target gene localization at least comprises: a regular gene adjacent to the target gene position, its own position coordinates and relative position relation with the target gene, and/or a regular gene accompanying the target gene, its own position coordinates and relative position relation with the target gene;
the regularity gene is the same gene which is contained in the same position in more than 80% of the total number of correctly positioned animal species in the step (1).
2. The method of claim 1, wherein the regularization gene is 100% of the identical genes of the correctly located animal species of step (1) at the same location.
3. The positioning method according to claim 1, characterized in that the positioning method further comprises: and determining the correct nucleotide sequence and/or the amino acid sequence corresponding to the target gene of the animal to be localized according to the correct position coordinates of the target gene on the chromosome of the animal to be localized.
4. A method for locating an animal ASMT gene, wherein the animal to be located has a ASMT gene and the location of the ASMT gene in the genome of the animal to be located is not disclosed or is not properly disclosed; the positioning method comprises the following steps:
(1) Selecting an animal species whose ASMT gene locus is correctly disclosed, the number of said species being not less than 2;
(2) Locating the position coordinates of ASMT genes on the chromosomes of each species described in step (1) and identifying genes adjacent to the ASMT gene position and/or genes that accompany the ASMT gene;
(3) Based on the information obtained in the step (2), adopting a comparative genomics method to analyze and obtain ASMT gene positioning rule information;
(4) Judging the correct position coordinates of ASMT genes on the chromosome of the animal to be positioned according to the conservation of the genes and the rule information;
The ASMT gene localization rule information at least includes:
a regularization gene adjacent to ASMT gene position, its own position coordinates and its relative position relationship with ASMT gene, and/or a regularization gene occurring concomitantly with ASMT gene, its own position coordinates and its relative position relationship with ASMT gene;
the regularity gene is the same gene which is contained in the same position in more than 80% of the total number of correctly positioned animal species in the step (1).
5. The method of claim 4, wherein said regulatable genes are the same genes in the same location in 100% of the total number of animal species correctly located in step (1).
6. The localization method of claim 4, wherein the regularity gene comprises AKAP17A gene and/or ASMTL gene.
7. The positioning method of claim 4, wherein the positioning method further comprises: and determining the nucleotide sequence and/or the amino acid sequence corresponding to the ASMT gene of the animal to be localized according to the correct position coordinates of the ASMT gene on the chromosome of the animal to be localized.
8. The method of claim 4, wherein the animal to be localized is a pig.
9. Use of the method for localizing a gene of an animal ASMT according to any one of claims 4 to 8 for studying melatonin biosynthesis in animals.
CN202110575589.8A 2021-05-26 2021-05-26 Animal gene positioning method Active CN113421611B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110575589.8A CN113421611B (en) 2021-05-26 2021-05-26 Animal gene positioning method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110575589.8A CN113421611B (en) 2021-05-26 2021-05-26 Animal gene positioning method

Publications (2)

Publication Number Publication Date
CN113421611A CN113421611A (en) 2021-09-21
CN113421611B true CN113421611B (en) 2024-04-19

Family

ID=77713010

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110575589.8A Active CN113421611B (en) 2021-05-26 2021-05-26 Animal gene positioning method

Country Status (1)

Country Link
CN (1) CN113421611B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006101623A2 (en) * 2005-03-23 2006-09-28 Iowa State University Research Foundation, Inc. Cstf1 and c20orf43 markers for meat quality and growth rate in animals

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050066276A1 (en) * 2002-12-13 2005-03-24 Moore Helen M. Methods for identifying, viewing, and analyzing syntenic and orthologous genomic regions between two or more species
KR20060021863A (en) * 2003-05-23 2006-03-08 아이오와 스테이트 유니버시티 리서치 파운데이션, 인코퍼레이티드 Fine mapping of chromosome 17 quantitative trait loci and use of same for marker assisted selection
US11214800B2 (en) * 2015-08-18 2022-01-04 The Broad Institute, Inc. Methods and compositions for altering function and structure of chromatin loops and/or domains

