CN113416788B - ADPGK gene molecular marker related to Hu sheep testicular character and application thereof - Google Patents
ADPGK gene molecular marker related to Hu sheep testicular character and application thereof Download PDFInfo
- Publication number
- CN113416788B CN113416788B CN202110797098.8A CN202110797098A CN113416788B CN 113416788 B CN113416788 B CN 113416788B CN 202110797098 A CN202110797098 A CN 202110797098A CN 113416788 B CN113416788 B CN 113416788B
- Authority
- CN
- China
- Prior art keywords
- sheep
- adpgk
- molecular marker
- gene
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for correlating the testicular character of Hu sheepADPGKGene molecular marker and application thereof, wherein the molecular marker is prepared fromADPGKThe Gene sequence (Gene Bank ID: 101116836) is obtained by amplifying a designed specific primer, the nucleotide sequence of the Gene sequence is shown as a sequence table SEQ ID NO.1, a C/T base mutation exists at the 130bp position of the sequence table SEQ ID NO.1, and the mutation causes HpyCH4 III-RFLP enzyme cutting polymorphism. By analyzing Hu sheepADPGKThe correlation between the genotyping and the testicular traits shows that the genotype of the Hu sheep individual is divided into a CC genotype and a TC genotype, and the weight, the size, the epididymis weight and the sperm number of the testis of the TC genotype individual are obviously higher than those of the CC genotype individual. By adopting the molecular marker, the accuracy of seed selection is improved, Hu sheep individuals with higher sperm yield can be selected when the Hu sheep rams are young, the early breeding of the Hu sheep variety becomes possible, and the breeding process is accelerated.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a Hu sheep testis character-related geneADPGKGene molecular marker and its application.
Background
In recent years, the demand for mutton is increasing, so that the mutton is in short supply. Therefore, the cultivation of new high-fertility sheep varieties or strains is one of the main measures for relieving the mutton tension in China and is also one of the important tasks of the national livestock and poultry fine breed joint attack. The sheep artificial insemination technology is the best choice for rapidly expanding the breeding scale, developing scientific seed selection and matching and improving the breeding benefit in an intensive sheep farm. Therefore, the sperm yield of the ram can be improved, the production capacity of the sheep flock can be effectively improved, and the situation of insufficient production supply of the existing mutton sheep is improved. Among several scientific and technological factors affecting the livestock production benefit, the scientific and technological contribution rate of genetic breeding and propagation accounts for 50%, but the traditional phenotypic selective breeding method is not high in accuracy. Research shows that the size of the testis of the Hu sheep is obviously related to the spermatogenesis capacity of the ram, but the testis size, which is the testicular character, can be measured only after the Hu sheep is mature, so that the selection time is increased, and the breeding progress is slow. With the development of molecular marking technology, the testis characters are marked by using a molecular biology method so as to carry out auxiliary selection of early breeding, reduce the blindness of selection in the breeding process, shorten the breeding time and greatly improve the breeding efficiency.
The Hu sheep is one of important domestic animals in Taihu plain, and is a first-level protective local livestock and poultry variety in China. The sheep is a rare white lamb skin sheep variety, has the excellent properties of precocity, four seasons estrus, two fetuses in one year, more lambs per fetus, good lactation performance, fast growth and development, ideal meat production performance after improvement, high temperature and high humidity resistance and the like, and can be used as an ideal lamb variety for molecular marker-assisted breeding to relieve the mutton tension situation in China.
ADP-dependent glucokinase (ADPGK) is a novel glucose phosphorylase that plays a role in sugar metabolic pathways. It is an isozyme of hexokinase and regulates cellular energy metabolism in vitro and in vivo by regulating protein glycosylation. Although it functions similarly to hexokinase, it differs in that ADPGK employs ADP instead of ATP as a phosphate donor and is not inhibited by glucose-6-phosphate. It has been shown that during spermatogenesis, the supporting cells supply energy for lactic acid production to the spermatozoon by a number of glycolysis (Oliveira P F et al, 2015) and that the process of sperm maturation in the epididymis also dependent on the energy produced by glycolysis (Hermo L et al, 2019), except that glycolysis is the main source of energy during sperm motility and is involved in sperm capacitation (Losano J et al, 2017). However, the application of ADPGK is mainly focused on tumor cells at present, and no report is found on relevant research on the fertility of Hu sheep or even sheep.
Disclosure of Invention
The invention aims to provide a method for correlating the testicular character of Hu sheepADPGKThe gene molecular marker provides an auxiliary selection molecular marker for the Hu sheep testicular character detection, improves the accuracy of seed selection, makes early breeding of Hu sheep varieties possible, and accelerates the breeding process.
The purpose of the invention is realized by the following technical scheme:
the invention provides a method for correlating the testicular character of Hu sheepADPGKGenetic molecular markers consisting ofADPGKThe DNA sequence of (A) is obtained by amplifying a designed specific primer, the nucleotide sequence of the DNA sequence is shown as SEQ ID NO.1, and a C/T base mutation is shown at a position of 130bp of the sequence SEQ ID NO.1, and the mutation causes RFLP-HpyCH4 III polymorphism.
The primer pairs for amplifying the molecular markers are as follows:
a forward primer F: ACCTGAAAAGGGTTGGAGAAT, respectively;
reverse primer R: AGGAAGGTTGTTGGGGTCATTT are provided.
The method utilizes the characteristics related to the testicle character of the Hu sheepADPGKThe gene molecular marker can be used for Hu sheep molecular marker-assisted selection, and particularly can be used for Hu sheep rams molecular marker-assisted selection with high sperm yield.
The method comprises the steps of collecting epididymis tail semen of the Hu sheep, extracting genome DNA, designing a specific primer pair, carrying out PCR amplification on the Hu sheep genome, and carrying out PCR amplification on the Hu sheep by adopting an HpyCH4 III-RFLP methodADPGKGenotyping is carried out on SNP loci of the genes, and finally Hu sheep are analyzedADPGKThe correlation between the genotyping and the testicular characters shows that the genotyping of the Hu sheep individuals is CC genotype and TC genotype, and the weight, size, epididymis weight and sperm number of the testis of the TC genotype individuals are obviously higher than those of the CC genotype individuals, so that the TC genotype individuals can be selected in the early breeding of the Hu sheep rams, and the early breeding of the Hu sheep rams with higher sperm yield is realized.
The molecular marker provided by the invention is used for molecular marker-assisted selection, and the sperm yield of the adult Hu sheep ram of the young can be predicted only by detecting the characteristic amplification band of the molecular marker.
Drawings
FIG. 1 shows a Hu sheep of the present inventionADPGKGene part sequencing results and SNP sites;
FIG. 2 shows a Hu sheep of the present inventionADPGKThe detection result of the gene HpyCH4 III-RFLP. Agarose concentration 3%, label in the figure indicates: lane M is DL2000 DNA Marker (containing 6 banding patterns of 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp and 2000 bp); the size of the TT genotype fragment is 312 bp, and the sizes of the CC genotype fragments are 131 bp and 181bp respectively; the sizes of TC genotype fragments are 131 bp, 181bp and 312 bp respectively.
Detailed Description
The following examples are further illustrative of the present invention and are not to be construed as limiting thereof. Modifications and substitutions may be made thereto without departing from the spirit and scope of the invention.
The 6-month-old Hu sheep ram sample is collected from agricultural biotechnology limited company of Defu, Minqin county.
1. Hu sheep testicle tissue and epididymis tail semen collection
And (3) taking the left testis tissue of the Hu sheep ram, preserving the left testis tissue by using liquid nitrogen, and extracting RNA. Weighing the tail of the epididymis on the left side of the Hu sheep, soaking the weighed tail in 50 mL saline, shearing the tissues into small pieces by using sterile scissors, placing the small pieces in a test tube, incubating the small pieces in a water bath at 37 ℃ for 1 hour, and filtering the small pieces through a 200-mesh copper net to remove tissue fragments to obtain semen.
2. Testis RNA extraction
(1) Grinding the testis tissue blocks into powder in liquid nitrogen;
(2) transferring 100mg testis tissue powder to a 1.5mL centrifuge tube, adding 1mL Trizol, and fully lysing for 5 min;
(3) adding 200 μ L chloroform, capping, mixing for 15s under shaking, and standing at room temperature for 10 min;
(4) centrifuging at 12000r/min at 4 deg.C for 10min, transferring the supernatant to another new centrifuge tube, adding 0.5mL isoamylol, mixing, and standing at room temperature for 5-10 min;
(5) centrifuging a new centrifuge tube at 12000r/min for 10 minutes at 4 ℃, removing supernatant, adding 1mL of 75% ethanol for suspension precipitation, continuing to centrifuge at 12000r/min at 4 ℃ for 5 minutes, removing ethanol, and standing in the air for 5-10 minutes to obtain RNA precipitate;
(6) the RNA precipitate was dissolved in 50. mu.L RNase-free water (DEPC), and stored at-80 ℃ after the concentration was measured with a spectrophotometer.
3. Reverse transcription reaction
According to the instructions of the gold EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit, the extracted RNA is diluted to the same concentration (1. mu.g/. mu.L), 1. mu.L of the RNA diluent is transferred to a new PCR tube, 1. mu.L of adsorbed Oligo (dT) Primer, 10. mu.L of 2 × ES Reaction Mix, 1. mu.L of EasyScript RT/RI Enzyme Mix, 1. mu.L of gDNA Remover and 6. mu.L of RNase-free Water are added into the PCR tube, the total volume is 20. mu.L, and the mixture is mixed gently. Carrying out reverse transcription reaction by adopting a PCR instrument according to the following conditions: incubate at 42 ℃ for 15 min, heat at 85 ℃ for 5s to inactivate the EasyScript RT/RI Enzyme Mix and gDNA Remover. The cDNA generated by reverse transcription was diluted to 20 ng/. mu.L and stored at-80 ℃.
4. Polymerase Chain Reaction (PCR)
According to Hu sheepADPGKThe mRNA sequence (XM _ 027971562.1) of the gene is amplified by using Oligo7 to design four pairs of primers (shown in Table 1) P1-P4, and specifically comprises the following steps: and (3) preparing a mixed pool of the cDNA of 50 Hu sheep ram individuals (each 10 Hu sheep individuals are mixed pools), and performing PCR amplification on a target fragment by using the mixed pool cDNA as a template. The total PCR amplification reaction was 20. mu.L: wherein the cDNA template (20 ng/. mu.L) is 1. mu.L, 2 × Easy Taq PCR Super MIX 10. mu.L (TranGen), the forward primer and the reverse primer are each 0.5. mu.L (10. mu.M), ddH2Make up to 20. mu.L of O. PCR amplification reaction conditions: pre-denaturation at 94 ℃ for 5min and then denaturation at 94 DEG CAnnealing for 30 s according to the annealing temperature corresponding to each primer in the table 1, and extending for 60 s at 72 ℃ (the steps of denaturation, annealing and extension are carried out for 34 cycles); and finally, extending for 5min at 72 ℃ to obtain a PCR product, and carrying out electrophoresis detection on the PCR product by using 1% agarose gel.
5. ADPGKGenetic single nucleotide polymorphism screening
Sequencing the obtained PCR product, and after sequencing comparison, finding that the PCR product obtained by amplifying the P3 primer has a C/T base mutation, wherein the mutation generates Single Nucleotide Polymorphism (SNP) of the restriction site (A [ T/C ] N ↓ ] GT) of the restriction enzyme HpyCH4 III, and the partial result of the sequencing peak diagram is shown in FIG. 1.
6. Genomic DNA extraction
(1) Taking the Hu sheep semen (1 mL) in the step 1, transferring the Hu sheep semen into a 1.5mL centrifuge tube, centrifuging at 12000rpm for 5-10min at 4 ℃, removing supernatant, and attaching the semen to the tube wall;
(2) adding 100 muL of SDS (20 percent, 20g of SDS dissolved in 100mL of distilled water) and 400 muL of tissue extract (3 mL of 0.5mol/L EDTA, 1mL of 1 mol/L Tris-HCl (pH 7.4), 15mL of 10 percent SDS, 0.1155g of DTT and 0.435g of NaCl into a centrifuge tube, adding water to 120mL, carrying out autoclaving according to a conventional method, and carrying out vortex oscillation to completely dissolve the sperm precipitate in the extract;
(3) adding 20 muL proteinase K (10 mg/mL) into the tissue extract to obtain a reaction solution, sealing the reaction solution by using a sealing film, turning over and uniformly mixing the reaction solution, placing the mixture in a water bath at 55 ℃ for digestion overnight, taking out the mixture during the digestion for several times, and dispersing precipitate blocks to facilitate enzymolysis;
(4) cooling the reaction liquid to room temperature, adding 300 mu L of saturated saline water, reversing and uniformly mixing for 2-3 min, and standing for 10min at 4 ℃;
(5) centrifuging at 12000rpm for 10min, and transferring the supernatant to a new centrifuge tube;
(6) adding 1mL of precooled anhydrous ethanol into the precipitate, reversing and uniformly mixing for 1-2 min (at the moment, white flocculent precipitate can be seen), and centrifuging at 12000rpm for 2 min;
(7) discarding the supernatant, and keeping DNA precipitate;
(8) adding 500 mu L of 75% ethanol (v/v) into the DNA sediment, gently mixing uniformly, centrifuging for 1 min at 12000 rpmm, and discarding the supernatant;
(9) repeating the step 8, and discarding the supernatant;
(10) after the ethanol is completely volatilized, 200 muL of water or TE is added to dissolve DNA;
(11) storing at 4 deg.C until DNA is completely dissolved, and storing at-80 deg.C after measuring concentration with spectrophotometer.
7. Restriction enzyme fragment polymorphism (RFLP) detection
According toADPGKDNA sequence (Gene Bank ID: 101116836) A pair of specific primers P5 was designed in the vicinity of the above-mentioned mutation site, and the Hu sheep genomic DNA extracted in step 6 was used as a template to amplify the desired fragment by PCR, the sequence of primer P5 is shown in Table 1, and the PCR amplification reaction system and reaction conditions were the same as in step 4.
TABLE 1 Hu sheepADPGKGene PCR primer sequence
The DNA sequence obtained by amplification of the primer pair P5 is shown in a sequence table SEQ ID NO.1, and C/T Single Nucleotide Polymorphism (SNP) exists at a position of 130bp of the sequence. Hu sheep is treated by HpyCH4 III-RFLP methodADPGKCarrying out genotyping on the SNP locus of the gene, wherein the enzyme digestion reaction system is 20 mu L: wherein the PCR product was 4. mu.L, restriction enzyme (HpyCH 4 III) 0.3. mu.L, 10 XBuffer 3. mu.L, ddH2O12.7 mu L, mixing the samples evenly, centrifuging, and incubating for 12 h at 37 ℃.
mu.L of the digested product was electrophoresed on 3% agarose gel, followed by genotyping and identification, and the results are shown in FIG. 2. The amplified fragment has the size of 312 bp, the enzyme digestion polymorphic site is positioned at the 130bp position of the fragment, when the mutation site is C base, the enzyme digestion site (A [ T/C ] N ↓ ] GT) of a restriction enzyme HpyCH4 III can be generated, 2 bands with the sizes of 131 bp and 181bp respectively can be generated after the enzyme digestion PCR product of HpyCH4 III, and the genotype is CC type; when the site is T basic group, the restriction enzyme cutting site of HpyCH4 III can not be generated, a 312 bp band is still formed after the PCR product is cut by HpyCH4 III enzyme, and the genotype is TT type; when the site is T/C hybrid, due to the existence of T and C bases, 3 bands with the sizes of 312 bp, 131 bp and 181bp are generated after the PCR product is cut by enzyme by HpyCH4 III, and the genotype is TC.
8. Hu sheepADPGKGenotype and testicular trait association analysis
The test detects the polymorphism of 466 Hu sheep, and the genotype detection result shows that there are 319 CC genotypes, 147 TC genotypes and TT genotypes in the 466 Hu sheep individuals. Analysis of Hu sheepADPGKThe frequency distribution of the single nucleotide polymorphisms on the gene is shown in Table 2.
TABLE 2 ADPGK genotype frequencies and allele frequencies
Batch effects were removed using R software, correlation analysis between genotype and phenotype was performed using SPSS 19.0 software, data was analyzed by independent sample t test if they met the normality test, and Mann-Whitney U test was used otherwise. All values are reported as mean ± sem, and P <0.05 is considered statistically significant.
The results of the genotype and testicular trait analyses are shown in Table 3, Hu sheepADPGKThe gene polymorphism is obviously related to the testis size, the major axis, the minor axis, the epididymis weight and the sperm number (p)<0.05）。
TABLE 3ADPGKCorrelation between different genotypes of gene and testis characteristics
The results in table 3 show that the weight, size, epididymis weight and sperm number of the Hu sheep TC genotype individual testis are significantly higher than those of the CC genotype individual, so that the TC genotype individual can be selected in the early breeding of the Hu sheep ram, and the early breeding of the Hu sheep ram with higher sperm yield can be realized.
Sequence listing
<110> Lanzhou university
<120> ADPGK gene molecular marker related to Hu sheep testicular character and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 312
<212> DNA
<213> sheep (Ovis aries)
<220>
<221> mutation
<400> 1
acctgaaaag ggttggagaa tcaagttttt agccctgtaa cacacaacat aaaaataaac 60
gagaacaaaa atccagtctt gttagtagat agctgaattg cgattaaaac ctgaaatgtt 120
tctgtgtaay tgtcaaaagg ctggaatgta tctggtagtt taatctgctg ttgtttcttt 180
ggctgtcttt cagtttgatc aacagaaatg gtttttgaca ctctcgatcc tatttcccag 240
accactgaat tcctgtcatt tttaggttgg ctagttttcc ttcatcagaa aaatgacccc 300
Claims (1)
1. Relating to the testicular character of Hu sheepADPGKThe application of the gene molecular marker in Hu sheep molecular marker-assisted selection is characterized in thatADPGKThe gene molecular marker is used for the molecular marker-assisted selection of the Hu sheep ram with the characteristics related to the size of the testis, the long diameter of the testis, the short diameter of the testis, the weight of the epididymis or the number of sperms;
the molecular marker of ADPGK gene related to the Hu sheep testicular character is composed ofADPGKThe gene sequence is obtained by amplifying a designed specific primer, the nucleotide sequence of the gene sequence is shown as SEQ ID NO.1, a C/T base mutation is shown at a position y of 130bp of the sequence SEQ ID NO.1, and the mutation causes RFLP-HpyCH4 III polymorphism.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110797098.8A CN113416788B (en) | 2021-07-14 | 2021-07-14 | ADPGK gene molecular marker related to Hu sheep testicular character and application thereof |
| ZA2022/07638A ZA202207638B (en) | 2021-07-14 | 2022-07-11 | Adpgk gene molecular marker related to hu sheep testis trait and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110797098.8A CN113416788B (en) | 2021-07-14 | 2021-07-14 | ADPGK gene molecular marker related to Hu sheep testicular character and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113416788A CN113416788A (en) | 2021-09-21 |
| CN113416788B true CN113416788B (en) | 2022-04-29 |
Family
ID=77721017
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110797098.8A Active CN113416788B (en) | 2021-07-14 | 2021-07-14 | ADPGK gene molecular marker related to Hu sheep testicular character and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113416788B (en) |
| ZA (1) | ZA202207638B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116144786A (en) * | 2022-10-05 | 2023-05-23 | 甘肃润牧生物工程有限责任公司 | FAM151B gene molecular marker related to Hu sheep testis character and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950638A (en) * | 2016-07-22 | 2016-09-21 | 兰州大学 | Molecular marker of TrkA gene as sheep lambing number characteristic and application of molecular marker |
| CN110241227A (en) * | 2019-07-01 | 2019-09-17 | 兰州大学 | A kind of method and application detecting sheep SPATA6 gene single nucleotide polymorphism |
| CN111850136A (en) * | 2020-06-30 | 2020-10-30 | 广东海洋大学 | Application of MRVI1 gene as marker for screening excellent meat quality traits of beef cattle |
| CN111954541A (en) * | 2018-01-25 | 2020-11-17 | Acm生物实验室私人有限公司 | Polymersomes comprising soluble encapsulated antigens, methods of making and uses thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210071255A1 (en) * | 2019-09-06 | 2021-03-11 | The Broad Institute, Inc. | Methods for identification of genes and genetic variants for complex phenotypes using single cell atlases and uses of the genes and variants thereof |
-
2021
- 2021-07-14 CN CN202110797098.8A patent/CN113416788B/en active Active
-
2022
- 2022-07-11 ZA ZA2022/07638A patent/ZA202207638B/en unknown
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950638A (en) * | 2016-07-22 | 2016-09-21 | 兰州大学 | Molecular marker of TrkA gene as sheep lambing number characteristic and application of molecular marker |
| CN111954541A (en) * | 2018-01-25 | 2020-11-17 | Acm生物实验室私人有限公司 | Polymersomes comprising soluble encapsulated antigens, methods of making and uses thereof |
| CN110241227A (en) * | 2019-07-01 | 2019-09-17 | 兰州大学 | A kind of method and application detecting sheep SPATA6 gene single nucleotide polymorphism |
| CN111850136A (en) * | 2020-06-30 | 2020-10-30 | 广东海洋大学 | Application of MRVI1 gene as marker for screening excellent meat quality traits of beef cattle |
Non-Patent Citations (3)
| Title |
|---|
| "rs160289512";NCBI;《Ensembl》;20210531;第1-2页 * |
| "Variants of ADPGK gene and its effect on the male reproductive organ parameters and sperm count in Hu sheep";Rongyu Yao等;《Animal Biotechnology 》;20211103;第1-8页 * |
| "脂多糖对奶山羊肝脏葡萄糖及脂肪酸代谢的影响";杨树;《中国优秀硕士学位论文全文数据库农业科技辑》;20150315(第03期);D050-89 * |
Also Published As
| Publication number | Publication date |
|---|---|
| ZA202207638B (en) | 2022-10-26 |
| CN113416788A (en) | 2021-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106701830B (en) | Pig embryo p66 knock-outshcMethod for gene | |
| CN108018316A (en) | A kind of method of gene knockout selection and breeding rmnd5b Gene Deletion zebra fish | |
| US10323284B2 (en) | Single nucleotide polymorphisms associated with bull fertility | |
| CN108384859B (en) | SNP (Single nucleotide polymorphism) marker related to tail type character of fat-tail sheep and application | |
| CN113416788B (en) | ADPGK gene molecular marker related to Hu sheep testicular character and application thereof | |
| CN109280666A (en) | A kind of method of gene knockout breeding bai2 Gene Deletion zebra fish | |
| CN110066805A (en) | The method of gene knockout breeding adgrf3b Gene Deletion zebra fish | |
| CN113355427B (en) | SNP (single nucleotide polymorphism) marker related to pig backfat thickness and utilization method thereof | |
| CN112941198B (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| CA2549397A1 (en) | Methods and compositions for genetically detecting improved milk production traits in cattle | |
| CN111518916B (en) | SNP marker significantly related to pig chromosome 13 and number of live piglets of Erhualian pigs as well as detection method and application of SNP marker | |
| CN107354234B (en) | Method for screening parent oysters with high glycogen content and related primer pair thereof | |
| CN114250307B (en) | Molecular marker for evaluating age of pigs reaching 100kg body weight and application thereof | |
| CN115720874A (en) | Creating method and application of inonotus spiny germplasm for cultured economic fishes | |
| CN110129320B (en) | Method for obtaining gene editing sheep and sgRNA and Oligo DNA special for same | |
| CN113736890A (en) | SNP molecular marker related to Jian' er number and survival rate and application thereof | |
| CN116042844B (en) | SNP molecular marker affecting pig growth traits and application thereof | |
| CN113355428B (en) | SNP (Single nucleotide polymorphism) marker related to day age of up to 100kg body weight and application method thereof | |
| CN111808974B (en) | SNP molecular marker located on pig chromosome 9 and related to scrotal hernia and application | |
| CN103289992A (en) | ABCF1 gene used as porcine birth weight character related molecular marker | |
| CN108570505B (en) | Multi-group integrated precise breeding method for pigs | |
| CN104630210B (en) | GLI2 genes are used as pig birth weight proterties related molecular marker and preparation method and application | |
| CN103421901B (en) | Method for identifying royal jelly production performance by bee SsRbeta gene fluorescent quantitative PCR (polymerase chain reaction) technology | |
| CN117487931B (en) | Sillago sihama hypoxia tolerance character related SNP molecular marker and application thereof | |
| CN109486956B (en) | Multi-group integrated precise breeding method for pigs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220713 Address after: 737200 north side of Yongqing Road, zhuwangbao Town, Yongchang County, Jinchang City, Gansu Province (Yongqing road 8-6) Patentee after: GANSU RUNMU BIOLOGICAL ENGINEERING CO.,LTD. Address before: 730000 No. 222 Tianshui South Road, Chengguan District, Gansu, Lanzhou Patentee before: LANZHOU University |
|
| TR01 | Transfer of patent right |