CN113421611A - Animal gene positioning method - Google Patents

Animal gene positioning method Download PDF

Info

Publication number
CN113421611A
CN113421611A CN202110575589.8A CN202110575589A CN113421611A CN 113421611 A CN113421611 A CN 113421611A CN 202110575589 A CN202110575589 A CN 202110575589A CN 113421611 A CN113421611 A CN 113421611A
Authority
CN
China
Prior art keywords
gene
asmt
genes
regular
animal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110575589.8A
Other languages
Chinese (zh)
Other versions
CN113421611B (en
Inventor
刘国世
李广栋
王静
王立凯
关盛宇
阎来庆
吕东颖
张鲁
姬鹏云
马文奎
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN202110575589.8A priority Critical patent/CN113421611B/en
Publication of CN113421611A publication Critical patent/CN113421611A/en
Application granted granted Critical
Publication of CN113421611B publication Critical patent/CN113421611B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6818—Sequencing of polypeptides
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B50/00—ICT programming tools or database systems specially adapted for bioinformatics

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Immunology (AREA)
  • Medical Informatics (AREA)
  • Organic Chemistry (AREA)
  • Theoretical Computer Science (AREA)
  • Evolutionary Biology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Bioethics (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Databases & Information Systems (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for positioning animal genes, in particular to a method for positioning animal ASMT genes. The animal gene positioning method provided by the invention provides a valuable reference basis for the research of other unknown genes, and initiatively positions the pig ASMT gene, thereby providing a new reference for the research of the pig melatonin biosynthesis pathway.