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006101623A2 (en) * 2005-03-23 2006-09-28 Iowa State University Research Foundation, Inc. Cstf1 and c20orf43 markers for meat quality and growth rate in animals

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
Cellular localization and kinetics of the rice melatonin biosynthetic enzymes SNAT and ASMT;Yeong B , Yool H L , Kyungjin L , et al;;Journal of pineal research;20140128(第56期);全文 *
HETEROLOGOUS COMPARATIVE GENOMICS TO IDENTIFY CANDIDATE GENES IMPACTING FRUIT QUALITY IN APPLE (MALUS X DOMESTICA BORKH.);Costa F.;Costa G.;Sansavini S.;Soglio V，et al；;Acta Horticulturae;20090301(814);全文 *
Yeong B ,Yool H L ,Kyungjin L , et al *
原发性高血压相关单核苷酸多态性的研究综述;刘潇;叶余丰;;中国医疗前沿;20100123;第05卷(第02期);全文 *
比较基因组学及其应用;宋雪梅;李宏滨;杜立新;;生命的化学;20061015(第05期);全文 *
猪基因分离方法的研究进展;马海明;施启顺;柳小春;;国外畜牧学(猪与禽);20060925(第05期);全文 *
鸡DLK1基因的生物信息学分析;闫晓红;王宁;;东北农业大学学报;20110625;第42卷(第06期);全文 *

Also Published As

Publication number Publication date
CN113421611A (en) 2021-09-21

Similar Documents

Publication Publication Date Title
Bellinge et al. Myostatin and its implications on animal breeding: a review
Wang et al. Hypothalamic and pituitary transcriptome profiling using RNA-sequencing in high-yielding and low-yielding laying hens
Ahlawat et al. Current status of molecular genetics research of goat fecundity
Chang et al. A genome‐wide association study suggests several novel candidate genes for carcass traits in Chinese Simmental beef cattle
Große-Brinkhaus et al. Genome-wide association analyses for boar taint components and testicular traits revealed regions having pleiotropic effects
Hao et al. Genome-wide association study identifies candidate genes for piglet splay leg syndrome in different populations
Weikard et al. Tissue-specific mRNA expression patterns reveal a coordinated metabolic response associated with genetic selection for milk production in cows
Gurgul et al. Identification of genome‐wide selection signatures in the L imousin beef cattle breed
Liu et al. Effect of in ovo folic acid injection on hepatic IGF2 expression and embryo growth of broilers
Pasandideh et al. A genome‐wide association study revealed five SNPs affecting 8‐month weight in sheep
Ladeira et al. CNV detection and their association with growth, efficiency and carcass traits in Santa Inês sheep
Bordbar et al. Identification and validation of a novel candidate gene regulating net meat weight in Simmental beef cattle based on imputed next‐generation sequencing
Talebi et al. Genetic basis of muscle‐related traits in sheep: A review
Getaneh et al. Candidate genes associated with economically important traits in dairy goats
Guo et al. Positive selection signatures in Anqing six‐end‐white pig population based on reduced‐representation genome sequencing data
Gao et al. Genome-wide association study of egg-laying traits and egg quality in LingKun chickens
CN113421611B (en) Animal gene positioning method
Xiong et al. Whole-genome resequencing reveals genetic diversity and selection characteristics of dairy goat
Wang et al. Goat SNX29: mRNA expression, InDel and CNV detection, and their associations with litter size
Huang et al. Cloning and expression analysis of hif-1α and downstream genes during hypoxic stress in cobia (Rachycentron canadum)
Zhang et al. Comparative transcriptomics identifies genes differentially expressed in the intestine of a new fast-growing strain of common carp with higher unsaturated fatty acid content in muscle
Cui et al. Detection of coding sequence, mRNA expression and three insertions/deletions (indels) of KDM6A gene in male pig
Wijayanti et al. Genetic polymorphisms within the ETAA1 gene associated with growth traits in Chinese sheep breeds
Fan et al. Identification of genetic markers associated with fatness and leg weakness traits in the pig
Zhang et al. Identification of candidate genomic regions for thermogelled egg yolk traits based on a genome-wide association study

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant