CN113403309B - Application of non-homologous double-stranded oligonucleotide fragment in gene knockout system - Google Patents

Abstract

The invention relates to application of non-homologous double-stranded oligonucleotide fragments in a gene knockout system. The invention combines non-homologous double-stranded oligonucleotide fragments with a gene knockout system for gene knockout for the first time, the non-homologous double-stranded oligonucleotide fragments can stimulate the non-homologous tail end of cells to be connected and repaired, more insertions or deletions are introduced, meanwhile, the non-homologous double-stranded oligonucleotide fragments can be inserted into cutting break points and can be used as markers to monitor the off-target sites, thus being beneficial to enhancing the knockout efficiency of target genes and accurately monitoring the off-target effect.

Description

Application of non-homologous double-stranded oligonucleotide fragment in gene knockout system

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to application of a non-homologous double-stranded oligonucleotide fragment in a gene knockout system.

Background

With the progress of gene function research, the clinical direction of antiviral therapy is moving to the field of individualized gene editing. However, the existing gene knockout system (CRISPR/Cas nuclease system) has low knockout efficiency on target genes, and the development and application of the CRISPR/Cas nuclease system are limited; meanwhile, in order to detect the off-target effect, the off-target site is assumed to be similar to the target site in advance, but because many off-target mutations occur at places which are greatly different from the target site, the number and positions of off-target breakpoints are difficult to predict. How to improve the target gene knockout efficiency of the gene knockout system and simultaneously monitor the off-target effect becomes the key point of research. For example, the HPV18E7 gene is targeted to be knocked out by using CRISPR/Cas9, the problems that the editing efficiency needs to be further improved, the off-target condition is unknown and the like exist, and the further transformation application of the gene in clinic is limited.

In order to obtain higher editing efficiency, searching for a new nuclease, screening sgRNA with high target activity, adding an exogenous synergistic protein, knocking in an homologous donor of an exogenous gene fragment, modifying sgRNA, and the like are generally used. For example, patent CN111718418A discloses a fusion protein for enhancing gene editing; patent CN112601812A discloses agents for promoting homologous targeted DNA repair for use in hematopoietic stem cell and/or progenitor cell gene therapy; patent CN107532162A discloses the modification of genomic sequences in cells using editing oligonucleotides; patent CN109295060A discloses a paired sgRNA for gene editing and application, wherein a plurality of sgRNAs are designed according to specific editing requirements of a target gene or a target genome site, two sgRNAs with specific intervals and corresponding PAM specific position combinations are selected as the paired sgRNAs, and the paired Cas 9-sgRNAs can improve the gene editing efficiency. The substitution of cas9 protein, such as sacas9, has the limitations of insufficient cutting efficiency and stricter requirements on PAM sequence; the editing efficiency is improved by simultaneously adding exogenous small molecular compounds, and the problem that the compounds are inconvenient to be simultaneously delivered into cells exists; the improvement of the sgRNA only aims at a specific target gene to obtain better editing efficiency, and the universality is not high.

Disclosure of Invention

The invention aims to provide application of non-homologous double-stranded oligonucleotide fragments in a gene knockout system, wherein the non-homologous double-stranded oligonucleotide fragments can increase the cutting breakpoint of the gene knockout system on a target gene and can be integrated at the cutting breakpoint, so that the knockout effect of the target gene is enhanced, and off-target sites can be accurately judged.

In order to achieve the purpose, the invention adopts the technical scheme that:

the first aspect of the present invention provides an application of a non-homologous double-stranded oligonucleotide fragment in a gene knockout system, wherein the non-homologous double-stranded oligonucleotide fragment can improve the cleavage efficiency of the gene knockout system on a target gene and can be integrated at a cleavage breakpoint.

Specifically, the non-homologous double-stranded oligonucleotide fragments can stimulate repair of non-homologous end joining of cells, introducing more insertions or deletions.

Specifically, cells are co-transfected with a CRISPR system for knocking out a target gene and a non-homologous double-stranded oligonucleotide fragment.

Preferably, the non-homologous double-stranded oligonucleotide fragment can also be used as a marker for monitoring off-target effects of gene knockout systems.

Specifically, after a CRISPR system for knocking out a target gene and a nonhomologous double-stranded oligonucleotide fragment are cotransfected to a cell, the integration position of the nonhomologous double-stranded oligonucleotide fragment is analyzed by a GUIDE-seq method to judge an off-target site.

Based on the problems that the knockout effect of the existing gene knockout system is poor and the off-target site is difficult to accurately position, the inventor finds that the sgRNA with high target activity is screened only, the cleavage effect of the CRISPR system constructed by the sgRNA is still not ideal, the inventor accidentally finds that the non-homologous double-stranded oligonucleotide fragment (non-homologous dsODN) is combined with the gene knockout system and then used for gene knockout, the non-homologous double-stranded oligonucleotide fragment can stimulate the non-homologous end connection repair of cells, more insertions or deletions (indels) are introduced, the non-homologous double-stranded oligonucleotide fragment can be inserted into the cleavage site and can also be used as a marker to accurately position the off-target site, the off-target effect is monitored while the knockout efficiency of a target gene is remarkably enhanced, and the two aims are achieved.

In the above application, the CRISPR system is preferably a CRISPR/Cas9 system. At present, the CRISPR/Cas9 system is relatively comprehensively researched, but the target gene knockout efficiency is low and a serious off-target effect still exists, and the combination of the non-homologous double-stranded oligonucleotide fragment and the target gene knockout effect can obviously improve the CRISPR/Cas9 system and accurately position off-target sites.

The sequence of the non-homologous double-stranded oligonucleotide fragment is preferably as shown in SEQ ID NO.6, or a sequence having at least 80% or more homology thereto, preferably at least 85% or more homology thereto, more preferably at least 90% or more homology thereto, still more preferably at least 95% or more homology thereto, and still more preferably at least 98% or more homology thereto.

Further preferably, the non-homologous double-stranded oligonucleotide fragment is phosphorylated at the 5 ' end, glucosinolate is modified between two consecutive nucleotides of three nucleotides at the 5 ' end, and glucosinolate is modified between two consecutive nucleotides of three nucleotides at the 3 ' end.

Phosphorylation modification is carried out at the 5' end, so that the integration of the nonhomologous double-stranded oligonucleotide fragment and the cutting end point is facilitated; the thioside modification is beneficial to improving the stability of the nonhomologous double-stranded oligonucleotide fragment in the presence of cells and is not easy to degrade.

In a second aspect the invention provides a gene knockout system comprising a CRISPR system and a non-homologous double stranded oligonucleotide fragment.

Preferably, the CRISPR system is a CRISPR/Cas9 system.

Preferably, the CRISPR system for knocking out a target gene is cotransfected with a cell with a non-homologous double stranded oligonucleotide fragment.

Preferably, the sequence of the non-homologous dsODN is as shown in SEQ ID No.6, or a sequence having at least 80% or more homology thereto, preferably at least 85% or more homology, more preferably at least 90% or more homology, even more preferably at least 95% or more homology, and even more preferably at least 98% or more homology.

Further preferably, the non-homologous double-stranded oligonucleotide fragment is phosphorylated at the 5 ' end, glucosinolate is modified between two consecutive nucleotides of three nucleotides at the 5 ' end, and glucosinolate is modified between two consecutive nucleotides of three nucleotides at the 3 ' end. Phosphorylation modification is carried out at the 5' end, so that integration of the nonhomologous double-stranded oligonucleotide fragment and the cutting end point is facilitated; the thioside modification is beneficial to improving the stability of the nonhomologous double-stranded oligonucleotide fragment inserted into a cutting end point.

Preferably, the gene knockout system is directed to the knockout of the human papillomavirus type 18E7 gene.

According to some embodiments, the sequence of the sgRNA of the CRISPR system is as shown in SEQ ID No.1, or a sequence having at least 80% homology or more thereto, preferably at least 85% homology or more, further preferably at least 90% homology or more, further preferably at least 95% homology or more, further preferably at least 98% homology or more;

or the sequence of the sgRNA is shown as SEQ ID NO.2, or a sequence having at least 80% homology or more with the sgRNA, preferably at least 85% homology or more, more preferably at least 90% homology or more, even more preferably at least 95% homology or more, and even more preferably at least 98% homology or more.

Specifically, cloning an expression vector PX330 by sgRNA and Cas9 which can be combined with the human papilloma virus 18 type E7 gene to obtain a plasmid for knocking out the human papilloma virus 18 type E7 gene in a targeted manner;

the plasmid used to target knock-out of the human papillomavirus E7 gene was co-transfected with a non-homologous dsODN.

The constructed CRISPR/Cas9 expression plasmid targeting the high-risk HPV E7 gene is used for specifically inducing HPV oncogenic element frameshift mutation of corresponding HPV subtype positive cells by transfecting the expression plasmid and non-homologous dsODN into the cells together, so that the oncogenic property is lost, and even the cells are directly subjected to apoptosis due to excessive DSB. The efficiency of specifically knocking out the high-risk HPV E7 gene by the CRISPR/Cas9 system is effectively enhanced, so that the aims of reducing virus load, removing viruses and pathological cells and reversing canceration are fulfilled, and the method has an important clinical application value.

Preferably, the system is used for targeted knockout of human papillomavirus type 18E7 gene, and the sequence of the non-homologous dsODN is shown as SEQ ID NO.6, or has at least 80% homology or more with the sequence, preferably has at least 85% homology or more with the sequence, further preferably has at least 90% homology or more with the sequence, further preferably has at least 95% homology or more with the sequence, and further preferably has at least 98% homology or more with the sequence.

Due to the application of the technical scheme, compared with the prior art, the invention has the following advantages:

based on the problems that the knockout efficiency of a target gene of the existing gene knockout system is low, the condition of the target gene is unclear, the target-missing site is difficult to accurately position and the like, the non-homologous double-stranded oligonucleotide fragment is firstly combined with the gene knockout system for gene knockout, the non-homologous double-stranded oligonucleotide fragment can excite the non-homologous tail end of a cell to connect and repair, more insertions/deletions are introduced, meanwhile, the non-homologous double-stranded oligonucleotide fragment can be inserted into a cutting point, the target-missing site can be accurately positioned by adopting a GUIDE-seq method as a marker, the knockout efficiency of the target gene is enhanced, and the target gene miss effect is monitored at the same time.

Drawings

FIG. 1 is a sequence diagram of a non-homologous double stranded oligonucleotide fragment (dsODN) used in the examples;

FIG. 2 is a schematic diagram showing the effect of CRISPR/Cas9 co-transforming non-homologous dsODN knocking out high-risk HPV E7 gene;

fig. 3 shows that when CRISPR/Cas9 targeting HPV18E7 was co-transformed into a non-homologous dsODN in the examples, ODN integration was detected at the breakpoint of the target gene. In the figure, "blank" represents the results of untreated group breakpoint PCR, "-" represents the results of CRISPR/Cas9 plasmid group breakpoint PCR only transfected to target HPV18E7, "ss" represents the results of CRISPR/Cas9 plasmid and non-homologous single-stranded oligonucleotide fragment (ssODN) group breakpoint PCR cotransferred to target HPV18E7, and "ds" represents the results of CRISPR/Cas9 plasmid and non-homologous double-stranded oligonucleotide fragment (dsODN) group breakpoint PCR cotransferred to target HPV18E 7;

FIG. 4 is the sequencing result of Sanger sequencing of PCR product of group breaking point of CRISPR/Cas9 cotransformation non-homologous dsODN using targeting HPV18E7 in the examples;

FIG. 5 shows the expression level of HPV18E7 mRNA after co-transformation of HeLa cells with CRISPR/Cas9 plasmid targeting HPV18E7 and non-homologous dsODN in the examples. In the figure, "blank" represents the mRNA expression level of HPV18E7 in an untreated group, "-" represents the mRNA expression level of HPV18E7 in a CRISPR/Cas9 plasmid group only transfected with targeting HPV18E7, "ss" represents the mRNA expression level of CRISPR/Cas9 plasmid of cotransfer targeting HPV18E7 and HPV18E7 in a non-homologous ssODN group, and "ds" represents the mRNA expression level of HPV18E7 in a CRISPR/Cas9 plasmid of cotransfer targeting HPV18E7 and non-homologous dsODN group;

FIG. 6 shows the HPV18-E7 gene knockout efficiency (Indel%) after co-transformation of HeLa cells with CRISPR/Cas9 plasmid targeting HPV18E7 and non-homologous dsODN in the examples. In the figure, "-" represents the CRISPR/Cas9 plasmid group only transfected with targeting HPV18E7, "ss" represents the CRISPR/Cas9 plasmid and the non-homologous ssODN group of cotransferred targeting HPV18E7, and "ds" represents the CRISPR/Cas9 plasmid and the non-homologous dsODN group of cotransferred targeting HPV18E 7. NON-ODN% represents the proportion of insertions or deletions (indels) at the breakpoint but no ODN insertion, and ODN% represents the proportion of ODN insertions at the breakpoint;

FIG. 7 is a schematic diagram of the process of GUIDE-Seq library construction;

FIG. 8 is off-target as monitored by co-transfected dsODNs as markers in the examples. "20 bp target site" refers to the DNA sequence of the targeted target gene, with PAM as the motif adjacent to the prepro-spacer sequence. "·" indicates that the base of the monitored site matches the target DNA sequence, and all "·" indicates that the site is at the target site, and the inconsistency indicates that the site is off-target.

Detailed Description

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to specific examples.

The primers used in the examples were synthesized by Cincisco Biotech, Suzhou; qRT-PCR reagent adopted

Premix Ex Taq ^TM Purchased from Bao bioengineering (Dalian) Co., Ltd. (Code No. RR420A).

Example 1, non-homologous ODN sequence (SEQ ID NO.6) and manner of obtaining.

(1) Obtaining ssODN donor:

the sequence of ssODN donor is:

5′-P-G*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T-3′

wherein "P" indicates 5' phosphorylation and "-" indicates glucosinolate modifications between 2 nucleotides. Sequence synthesis and modification were both done by Jinwei Zhi biology, Suzhou. The resultant dry powder was diluted to a concentration of 50. mu.M with sterile deionized water for subsequent transfection.

(2) Acquisition of dsODN donor:

first, 2 ssODNs with complementary pairs in opposite directions were synthesized, the sequences of which are as follows:

oligo 1：5′-P-G*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T-3′

oligo 2：5′-P-A*T*ACCGTTATTAACATATGACAACTCAATTAA*A*C-3′

similarly, where "P" indicates 5' phosphorylation and "-" indicates a modified linkage of glucosinolate between 2 nucleotides. Synthesis and modification of 2 complementary ssODN sequences were performed by suma jingzhi biology. The resultant dry powder was diluted to a concentration of 125. mu.M with sterile deionized water for the subsequent annealing step.

Annealing of 2 single strands of ssODN to form a double stranded dsODN donor

First, 10 XOligodaplex Annealing Buffer (STE) was prepared as a Buffer required for Annealing:

then, the following reaction system was added to a 200. mu.L sterile reaction tube:

and finally, completing the prepared annealing reaction system in a PCR instrument, wherein the reaction process comprises the following steps: 95 ℃, 5min → 1 ℃ drop every 30s (70 cycles total) → 4 ℃ hold.

Example 2 construction of CRISPR/Cas9 plasmid expression vector targeting HPV18E7

(1) The full-length sequence information of HPV18E7 oncogene is inquired from NCBI website, sgRNA is designed aiming at E7 of HPV18, and the following sgRNAs with good effect are preliminarily screened:

E7-sgRNA1

CGAGCAATTAAGCGACTCAGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc(SEQ ID NO.1)。

E7-sgRNA2

TCGTGACATAGAAGGTCAACgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc(SEQ ID NO.2)。

E7-sgRNA3

AGAGCCCCAAAATGAAATTCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc(SEQ ID NO.3)。

E7-sgRNA4

CATTGTGTGACGTTGTGGTTgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc(SEQ ID NO.4)。

E7-sgRNA5

ACGTTGTGGTTCGGCTCGTCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc(SEQ ID NO.5)。

wherein, the capital letters are crRNA sequences, i.e. sequences combined with target DNA, and the small letters are scaffold, i.e. secondary structural regions where sgRNA plays a role. Further experiments prove that the effects of E7-sgRNA3, E7-sgRNA4 and E7-sgRNA5 are poor, and the sgRNAs of the CRISPR/Cas9 system for targeting HPV18E7 are determined to be E7-sgRNA1(SEQ ID NO.1) or E7-sgRNA2(SEQ ID NO. 2).

(2) Construction method of expression vector for CRISPR/Cas9-E7 construction was accomplished with reference to the construction methods cited herein (Cong, L.et al.multiple genome engineering CRISPR/Cas systems. science 339, 819. 823, doi:10.1126/science.1231143 (2013)):

E7-sgRNA1 or E7-sgRNA2 and Cas9 sequences are cloned to an expression vector PX330, a eukaryotic expression vector CRISPR/Cas9-E7 plasmid aiming at HPV18E7 is constructed, after construction is completed, the correctness and no mutation of the constructed vector sequence are determined through conventional sequencing comparison, and the completely correct clone is selected for amplification and plasmid extraction.

Example 3 verification that dsODN can integrate to DSB after CRISPR/Cas9-E7 plasmid and co-transformation of non-homologous dsODN

The CRISPR/Cas9-E7 plasmid is transfected into cells, and the expressed CRISPR/Cas9-E7 system targeting HPV18E7 can rapidly recognize HPV18E7 sequences and play a role in cutting. After cutting, the cells are rapidly repaired mainly through an NHEJ pathway which is not limited by a cell cycle, so that insertion or deletion (indel) of a small segment is introduced, a frame shift mutation is caused, the E7 is finally lost, and the expression of HPV18E7 oncoprotein is inhibited. After co-transformation of the dsODN, on one hand, the dsODN can be integrated to a breakpoint, on the other hand, a cell NHEJ pathway can be stimulated, and more indels are introduced, so that the knockout efficiency of the target gene is improved.

The specific operation method comprises the following steps:

(1) cell culture

HPV18 Positive cervical cancer cell line HeLa complete Medium with DMEM containing 10% serum at 37 ℃ with 5% CO ₂ Culturing in an incubator. When the cell fusion degree reaches 90%, digesting with 0.25% pancreatin, stopping digestion with DMEM complete medium, inoculating into 6-well plate, and culturing for 24 hr.

(2) CRISPR/Cas9-E7 plasmid and nonhomologous dsODN cotransfection

After 24 hours, the cells were confirmed to adhere well, and the degree of cell fusion reached 80%, and transfection was performed. Mu.g of CRISPR/Cas9-E7 plasmid and 2. mu.L of non-homologous dsODN were transfected per well, using the X-tremeGENE HP DNA Transfection Reagent from Roche, as described in the instructions, in control with untreated cell groups, cell groups transfected with equal amounts of CRISPR/Cas9-E7 plasmid, cell groups transfected with equal amounts of CRISPR/Cas9-E7 plasmid and non-homologous ssODN. The transfected cells were continued at 37 ℃ with 5% CO ₂ Culturing in an incubator.

(3) Genomic DNA extraction

After 48 hours of transfection, 0.25% trypsin digestion was routinely performed, digestion was terminated with DMEM complete medium, cells were collected into a centrifuge tube, centrifuged at 300g for 5 minutes, the medium was discarded, PBS was washed once, centrifuged again at 300g for 5 minutes, PBS was discarded to obtain cell debris, cell genomic DNA was extracted using a cell genome extraction kit (all-type gold Biotechnology Co., Ltd., Cat. No.: EE101-01), and the DNA concentration was measured.

(4) Design of primers

Primers were designed based on the HPV18E7 gene sequence and non-homologous dsODN, with one end on the dsODN and the other end on the target gene. The corresponding primer sequences in this example are:

ODN-F:TTGAGTTGTCATATGTTAATAACGGT(SEQ ID NO.7)。

HPV18-E7-R:GTTGCTTACTGCTGGGATGC(SEQ ID NO.8)。

(5) PCR reaction

The above-mentioned extracted genomic DNA was used as a template, and the above-mentioned primers were used to carry out PCR reaction. The high-fidelity DNA polymerase used in the experiment is that of Beijing Quanji Biotech limited company

PCR SuperMix (cat # AS 111-02).

And (3) PCR reaction system:

and (3) PCR reaction conditions:

and after the PCR reaction is finished, taking a small amount of PCR products for agarose gel electrophoresis, and preliminarily judging whether the concentration of the PCR products and the size of bands are correct or not according to the electrophoresis result.

(6) Sequencing of the target band Sanger

The results of the experiments in FIGS. 3 and 4 show that the agarose gel electrophoresis has target bands, and the alignment of the sequencing results of the bands is correct, which indicates that the dsODN is integrated at the DSB by the HeLa cell group co-transformed with the CRISPR/Cas9-E7 plasmid and the non-homologous dsODN. No target bands are shown for the untreated cell group, the cell group transfected with the equivalent amount of CRISPR/Cas9-E7 plasmid, the cell group transfected with the equivalent amount of CRISPR/Cas9-E7 plasmid, and the ssODN.

Example 4. qRT-PCR clear Effect of cotransforming CRISPR/Cas9-E7 plasmid and dsODN on HPV18E7 mRNA transcript levels

(1) Extraction of sample RNA

The lysed cells were frozen and left at room temperature for 5 minutes to completely dissolve.

Separating two phases: 0.2ml of chloroform was added to each 1ml of the TRIZOL reagent lysed sample and the vial cap was closed. After manually shaking the tube vigorously for 15 seconds, the tube is incubated at 15 to 30 ℃ for 2 to 3 minutes. Centrifuge at 12000rpm for 15 minutes at 4 ℃. After centrifugation, the mixed liquid will be separated into a lower red phenol chloroform phase, an intermediate layer and an upper colorless aqueous phase. The RNA was partitioned in the aqueous phase in its entirety. The volume of the upper aqueous layer was approximately 60% of the TRIZOL reagent added during homogenization.

③ precipitation of RNA: the upper layer of the aqueous phase was transferred to a clean rnase-free centrifuge tube. The RNA was precipitated by mixing with an equal volume of isopropanol, incubated at 15 to 30 ℃ for 10 minutes after mixing, and centrifuged at 12000rpm at 4 ℃ for 10 minutes. At this point the invisible RNA pellet before centrifugation will form a gelatinous pellet at the bottom and on the side walls of the tube.

RNA cleaning: the supernatant was removed and at least 1ml of 75% ethanol (75% ethanol with DEPCH) was added per 1ml of TRIZOL reagent lysed sample ₂ O preparation), washing the RNA precipitate. After mixing, the mixture was centrifuged at 7000rpm at 4 ℃ for 5 minutes.

RNA drying: most of the ethanol solution was carefully aspirated and the RNA pellet was allowed to dry in air at room temperature for 5-10 minutes.

Sixthly, dissolving RNA precipitate: when dissolving RNA, 40. mu.l of RNase-free water was added and the mixture was repeatedly blown with a gun several times to dissolve the RNA completely, and the obtained RNA solution was stored at-80 ℃ for further use.

(2) PCR reaction solution was prepared as follows (the reaction solution was prepared on ice)

Reagent	Amount of the composition used	Final concentration
			SYBR Premix Ex Taq(Tli RNaseH Plus)(2×)	10μl	1×
PCR Forward Primer(10μM)	0.4μl	02μM ＊1
			PCR Reverse Primer(10μM)	0.4μl	0.2μM ＊1
DNA template (< 100ng) ＊2	2μl
			Sterilized water	7.2μl
Total	20ul

Applied Biosystems 7500 Fast Real-Time PCR System was used for Real Time PCR reaction, and the reaction procedure used was a two-step PCR amplification standard:

stage 1: pre-denaturation

Reps：1

95 ℃ for 30 seconds

Stage 2: PCR reaction

Reps：40

95 ℃ for 5 seconds

30-34 seconds at 60 DEG C

FIG. 5 shows that the transcription level of HPV18E7 mRNA in HeLa cell group co-transformed with CRISPR/Cas9-E7 plasmid and dsODN is obviously reduced, which indicates that the effect of targeted knockout of HPV18E7 gene is better than that of cell group transfected with CRISPR/Cas9-E7 plasmid, cell group transfected with CRISPR/Cas9-E7 plasmid and co-transformed non-homologous ssODN.

Example 5 amplicon sequencing to further evaluate the efficiency of editing target genes by the co-rotating CRISPR/Cas9-E7 plasmid and non-homologous dsODN

The genomic DNA extracted in example 3 was used as a template, primers were designed according to the target, and PCR was performed. The reagent used in this experiment was KAPAHiFi HotStart ReadyMix (cat. KK2602) from KAPAbiosystems.

(1) Design of primers

Designing a primer according to the target point, wherein two ends of the primer are respectively positioned at two sides of the target point. The corresponding primer sequences in this example are:

E7-NGS-F：

ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCATGGACCTAAGGCAACA(SEQ ID NO.9)。

E7-NGS-R:gtgactggagttcagacgtgtgctcttccgatctgctcaattctggcttcacact(SEQ ID NO.10)。

(2) first round PCR

Reaction system:

Nuclease-free H2O	supplementing to 25ul
		KAPA HiFi HotStart ReadyMix	12.5ul
E7-NGS-F(10μM)	0.75ul
		E7-NGS-R(10μM)	0.75ul
Genome DNA	1ug
		Total	25ul

Reaction conditions are as follows: at 98 ℃ for 3 min; 25cycles of (98 ℃ for 20s,65 ℃ for 15s,72 ℃ for 15s),72 ℃ for 1min,4 ℃ for ∞

(3) Second round PCR

Reaction system:

Nuclease-free H2O	supplementing to 25ul
		KAPAHiFi HotStart ReadyMix	12.5ul
NEBNext i5 primer(10μM)	2.5ul
		NEBNext i7 primer(10μM)	2.5ul
DNA from PCR1	2ul
		Total	25ul

Reaction conditions are as follows: at 98 ℃ for 3 min; 11cycles of (98 ℃ for 20s,65 ℃ for 15s,72 ℃ for 15s),72 ℃ for 1min,4 ℃ for ∞

(4) And cutting and recovering the PCR amplification product in the second round, quantifying, sequencing and analyzing data.

FIG. 6 shows that the HeLa cell group Indel% of the co-transformed CRISPR/Cas9-E7 plasmid and the non-homologous dsODN is significantly higher than the cell group transfected with the equivalent CRISPR/Cas9-E7 plasmid, the cell group transfected with the equivalent CRISPR/Cas9-E7 plasmid and the non-homologous ssODN, wherein the part is due to integration and insertion of ODN.

When the sgRNA is E7-sgRNA1, the Indel% of HeLa cell groups of the co-transformed CRISPR/Cas9-E7 plasmid and the nonhomologous dsODN can reach 40%, and is respectively increased by about 25% compared with a cell group transfected with an equivalent CRISPR/Cas9-E7 plasmid, a cell group transfected with an equivalent CRISPR/Cas9-E7 plasmid and a nonhomologous ssODN, wherein the ODN insertion at the break point accounts for about 66% of the total insertion deletion (Indel); when the sgRNA is E7-sgRNA2, the Indel% of HeLa cell groups of the cotransformed CRISPR/Cas9-E7 plasmid and the nonhomologous dsODN can reach about 65%, and is respectively improved by about 20% compared with the cell groups transfected with the same amount of CRISPR/Cas9-E7 plasmid, the same amount of CRISPR/Cas9-E7 plasmid and the nonhomologous ssODN, wherein the ODN% represents that the ODN insertion at the breakpoint accounts for about 17% of the total insertion deletion (Indel). The CRISPR/Cas9-E7 plasmid cotransformation of non-homologous dsODN can remarkably enhance the efficiency of targeted knockout of human papilloma virus E7 gene.

Example 6 Co-transfected dsODN as marker for monitoring off-target conditions

1) A schematic diagram of the process of GUIDE-Seq library construction is shown in FIG. 7.

2) Preparing a Y-shaped joint:

the Y-type linker was made by annealing Miseq Universal oligonucleotides (Miseq Common Adapter) separately to each sample barcode linker primer (A # # Adapter): wherein, the sequence of Miseq universal oligonucleotide adaptor is P-GATCGGAAGAGC C a ("P" indicates phosphorylation, "" indicates glucosinolate modification), the sequence of sample barcode adaptor primer is:

AATGATACGGCGACCACCGAGATCTACACTAGATCGCNNWNNWNNACACTCTTTCCCTACACGACGCTCTTCCGATC*T

wherein "NNWNNWNN" is a molecular index tag and "-" indicates a thioglycoside modification.

The annealing reaction system for preparing the Y-shaped joint is as follows:

3) preparing a DNA sample:

after 3 days of electrotransfer, cells are harvested, DNA is extracted according to the method for extracting DNA, the concentration of the DNA is determined by using the Qubit, the A260/280 is qualified when the A260/280 is required to be between 1.8 and 2.0, the concentration is more than 20 ng/mu L, and the total amount is more than 1 mu g.

The final volume was 120. mu.L diluted with 1XTE buffer (i.e. 10mm Tris-HCl without EDTA).

The DNA of each sample was fragmented to an average length of 500bp according to the standard protocol of the Covaris S2 instrument.

4) Purification of disrupted DNA samples:

and (4) taking the purified magnetic beads to room temperature in advance, shaking, uniformly mixing, and incubating at room temperature for 30min for later use.

The disrupted sample was transferred to a 1.5mL dedicated purified EP tube, and 120. mu.L of magnetic beads was added.

Gently sucking and stirring uniformly for 6 times, standing at room temperature for incubation for 10min, and placing the PCR tube on a magnetic frame for 3min to clarify the solution.

The supernatant was removed, the PCR tube was placed on a magnetic stand, 200. mu.L of a freshly prepared 80% ethanol solution was added to the PCR tube, and the tube was allowed to stand for 30 seconds.

The supernatant was removed, 200. mu.L of 80% ethanol solution was again added to the PCR tube, and the supernatant was completely removed after standing for 30 seconds.

Standing at room temperature for 5min to completely volatilize residual ethanol.

Add 20. mu.L of 1XTE buffer, gently pipette the resuspended beads, remove the magnetic frame, and let stand at room temperature for 2 min.

The PCR tube was placed on a magnetic stand for 2min to clarify the solution.

Carefully pipette 15. mu.L of the supernatant (after bead elution, the supernatant is not pipetted), transfer to a new PCR tube, and label the sample for the next reaction.

5) Tip repair

In a 200 μ L PCR tube, the following (per reaction) was added, in the reaction system:

6) adding A tail and connecting

In the reaction tube completed in the previous step, the following (each reaction) was added, the reaction system being:

7) purification of the product after addition of the A tail

Mixing PEG/NaCl

Solution is taken out in advance and then is returned to the room temperature.

0.9 XPEG/NaCl (i.e., 22.95. mu.L) was added to each sample

After Solution, the mixture is fully mixed, transferred into a low adsorption tube of 1.5mL, incubated at room temperature for 15min, and then purified according to the conventional purification steps.

After elution with 12. mu.L of 1XTE buffer, each magnetic bead sample was transferred to a labeled PCR vial.

8) First round PCR and purification

In a 200 μ L reaction tube, the following (per reaction) was added in the reaction system:

the corresponding primers were used as follows:

the primer sequence of P5-1 is: aatgatacggcgaccaccgagatcta (SEQ ID NO.11) from Kingwizhi, Suzhou.

GSP1 Primer: the primer is formed by mixing GSP1(+) and GSP1(-), wherein the sequence of the GSP1(+) primer is as follows: ggatctcgacgctctccctgtttaattgagttgtcatatgttaataac (SEQ ID NO. 12); the sequence of the GSP1(-) primer is: ggatctcgacgctctccctataccgttattaacatatgaca (SEQ ID NO. 13).

Magnetic bead purification for first round PCR:

mixing PEG/NaCl

Solution is taken out in advance and then is returned to the room temperature.

To each sample was added 1.2X (i.e., 36. mu.L) PEG/NaCl

After Solution, the mixture is fully and uniformly mixed, transferred into a low adsorption tube of 1.5mL, kept stand and incubated at room temperature for 15min, and then purified according to the conventional purification steps.

mu.L of 1XTE buffer was added to each magnetic bead sample for elution.

Second round PCR and purification

The corresponding primers were used as follows:

the primer sequence of P5-2 is: aatgatacggcgaccaccgagatctacac (SEQ ID NO.14), manufactured by Jinweizhi, Suzhou.

Sequence of GSP2 Primer: the primer is formed by mixing GSP2(+) and GSP2(-), wherein the sequence of the GSP2(+) primer is as follows: cctctctatgggcagtcggtgatacatatgacaactcaattaaac (SEQ ID NO. 15); the sequence of the GSP2(-) primer is: cctctctatgggcagtcggtgatttgagttgtcatatgttaataacggta (SEQ ID NO. 16).

The sequence of the P7- # primer is: caagcagaagacggcatacgagat(nnnnnnnn)

gtgactggagtcctctctatgggcagtcggtga, wherein "nnnnnnnn" is an 8bp barcode sequence used to distinguish samples.

In a 200 μ L reaction tube, the following (per reaction) was added in the reaction system:

magnetic bead purification step of second round PCR:

mixing PEG/NaCl

Solution is taken out in advance and then is returned to the room temperature.

0.7 XPEG/NaCl (i.e., 21. mu.L) was added to each sample

After Solution, the mixture is fully and uniformly mixed, transferred into a low adsorption tube of 1.5mL, kept stand and incubated at room temperature for 15min, and then purified according to the conventional purification steps.

mu.L of 1XTE buffer was added to each magnetic bead sample for elution.

And (3) quantifying the sample subjected to the second round of PCR purification by using a qubit, checking the purity of the library DNA according to A260/280, and determining that the sample is qualified between 1.8 and 2.0. For subsequent high-throughput sequencing.

10) And (3) machine sequencing:

qPCR library quantification: each sub-library was diluted to 4nM and then mixed in equal volumes to pool.

Library equilibration: library equilibration with 25% library ratio phix: first dilute the phix to 4nM (10 nM original concentration), then compare the phix library (4nM) in volume: pool library ═ 1: 3 mixing to obtain 25% phix posing library. Specifically, 0.8. mu.L stock solution (i.e., 8nM) of phix is added to 1.2. mu.L of water, and 2. mu.L total phix. phix library (4 nM): pooling library 2 μ L: 6 μ L, total 8 μ L volume.

Library denaturation: mu.L of the sample was removed from 8. mu.L of the previous step and denatured by mixing with 5. mu.L of 0.2M NaOH for 5min (this time at a library concentration of 2 nM).

Dilution of the library: the library in the last step needs to be diluted to 1.2pM final concentration before being loaded on the computer so as to obtain better loading data quality. The dilution method comprises the following steps: mu.L of the denatured library obtained in the above step was mixed with 990. mu.L of HT1 buffer by shaking (the library concentration was 20 pM). Then 90. mu.L of the supernatant was mixed with 1410. mu.L of HT1 buffer with shaking to obtain a final concentration of 1.2pM of the on-machine library.

The reagent (square plate) stored at-20 ℃ is thawed for 1-2 hours in advance, and then small bubbles at the bottom are removed by beating. And. Flowcell was equilibrated to room temperature from 4 ℃ in advance and allowed to dry clean.

And (3) computer primer dilution: the primers were diluted to a concentration of 0.3. mu.M on the machine.

Selecting a Nextseq Mid kit and a Paired End double-ended sequencing program, and performing on-machine sequencing according to the instruction steps of a sequencer.

11) And (3) data analysis:

processing and integration of sequence reads: the sequences identical in the first 6 bases and the sequence of the molecular index tag having the same 8 bases in the sequenced sequences were integrated and identified as being from the same pre-pcr sample. The integrated sequences were aligned to a human genome reference sequence (GrCh38) using the BWA-MEM software program.

Analyzing and judging the off-target site: preserving and displaying the initial matching position of reads with the comparison quality of more than or equal to 50, and grouping comparison areas by adopting a sliding comparison window of 10 bp. Reads comprising the integrated dsODN sequence are analyzed and called SNPs and indices at these locations with the dsODN sequence using computer analysis tools based on the molecular index and SAMtools of the bin-consensus mutation calling algorithm and then aligned to non-target sequences of the reference genome to determine the specific reference coordinates at which the dsODN sequence is integrated on the cellular genome and thus to determine whether it is at a target or off-target site.

Co-electrotransferred dsODN donor monitors the on-target and off-target conditions of the CRISPR-Cas9 system at the HPV18E7 target point. FIG. 8 shows that 36505 reads can be detected at the target site and 1 off-target site can be detected when targeting cleavage of the HPV18E7 gene using single E7-sgRNA 1. When single E7-sgRNA2 was used for targeted cleavage of the HPV18E7 gene, 75596 reads could be detected at the target site and 2 off-target sites could be detected.

The above embodiments are merely illustrative of the technical ideas and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the contents of the present invention and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes and modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.

Sequence listing

<110> Zhuhaishutong medical science and technology Limited

<120> application of non-homologous double-stranded oligonucleotide fragment in gene knockout system

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 96

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 1

cgagcaatta agcgactcag gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 2

<211> 96

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 2

tcgtgacata gaaggtcaac gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 3

<211> 96

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 3

agagccccaa aatgaaattc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 4

<211> 96

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 4

cattgtgtga cgttgtggtt gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 5

<211> 96

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 5

acgttgtggt tcggctcgtc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 6

<211> 34

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 6

gtttaattga gttgtcatat gttaataacg gtat 34

<210> 7

<211> 26

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 7

ttgagttgtc atatgttaat aacggt 26

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 8

gttgcttact gctgggatgc 20

<210> 9

<211> 53

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 9

acactctttc cctacacgac gctcttccga tcttgcatgg acctaaggca aca 53

<210> 10

<211> 55

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 10

gtgactggag ttcagacgtg tgctcttccg atctgctcaa ttctggcttc acact 55

<210> 11

<211> 26

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 11

aatgatacgg cgaccaccga gatcta 26

<210> 12

<211> 48

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 12

ggatctcgac gctctccctg tttaattgag ttgtcatatg ttaataac 48

<210> 13

<211> 41

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 13

ggatctcgac gctctcccta taccgttatt aacatatgac a 41

<210> 14

<211> 29

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 14

aatgatacgg cgaccaccga gatctacac 29

<210> 15

<211> 45

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 15

cctctctatg ggcagtcggt gatacatatg acaactcaat taaac 45

<210> 16

<211> 50

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 16

cctctctatg ggcagtcggt gatttgagtt gtcatatgtt aataacggta 50

Claims (2)

1. The application of the nonhomologous double-stranded oligonucleotide fragment in improving the cutting efficiency of the CRISPR/Cas9 system on a target gene is characterized in that: the CRISPR/Cas9 system and the non-homologous double-stranded oligonucleotide fragment are co-transfected into cells in vitro, the non-homologous double-stranded oligonucleotide fragment consists of a sequence shown in SEQ ID NO.6 and a sequence which is in reverse complete complementary pairing with the sequence, the 5 ' end of the non-homologous double-stranded oligonucleotide fragment is subjected to phosphorylation modification, two nucleotides connected among three nucleotides at the 5 ' end are subjected to glucosinolate modification, and two nucleotides connected among three nucleotides at the 3 ' end are subjected to glucosinolate modification.

2. Use according to claim 1, characterized in that: the CRISPR/Cas9 system and the nonhomologous double-stranded oligonucleotide fragment knock out the human papillomavirus 18 type E7 gene, and the sequence of sgRNA of the CRISPR/Cas9 system is shown as SEQ ID No.1 or SEQ ID No. 2.

Images