Description

Animal gene positioning method
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a method for positioning animal genes.
Background
Melatonin (Melatonin, MT, N-acetyl-5-methoxytryptamine) is also called "brain platinum", and is an important indole-like active small molecule substance synthesized and secreted by organs such as pineal bodies, ovaries and the like of mammals, and widely distributed in a plurality of tissues of animals. Melatonin is a very important endocrine hormone whose synthesis is inhibited by light and exhibits rhythmic oscillations of low day and high night, and is therefore also called "dark hormone". Melatonin has a variety of physiological and pharmacological functions, such as: improving sleep, regulating biological rhythm, relieving stress, regulating immune system, enhancing immunity, resisting tumor, and resisting aging. Melatonin and metabolites thereof are important broad-spectrum antioxidants, can remove oxygen Radical (ROS) in and out of an animal body, high-activity nitrogen Radical (RNS) and the like, and can activate the expression of intracellular antioxidant enzyme genes to further play an antioxidant function. In addition, melatonin can protect the stability of cellular DNA, reduce lipid damage, maintain mitochondrial function, promote expression of anti-apoptotic genes, and the like. Melatonin is also a key reproductive hormone, directly or indirectly regulates the secretion of the reproductive hormone, follicular development, embryonic development, implantation and the like in animal reproduction activities, and also participates in the regulation of the oestrus cycle of seasonal oestrous animals.
China is the country with the largest stock of live pigs in the world, the healthy development of the pig raising industry and the stable supply of pork are closely related to the national civilian life, and the continuous development of experimental model pigs greatly promotes the research progress of biomedicine and medicines in China. However, the productive performance of the sows in China is still not small compared with that of developed countries. The low breeding efficiency of the sows is one of the key factors for restricting the healthy and rapid development of the pig industry in China. The melatonin is widely applied to the improvement of the production performance of pigs, and can improve the reproductive performance, resist heat stress, relieve piglet diarrhea, improve intestinal microorganisms, enhance immunity, relieve gamete and embryo freezing injury and the like. Studies have shown that many tissues and organs of pigs are capable of secreting melatonin, but the synthetic pathway has not been understood to date.
In mammals, the primary source of melatonin synthesis is L-trpophan (tryptophan). L-tryptophan undergoes a hydroxylation reaction catalyzed by TPH (tryptophane hydroxylase) to generate 5-Hydroxytryptophan (5-Hydroxytryptophan, 5-HTP), and then undergoes an AAAD (L-aromatic amino acid decarboxylase) decarboxylation reaction to be changed into 5-Hydroxytryptamine (5-Hydroxytryptamine, 5-HT), also called Serotonin (Serotonin). The 5-hydroxytryptamine generates N-Acetyl-5-hydroxytryptamine (NAS) under the action of AANAT (Arylalkylamine-N-acetylamine, Arylalkylamine N-Acetyltransferase). Finally, methylation is carried out under the catalytic action of ASMT (acetyl serotonin O-methyltransferase, acetyl-5-hydroxytryptamine-oxygen-methyltransferase) so as to generate the final melatonin. In other animals (such as mice, rats, rhesus monkeys, cows, sheep, goats, chickens, ducks, fish, etc.), the synthetase genes in the melatonin synthesis process have been successfully identified and cloned. The mouse ASMT gene is located in the Pseudoautosomal region of the X chromosome (PAR), which has a high recombination and mutation rate, and thus, the mouse ASMT gene was not successfully localized and cloned until 2010.
For pigs with important edible and medical values, the inventor finds that the NCBI database does not contain the pig ASMT gene, supposes that the pig ASMT gene is possibly similar to mouse ASMT, and the high mutation rate of a complex region possibly causes the pig ASMT gene to be successfully mined so far, which is also the main reason for the relevant research on the pig melatonin biosynthesis pathway to be stopped.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a method for positioning unknown or information-disordered genes by using a bioinformatics method.
The specific technical scheme is as follows:
in a first aspect, the invention provides a method for mapping an animal gene. The animal to be localized has a gene of interest, and the location of the gene of interest in the genome of the animal to be localized is not disclosed or not correctly disclosed.
The method for positioning the animal gene comprises the following steps:
(1) selecting animal species with the target gene position correctly disclosed, wherein the number of the species is not less than 2;
(2) locating the position coordinates of the target gene on the chromosome of each species in the step (1), and identifying the genes adjacent to the position of the target gene and/or the genes associated with the target gene;
(3) analyzing and obtaining the regular information of target gene positioning by adopting a comparative genomics method on the basis of the information obtained in the step (2);
(4) and judging the correct position coordinates of the target gene on the chromosome of the animal to be positioned according to the conservation of the gene and the rule information.
In the method provided by the invention, the disclosed or (not) correctly disclosed means that the disclosed or (not) correctly disclosed method is disclosed in databases commonly used in the field, such as NCBI and Ensemble databases.
In the method provided by the invention, the number of animal species with the target gene position correctly disclosed is at least 2, and more species number is helpful for obtaining more accurate rule information. Preferably, the species of the animal is of a type similar to the biological classification of the animal to be located.
In some embodiments of the present invention, the regular information of target gene localization at least comprises: the gene expression vector comprises regular genes adjacent to the target gene, position coordinates of the regular genes and relative position relations of the regular genes and the target gene, and/or regular genes which are associated with the target gene, position coordinates of the regular genes and relative position relations of the regular genes and the target gene. The regular genes refer to the same genes which account for more than 80% of the total number, preferably 100%, of the correctly located animal species in step (1) and are present at the same position. On the basis of knowing the regular gene and the position coordinate of the regular gene, the position coordinate of the target gene can be judged according to the relative position relation between the regular gene and the target gene.
The method of the present invention may further comprise: and determining the correct nucleotide sequence and/or amino acid sequence corresponding to the target gene of the animal to be positioned according to the correct position coordinates of the target gene on the chromosome of the animal to be positioned.
The method of the present invention may further comprise: and (3) verifying whether the target gene is correctly positioned according to the properties (such as protein structure) and/or functions of the target protein.
In a second aspect, the present invention provides a method for mapping an animal ASMT (acetyl serotonin O-methyl transferase) gene. The animal to be localized has an ASMT gene and the position of the ASMT gene in the genome of the animal to be localized is not disclosed or not disclosed correctly.
The method for positioning the animal ASMT gene comprises the following steps:
(1) selecting animal species with the ASMT gene position correctly disclosed, wherein the number of the species is not less than 2;
(2) locating the position coordinates of the ASMT gene on the chromosome of each species described in step (1), and identifying the gene adjacent to the ASMT gene position and/or the gene associated with the ASMT gene;
(3) analyzing and obtaining rule information of ASMT gene positioning by adopting a comparative genomics method on the basis of the information obtained in the step (2);
(4) and judging the correct position coordinate of the ASMT gene on the chromosome of the animal to be positioned according to the conservation of the gene and the rule information.
In the method provided by the invention, the disclosed or (not) correctly disclosed means that the disclosed or (not) correctly disclosed method is disclosed in databases commonly used in the field, such as NCBI and Ensemble databases.
In the method provided by the invention, the number of animal species with the ASMT gene position correctly disclosed is at least 2, and more species number is helpful for obtaining more accurate rule information. Preferably, the species of the animal is of a type similar to the biological classification of the animal to be located.
In some embodiments of the invention, the information on the rule of ASMT gene localization comprises at least: the gene expression vector comprises a regular gene adjacent to the ASMT gene, position coordinates of the regular gene and the relative position relationship between the regular gene and the ASMT gene, and/or a regular gene which is associated with the ASMT gene, position coordinates of the regular gene and the relative position relationship between the regular gene and the ASMT gene. The regular genes refer to the same genes which account for more than 80% of the total number, preferably 100%, of the correctly located animal species in step (1) and are present at the same position. On the basis of knowing the regular gene and the position coordinate of the regular gene, the position coordinate of the ASMT gene can be judged according to the relative position relation between the regular gene and the ASMT gene.
In some embodiments of the invention, the regularity genes include the AKAP17A gene and/or ASMTL gene.
The method of the present invention may further comprise: and determining the nucleotide sequence and/or amino acid sequence corresponding to the ASMT gene of the animal to be positioned according to the correct position coordinates of the ASMT gene on the chromosome of the animal to be positioned.
The method of the present invention may further comprise: based on the nature (such as protein structure) and/or function of ASMT protein, the correct positioning of ASMT gene is verified.
As a specific embodiment of the present invention, the animal to be localized is a pig.
The method provided by the invention can correctly position the ASMT gene of the pig, so that the nucleotide sequence of the ASMT gene of the pig is determined to be shown in SEQ ID NO.1, and the amino acid sequence of the ASMT gene coding protein of the pig is determined to be shown in SEQ ID NO. 2.
In a third aspect, the invention provides the use of the localization method of the second aspect in studying melatonin biosynthesis in animals.
Compared with the prior art, the gene localization method provided by the invention provides a valuable reference basis for the research of other unknown genes. And as the biosynthesis pathway of the porcine melatonin is not broken so far, and the ASMT gene of the last step of the porcine melatonin is not found so far, the method provided by the invention initiatively positions the porcine ASMT gene, can provide a new reference for the research of the biosynthesis pathway of the porcine melatonin, and has important scientific significance for the research of the biological rhythm, the biological reproduction and the neuroendocrine of the porcine melatonin.
Drawings
FIG. 1 shows the results of a search of different forms of the pig ASMT gene in NCBI;
FIG. 2 shows the pig ASMT gene-related literature search and primer sequence alignment;
FIG. 3 is a longitudinal comparison of ASMT gene coordinates and arrangement rules on chromosomes of different species;
FIG. 4 is a comparison of the coordinates of ASMT and ASMTL genes of different species and their arrangement on chromosomes in a horizontal and vertical manner;
FIG. 5 shows pig ASMT gene localization;
FIG. 6 shows NCBI LOC110258194, Ensemble ENSSSCG00000032659 and UCSC search results;
FIG. 7 is a gene evolutionary tree and protein domain analysis of different species ASMT and ASMTL;
FIG. 8 is a pig ASMTL and LOC110258194 CDD analysis.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Example 1: existing information retrieval
NCBI database without pig ASMT
First, the pig ASMT gene was retrieved in NCBI, as shown in FIG. 1A, showing No items found; then, another name HIOMT of ASMT is retrieved, as shown in FIG. 1B, and the result is not retrieved as well; finally, the full name of the ASMT gene was searched for acetylserotonin O-methyl transferase, and as a result, the ASMTL (acetylserotonin O-methyl transferase-like) gene appeared (FIG. 1C).
A rare study of pig ASMT gene in Google scholar
In the Google scanner search for Research on pig ASMT gene, only one Bae H, Yang C, Lee J Y, et al, clinical animal-related interaction vision adjustment of SIRT1 reducing early prediction [ J ]. Journal of Pineal Research,2020,69(2): e12670 (FIG. 2A) was searched. Primer-BLAST was performed based on the Primer sequence of the pig ASMT gene (fig. 2B) provided in the literature, and the result is shown in fig. 2C, and the aligned gene is ASMTL, indicating that the authors of the article identified pig ASMTL as ASMT gene.
Example 2: localization of pig ASMT genes
1. The AKAP17A genes of different species are often accompanied with ASMT genes and arranged in the same direction
The ASMT genes of different species are longitudinally compared with each other in terms of arrangement rules on chromosomes, and the NCBI database Genome DataViewer is used to retrieve ASMT genes of different species such as human (Homo sapiens), sheep (Ovis aries), horse (Equus caballus), cow (Bos taurus), buffalo (Bubalus bubalis), giant panda (Ailuropoda melanoleuca), mouse (Mus musculus), dog (Candida albicans), domestic cat (Felis catus), whale (Balaopenpteramusculus), chicken (Gallus Gallus), zebra fish (Danio rerio) and the like, and the positions of the ASMT genes on the chromosomes and the adjacent genes are analyzed and compared. As shown in FIG. 3, it was found that human, sheep, horse, cow, buffalo, panda, mouse, dog, cat, blue whale and other mammalian ASMT genes are located on the X sex chromosome. Moreover, it is regular that the AKAP17A gene of mammals, chickens, zebrafish, etc. is accompanied by ASMT gene and both genes are arranged in the same direction.
2. The ASMT and ASMTL genes of different species are located on the same chromosome and are arranged in a reverse direction
And longitudinally comparing the arrangement rules of ASMTL genes of different species on the chromosome, and transversely comparing the arrangement rules of the ASMT and ASMTL genes of different species on the chromosome. We found that human ASMT and ASMTL genes are on the same chromosome and adjacent. Therefore, we further compare the arrangement rule of ASMTL genes of different species on the chromosome, and also compare the arrangement rule of ASMT and ASMTL genes of different species. As shown in FIG. 4, it was found that the P2RY8 gene of different species is associated with ASMTL gene and the two genes are arranged in the same direction, and more importantly, it was found that ASMT and ASMTL genes of different species are on the same chromosome, and are close in position and arranged in the opposite direction.
3. Pig ASMT gene is located in X chromosome PAR region
Based on the above-identified law of reverse arrangement of ASMT and ASMTL genes in different species, we speculate that swine should follow this law as well. Then, we searched the pig ASMTL gene with NCBI Graphical Sequence Viewer, as shown in FIG. 5, according to the rule that the AKAP17A gene (indicated by purple arrow in the figure) is often accompanied by ASMTL gene and the P2RY8 gene (indicated by blue arrow in the figure) is often accompanied by ASMTL gene (outlined by orange square), the result found that there is a gene called LOC110258194 (outlined by red square) beside AKAP17A gene on pig X chromosome, and the position arrangement rule completely conforms to ASMTL gene of other species, and there is a gene ENSSSSS 00000032659 (outlined by black square) at the same position CG in the Ensemble database, and the two exons are completely overlapped (the red vertical line in the figure indicates the position of the exon). Next we shall demonstrate NCBI LOC110258194 and Ensemble ENSSSCCG 00000032659 as pig ASMT genes.
We searched pig LOC110258194 in NCBI database and found that its Gene description is ASMT but ASMTL (FIG. 6A), and the Gene name of ENSSSCG00000032659 searched in Ensemble database is ASMT but its Gene description is ASMTL (FIG. 6B). Since the pig ASMTL gene is already an independently annotated gene (fig. 6C), it is clear that both NCBI and Ensemble databases wrongly annotated pig ASMTL as ASMTL. We further confirmed that ASMT genes were present at the same position in the genomes of different species using UCSC Genome Browser (FIG. 6D).
To further confirm that NCBI and Ensemble databases wrongly annotated porcine ASMT as ASMTL, we distinguished both genes from the protein domain. The TreeFam (https:// www.treefam.org /) tool of EMBL-EBI was used to map gene evolutionary trees and protein domains of ASMT and ASMTL in 42 different species, as shown in fig. 7, which indicated that the major ASMT domain of different species is methytransf _2 (indicated by red bands), while ASMTL has a unique conserved domain Maf (indicated by light green bands). Similarly, CDD (https:// www.ncbi.nlm.nih.gov/Structure/CDD. shtml) analysis of pig ASMTL and LOC110258194 revealed that the pig ASMTL protein contained the Maf domain (FIG. 8A) and the LOC110258194 gene corresponded protein did not have the Maf domain (FIG. 8B), thus further demonstrating the error of NCBI database machine annotation, namely LOC110258194 should be annotated as ASMT rather than ASMTL, which is located on pig X chromosome with coordinates NW _018084901.1(909502..943966) located in the pseudoautosomal region of X chromosome.
According to the position coordinates, the nucleotide sequence of the pig ASMT gene is shown as SEQ ID NO.1, and the amino acid sequence of the pig ASMT gene coding protein is shown as SEQ ID NO. 2. The specific gene sequences are shown below:
nucleotide sequence of pig ASMT gene (SEQ ID NO. 1):
CCAAAGGAGCTTGTGCACCGATCTCTGATTGGCTGGGGGTGGGCTCACGGGGCGGGGTCACAGGGGTTAATTCCATCCATCCTTAGGCTCCTGGAGTCCTGGGGGCTGCGGAGCTCAAGTCATTCAACCAGTAATTCATTTCTCCCACGTGGTGGTGCTTTGAGCGTTTGAAAAACAACTCGGGACCCGGGCATCAGGTTCTGTTATCCGCCTGTTTCAGGGAGGCGCTGCCGCCGACGCCGGGGTAGGGGTGGGACCGGAAGGCCCCTTGGGGTCTTGTAGGTTACCCGTCCCTGCAGCTGGGTCTCTGCAAAGCTTGCAAAGGCTGCTTTGGTTCCTGGGCGAGAGCGGGCGGCAGTTCCCCAGCGTCCCCTGGGCCGCGGGGAGGAGCAGAGGAAGGCGTGGCCCCCGCCCGCCCATCTGCCCTGCTTCGTCCAAGCCCAGGCTCACAGCCGGGGGCGGGGGGCTCCCCCCTGCTCCCCCCCTTCCCTACACCAGCTCAGGGTCTTCCGACCCTTAGAATTCCCACCCCCACGCCCCGCAGCGAGAAGCAGACTTACCTGCTGCAAGGAACAGGCGCCATCCACCACCAACCCCAACTCACCATAACTGAGTGATTCATCTTGGCTCCCTCCTGGGTCTTCAGCAAAGAGCTTCTGGCCGTCCCCCCAGTTCCCGCACACACGGTGATCCCCGAGGCCAGGACCGCTGGGGTCCCCCGAGCTGGGCCAGCCCACAGGGAAAATGGGTTCCCCGCATGATCAGGCCTACCGTCTCCTGAAGGAATATTCCAACGGCTTCATGGTCTCCCAGGTTCTCTTCGCCGCCTGTGAGCTGGGCGTGTTTGACCTTCTGGCCGAGGCCCCGGGGCCCCTAGGCTCGGCCGCAGTGGCCGCACATCTGGGCATCAGCTGCCGGGGGACGGAGCAACTGCTGGATGCCTGTGTGCTCCTGAAGCTGCTTCATGTGGAAATGAGGAGAGGAGAAGCTGTCTACGCCAACACCGAGCTGGCCAGCGCCTACCTGGCCGGGACCAGCCCCACGTCCCAGCAGCACATGCTGCTCTACGTGGCCAGGACCACCTACCTGTGCTGGGCCCACCTGGCCGAGGCCGTGAGGGAAGGGAAGAACCAGTATCTGAAGGCGTTCGGGGTTCCCTCCGAGGAGCTCTTCAGCGCCATCTACAGGTCTGAGGGGGAGCGGCTGCAGTTCCTGCGGGGCCTGGGGGACGTGTGGAGCGTGGAAGGGAGGGGCGTGCTGGCCGCCTTTGACCTGTCACCGTTCCCACTTGTCTGCGACCTCGGAGGCTGTTCAGGGGCTCTGGCCAAGGAGTGCACATCTCTCTACGCTGGATGCCACGTCACCGTGTTTGACATGCCAGATGTGGTCCAGACGGCAAAGAGGCACTTCTCCTTCCCGGAGGACGGACGGATCAGCTTCCGTGAGGGAGATTTCTTTAAAGATCCCCTCCCGGAGGCGGACCTGTACCTGCTGGCCAGGGTCCTGCACGACTGGACGGACGACAAGTGCTCCCGCCTGCTGGCCAGAATCCACGGCGCCTGCAGGACAGGCGGCGGCATCCTGGTCATTGAGAGCCTCCTGGATGCCGATGGGCGGGGCCCCCTGACCACACAGCTCTACTCGCTCAACATGCTCGTGCAGACCGAGGGCCGCGAGCGGACCCCCGCCCAGTACCTCGCGCTCCTGGCCCCCGCCGGCTTCCACGACATCCAGTGCCGCAGAACCGGGGGCACCTACGACGCCATCCTGGCCAGGAAGTGACCCCCAGCGTCATCTGAGACCCCTCACGGACTGCCCTCCAGAGGCCGTGTCTGGCACATTTCCTGGTTTTGTGCCCGGAGAGCGATGCTGAGCTTCTGCTCCCAGATGCCGACCGCCTGTCACCGTGAGGGGTGTCTTGTTTTAGTTTTTGAGTTATTTTCATTTGATTGTGTGTCATTCCAGTCCGATCTATTTTATTTCATTTCATTCCTTGCATGTGATGAAGTGAGGGGTCTGAGAGGAGGTCCCCCTGGATGAGGGGGGCCCTCCCTCCAAGGACA
amino acid sequence of pig ASMT gene (SEQ ID NO. 2):
MGSPHDQAYRLLKEYSNGFMVSQVLFAACELGVFDLLAEAPGPLGSAAVAAHLGISCRGTEQLLDACVLLKLLHVEMRRGEAVYANTELASAYLAGTSPTSQQHMLLYVARTTYLCWAHLAEAVREGKNQYLKAFGVPSEELFSAIYRSEGERLQFLRGLGDVWSVEGRGVLAAFDLSPFPLVCDLGGCSGALAKECTSLYAGCHVTVFDMPDVVQTAKRHFSFPEDGRISFREGDFFKDPLPEADLYLLARVLHDWTDDKCSRLLARIHGACRTGGGILVIESLLDADGRGPLTTQLYSLNMLVQTEGRERTPAQYLALLAPAGFHDIQCRRTGGTYDAILARK
the experimental idea provided by the invention is not limited to the ASMT gene, but also applicable to other genes. The examples of the present invention refer to porcine subjects, but the method of the present invention for mapping genes is applicable not only to pigs but also to other species.
Although the invention has been described in detail hereinabove by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that many modifications and improvements can be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
SEQUENCE LISTING
<110> university of agriculture in China
<120> a method for locating animal gene
<130> RYP2111189.3
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 2063
<212> DNA
<213> Sus scrofa
<400> 1
ccaaaggagc ttgtgcaccg atctctgatt ggctgggggt gggctcacgg ggcggggtca 60
caggggttaa ttccatccat ccttaggctc ctggagtcct gggggctgcg gagctcaagt 120
cattcaacca gtaattcatt tctcccacgt ggtggtgctt tgagcgtttg aaaaacaact 180
cgggacccgg gcatcaggtt ctgttatccg cctgtttcag ggaggcgctg ccgccgacgc 240
cggggtaggg gtgggaccgg aaggcccctt ggggtcttgt aggttacccg tccctgcagc 300
tgggtctctg caaagcttgc aaaggctgct ttggttcctg ggcgagagcg ggcggcagtt 360
ccccagcgtc ccctgggccg cggggaggag cagaggaagg cgtggccccc gcccgcccat 420
ctgccctgct tcgtccaagc ccaggctcac agccgggggc ggggggctcc cccctgctcc 480
cccccttccc tacaccagct cagggtcttc cgacccttag aattcccacc cccacgcccc 540
gcagcgagaa gcagacttac ctgctgcaag gaacaggcgc catccaccac caaccccaac 600
tcaccataac tgagtgattc atcttggctc cctcctgggt cttcagcaaa gagcttctgg 660
ccgtcccccc agttcccgca cacacggtga tccccgaggc caggaccgct ggggtccccc 720
gagctgggcc agcccacagg gaaaatgggt tccccgcatg atcaggccta ccgtctcctg 780
aaggaatatt ccaacggctt catggtctcc caggttctct tcgccgcctg tgagctgggc 840
gtgtttgacc ttctggccga ggccccgggg cccctaggct cggccgcagt ggccgcacat 900
ctgggcatca gctgccgggg gacggagcaa ctgctggatg cctgtgtgct cctgaagctg 960
cttcatgtgg aaatgaggag aggagaagct gtctacgcca acaccgagct ggccagcgcc 1020
tacctggccg ggaccagccc cacgtcccag cagcacatgc tgctctacgt ggccaggacc 1080
acctacctgt gctgggccca cctggccgag gccgtgaggg aagggaagaa ccagtatctg 1140
aaggcgttcg gggttccctc cgaggagctc ttcagcgcca tctacaggtc tgagggggag 1200
cggctgcagt tcctgcgggg cctgggggac gtgtggagcg tggaagggag gggcgtgctg 1260
gccgcctttg acctgtcacc gttcccactt gtctgcgacc tcggaggctg ttcaggggct 1320
ctggccaagg agtgcacatc tctctacgct ggatgccacg tcaccgtgtt tgacatgcca 1380
gatgtggtcc agacggcaaa gaggcacttc tccttcccgg aggacggacg gatcagcttc 1440
cgtgagggag atttctttaa agatcccctc ccggaggcgg acctgtacct gctggccagg 1500
gtcctgcacg actggacgga cgacaagtgc tcccgcctgc tggccagaat ccacggcgcc 1560
tgcaggacag gcggcggcat cctggtcatt gagagcctcc tggatgccga tgggcggggc 1620
cccctgacca cacagctcta ctcgctcaac atgctcgtgc agaccgaggg ccgcgagcgg 1680
acccccgccc agtacctcgc gctcctggcc cccgccggct tccacgacat ccagtgccgc 1740
agaaccgggg gcacctacga cgccatcctg gccaggaagt gacccccagc gtcatctgag 1800
acccctcacg gactgccctc cagaggccgt gtctggcaca tttcctggtt ttgtgcccgg 1860
agagcgatgc tgagcttctg ctcccagatg ccgaccgcct gtcaccgtga ggggtgtctt 1920
gttttagttt ttgagttatt ttcatttgat tgtgtgtcat tccagtccga tctattttat 1980
ttcatttcat tccttgcatg tgatgaagtg aggggtctga gaggaggtcc ccctggatga 2040
ggggggccct ccctccaagg aca 2063
<210> 2
<211> 345
<212> PRT
<213> Sus scrofa
<400> 2
Met Gly Ser Pro His Asp Gln Ala Tyr Arg Leu Leu Lys Glu Tyr Ser
1 5 10 15
Asn Gly Phe Met Val Ser Gln Val Leu Phe Ala Ala Cys Glu Leu Gly
20 25 30
Val Phe Asp Leu Leu Ala Glu Ala Pro Gly Pro Leu Gly Ser Ala Ala
35 40 45
Val Ala Ala His Leu Gly Ile Ser Cys Arg Gly Thr Glu Gln Leu Leu
50 55 60
Asp Ala Cys Val Leu Leu Lys Leu Leu His Val Glu Met Arg Arg Gly
65 70 75 80
Glu Ala Val Tyr Ala Asn Thr Glu Leu Ala Ser Ala Tyr Leu Ala Gly
85 90 95
Thr Ser Pro Thr Ser Gln Gln His Met Leu Leu Tyr Val Ala Arg Thr
100 105 110
Thr Tyr Leu Cys Trp Ala His Leu Ala Glu Ala Val Arg Glu Gly Lys
115 120 125
Asn Gln Tyr Leu Lys Ala Phe Gly Val Pro Ser Glu Glu Leu Phe Ser
130 135 140
Ala Ile Tyr Arg Ser Glu Gly Glu Arg Leu Gln Phe Leu Arg Gly Leu
145 150 155 160
Gly Asp Val Trp Ser Val Glu Gly Arg Gly Val Leu Ala Ala Phe Asp
165 170 175
Leu Ser Pro Phe Pro Leu Val Cys Asp Leu Gly Gly Cys Ser Gly Ala
180 185 190
Leu Ala Lys Glu Cys Thr Ser Leu Tyr Ala Gly Cys His Val Thr Val
195 200 205
Phe Asp Met Pro Asp Val Val Gln Thr Ala Lys Arg His Phe Ser Phe
210 215 220
Pro Glu Asp Gly Arg Ile Ser Phe Arg Glu Gly Asp Phe Phe Lys Asp
225 230 235 240
Pro Leu Pro Glu Ala Asp Leu Tyr Leu Leu Ala Arg Val Leu His Asp
245 250 255
Trp Thr Asp Asp Lys Cys Ser Arg Leu Leu Ala Arg Ile His Gly Ala
260 265 270
Cys Arg Thr Gly Gly Gly Ile Leu Val Ile Glu Ser Leu Leu Asp Ala
275 280 285
Asp Gly Arg Gly Pro Leu Thr Thr Gln Leu Tyr Ser Leu Asn Met Leu
290 295 300
Val Gln Thr Glu Gly Arg Glu Arg Thr Pro Ala Gln Tyr Leu Ala Leu
305 310 315 320
Leu Ala Pro Ala Gly Phe His Asp Ile Gln Cys Arg Arg Thr Gly Gly
325 330 335
Thr Tyr Asp Ala Ile Leu Ala Arg Lys
340 345

Claims (10)

1. A method for locating an animal gene, characterized in that an animal to be located has a target gene, and the position of the target gene in the genome of the animal to be located is not disclosed or not correctly disclosed; the positioning method comprises the following steps:
(1) selecting animal species with the target gene position correctly disclosed, wherein the number of the species is not less than 2;
(2) locating the position coordinates of the target gene on the chromosome of each species in the step (1), and identifying the genes adjacent to the position of the target gene and/or the genes associated with the target gene;
(3) analyzing and obtaining the regular information of target gene positioning by adopting a comparative genomics method on the basis of the information obtained in the step (2);
(4) and judging the correct position coordinates of the target gene on the chromosome of the animal to be positioned according to the conservation of the gene and the rule information.
2. The method according to claim 1, wherein the information on the regularity of the target gene mapping at least comprises: the regular gene adjacent to the target gene, the position coordinate of the regular gene and the relative position relation between the regular gene and the target gene, and/or the regular gene which is associated with the target gene, the position coordinate of the regular gene and the relative position relation between the regular gene and the target gene;
the regular genes refer to the same genes which account for more than 80% of the total number of the correctly positioned animal species in the step (1) and are in the same position.
3. The method of claim 2, wherein the regular genes are genes that are 100% of the same genes that are present in the same location in the correctly located animal species of step (1).
4. The positioning method according to claim 1, further comprising: and determining the correct nucleotide sequence and/or amino acid sequence corresponding to the target gene of the animal to be positioned according to the correct position coordinates of the target gene on the chromosome of the animal to be positioned.
5. A method for locating ASMT genes of animals is characterized in that the animals to be located have ASMT genes, and the ASMT genes are not disclosed or not correctly disclosed in the genome of the animals to be located; the positioning method comprises the following steps:
(1) selecting animal species with the ASMT gene position correctly disclosed, wherein the number of the species is not less than 2;
(2) locating the position coordinates of the ASMT gene on the chromosome of each species described in step (1), and identifying the gene adjacent to the ASMT gene position and/or the gene associated with the ASMT gene;
(3) analyzing and obtaining rule information of ASMT gene positioning by adopting a comparative genomics method on the basis of the information obtained in the step (2);
(4) and judging the correct position coordinate of the ASMT gene on the chromosome of the animal to be positioned according to the conservation of the gene and the rule information.
6. The localization method according to claim 5, wherein the regular information of ASMT gene localization at least comprises: regular genes adjacent to the ASMT gene, position coordinates of the regular genes and relative position relation between the regular genes and the ASMT gene, and/or regular genes which are accompanied with the ASMT gene, position coordinates of the regular genes and relative position relation between the regular genes and the ASMT gene;
the regular genes refer to the same genes which account for more than 80% of the total number, preferably 100%, of the correctly located animal species in step (1) and are present at the same position.
7. The method of claim 6, wherein the regularity genes comprise AKAP17A gene and/or ASMTL gene.
8. The positioning method according to claim 5, further comprising: and determining the nucleotide sequence and/or amino acid sequence corresponding to the ASMT gene of the animal to be positioned according to the correct position coordinates of the ASMT gene on the chromosome of the animal to be positioned.
9. The method of claim 5, wherein the animal to be localized is a pig.
10. Use of the method for mapping the animal ASMT gene according to any one of claims 5 to 9 for studying melatonin biosynthesis in animals.
CN202110575589.8A 2021-05-26 2021-05-26 Animal gene positioning method Active CN113421611B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110575589.8A CN113421611B (en) 2021-05-26 2021-05-26 Animal gene positioning method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110575589.8A CN113421611B (en) 2021-05-26 2021-05-26 Animal gene positioning method

Publications (2)

Publication Number Publication Date
CN113421611A true CN113421611A (en) 2021-09-21
CN113421611B CN113421611B (en) 2024-04-19

Family

ID=77713010

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110575589.8A Active CN113421611B (en) 2021-05-26 2021-05-26 Animal gene positioning method

Country Status (1)

Country Link
CN (1) CN113421611B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050066276A1 (en) * 2002-12-13 2005-03-24 Moore Helen M. Methods for identifying, viewing, and analyzing syntenic and orthologous genomic regions between two or more species
WO2006101623A2 (en) * 2005-03-23 2006-09-28 Iowa State University Research Foundation, Inc. Cstf1 and c20orf43 markers for meat quality and growth rate in animals
US20070037154A1 (en) * 2003-05-23 2007-02-15 Iowa State University Research Foundation Inc. Fine mapping of chromosome 17 quantitative trait loci and use of same for marker assisted selection
US20180245079A1 (en) * 2015-08-18 2018-08-30 The Broad Institute, Inc. Methods and compositions for altering function and structure of chromatin loops and/or domains

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050066276A1 (en) * 2002-12-13 2005-03-24 Moore Helen M. Methods for identifying, viewing, and analyzing syntenic and orthologous genomic regions between two or more species
US20070037154A1 (en) * 2003-05-23 2007-02-15 Iowa State University Research Foundation Inc. Fine mapping of chromosome 17 quantitative trait loci and use of same for marker assisted selection
WO2006101623A2 (en) * 2005-03-23 2006-09-28 Iowa State University Research Foundation, Inc. Cstf1 and c20orf43 markers for meat quality and growth rate in animals
US20180245079A1 (en) * 2015-08-18 2018-08-30 The Broad Institute, Inc. Methods and compositions for altering function and structure of chromatin loops and/or domains

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
COSTA F.;COSTA G.;SANSAVINI S.;SOGLIO V，ET AL；: "HETEROLOGOUS COMPARATIVE GENOMICS TO IDENTIFY CANDIDATE GENES IMPACTING FRUIT QUALITY IN APPLE (MALUS X DOMESTICA BORKH.)", ACTA HORTICULTURAE, no. 814, 1 March 2009 (2009-03-01) *
YEONG B , YOOL H L , KYUNGJIN L , ET AL;: "Cellular localization and kinetics of the rice melatonin biosynthetic enzymes SNAT and ASMT", JOURNAL OF PINEAL RESEARCH, no. 56, 28 January 2014 (2014-01-28) *
刘潇;叶余丰;: "原发性高血压相关单核苷酸多态性的研究综述", 中国医疗前沿, vol. 05, no. 02, 23 January 2010 (2010-01-23) *
宋雪梅;李宏滨;杜立新;: "比较基因组学及其应用", 生命的化学, no. 05, 15 October 2006 (2006-10-15) *
闫晓红;王宁;: "鸡DLK1基因的生物信息学分析", 东北农业大学学报, vol. 42, no. 06, 25 June 2011 (2011-06-25) *
马海明;施启顺;柳小春;: "猪基因分离方法的研究进展", 国外畜牧学(猪与禽), no. 05, 25 September 2006 (2006-09-25) *

Also Published As

Publication number Publication date
CN113421611B (en) 2024-04-19

Similar Documents

Publication Publication Date Title
Bellinge et al. Myostatin and its implications on animal breeding: a review
Daetwyler et al. Accuracy of pedigree and genomic predictions of carcass and novel meat quality traits in multi-breed sheep data assessed by cross-validation
Fan et al. Gonadal transcriptome analysis of male and female olive flounder (Paralichthys olivaceus)
Ahlawat et al. Current status of molecular genetics research of goat fecundity
Wang et al. Hypothalamic and pituitary transcriptome profiling using RNA-sequencing in high-yielding and low-yielding laying hens
de Las Heras-Saldana et al. Combining information from genome-wide association and multi-tissue gene expression studies to elucidate factors underlying genetic variation for residual feed intake in Australian Angus cattle
Zheng et al. CNV analysis of Meishan pig by next-generation sequencing and effects of AHR gene CNV on pig reproductive traits
Tao et al. Combined approaches to reveal genes associated with litter size in Yunshang black goats
Hao et al. Genome-wide association study identifies candidate genes for piglet splay leg syndrome in different populations
Große-Brinkhaus et al. Genome-wide association analyses for boar taint components and testicular traits revealed regions having pleiotropic effects
Pasandideh et al. A genome‐wide association study revealed five SNPs affecting 8‐month weight in sheep
Akhatayeva et al. Detecting novel Indel variants within the GHR gene and their associations with growth traits in Luxi Blackhead sheep
Ladeira et al. CNV detection and their association with growth, efficiency and carcass traits in Santa Inês sheep
Bordbar et al. Identification and validation of a novel candidate gene regulating net meat weight in Simmental beef cattle based on imputed next‐generation sequencing
Gao et al. Genome-wide association study of egg-laying traits and egg quality in LingKun chickens
Getaneh et al. Candidate genes associated with economically important traits in dairy goats
Berkowicz et al. Single nucleotide polymorphisms in the imprinted bovine insulin‐like growth factor 2 receptor gene (IGF2R) are associated with body size traits in Irish Holstein‐Friesian cattle
Yao et al. Identification and characterization of unique and common lncRNAs and mRNAs in the pituitary, ovary, and uterus of Hu sheep with different prolificacy
CN113421611B (en) Animal gene positioning method
Hu et al. Polymorphisms in the ASMT and ADAMTS1 gene may increase litter size in goats
Ma et al. New insights into the genetic loci related to egg weight and age at first egg traits in broiler breeder
Xi et al. Identification of the genetic basis of the duck growth rate in multiple growth stages using genome-wide association analysis
Ma et al. Ovine RAP1GAP and rBAT gene polymorphisms and their association with tail fat deposition in Hu sheep
Brand et al. Adrenal cortex expression quantitative trait loci in a German Holstein× Charolais cross
Wu et al. Investigation of SNP markers for the melatonin production trait in the Hu sheep with bulked segregant analysis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant