CN111893170A

CN111893170A - Method for detecting CRISPR-Cas off-target effect in whole genome range in vitro

Info

Publication number: CN111893170A
Application number: CN202010788603.8A
Authority: CN
Inventors: 谢红娴; 兰凯; 程欢; 黄龙
Original assignee: Zhuhai Shutong Medical Technology Co ltd
Current assignee: Zhuhai Shutong Medical Technology Co ltd
Priority date: 2020-08-07
Filing date: 2020-08-07
Publication date: 2020-11-06
Anticipated expiration: 2040-08-07
Also published as: CN111893170B

Abstract

The invention discloses a method for detecting CRISPR-Cas off-target effect in vitro in a whole genome range, and relates to a method for detecting CRISPR-Cas off-target effect in vitro in a whole genome range. The invention aims to solve the problems of false positive sites and large initial DNA adding amount in the existing off-target site detection, the invention randomly breaks genome DNA, then connects a stem-loop joint 1, uses exonuclease to digest linear DNA of the single-side joint 1 and the unconnected joint, and seals the rest DNA segment by ddNTP. Cutting DNA by using Cas enzyme, exposing new broken ends of the DNA and connecting the new broken ends with a linear joint 2, capturing the DNA of the connecting joint 2 by using streptavidin magnetic beads, and constructing an NGS library by using nested PCR (polymerase chain reaction) to carry out illumina double-end sequencing and bioinformatics analysis. The method has high detection rate of true positive off-target sites. The invention is applied to the field of biotechnology.

Description

Method for detecting CRISPR-Cas off-target effect in whole genome range in vitro

Technical Field

The invention relates to a method for detecting CRISPR-Cas off-target effect in a whole genome range in vitro.

Background

The CRISPR-Cas system is derived from acquired immune systems of bacteria and archaea, and becomes a powerful gene editing tool due to simple and efficient operation. The system forms an RNP (ribonucleic acid) compound by sgRNA and Cas protein, recognizes and combines target DNA through sequence specificity interaction of two regions of protospacer and PAM (the protospacer adjacent motif) under the guidance of the sgRNA, and realizes site-directed editing of the DNA by targeting shearing the target DNA by Cas nuclease. The Protospace region is complementarily paired with a 20nt space region at the 5' end of the sgRNA through target DNA and is combined; recognition of PAM is achieved by direct interaction of the C-terminal amino acid residue of Cas protein with the target DNA. Base mismatch recognition of Cas proteins to protospacer and PAM results in off-target effects of CRISPR-Cas systems, i.e., cleavage of DNA sequences in non-target regions similar to the targeted sequence.

The CRISPR-Cas system functions by relying on the generation of DNA double-strand breaks (DSBs). Cellular repair of DSBs may introduce insertion or deletion mutations (indels), and even a wider range of chromosomal rearrangements. Therefore, it is essential to detect the off-target sites of CRISPR-Cas system and their mutation frequency in genome-wide range, especially if the CRISPR-Cas system is widely used in biotechnological applications. For example, gene editing has been used in the treatment of human disease, and complete off-target site analysis can help avoid the use of sgrnas that may cause adverse clinical outcomes.

A plurality of existing experimental techniques are used for off-target site detection in the whole genome range, and can be roughly divided into two types: 1. the off-target detection method based on the cell transfection technology comprises GUIDE-seq, BLESS, HTGTS, DISCOVER-seq and the like; 2. independent of cell technology, in vitro detection methods, including digomer-seq, SITE-seq and CIRCLE-seq. Each technique has its limitations.

In vivo off-target detection methods based on cell transfection techniques lack operability for cell lines that are not easily transfected. Both GUIDE-seq dependent integration of the donor sequence dsODN into the genome and HTGTS dependent chromosomal translocation, both influenced by factors such as cell line DNA repair specificity and timeliness, target site specificity, cell cycle, etc., while off-target sites with less than 0.1% mutation frequency were missed because dsODN was not integrated or chromosomal translocation did not occur at the cleavage site. The DISCOVER-Seq detects the enrichment of a DSB repair factor MRE11 generated after the Cas enzyme is cut at a cutting site by using a ChIP-Seq method, thereby obtaining cutting site information. However, since the Cas enzymes do not cleave different sites at the same time, but have time sequence, the difference of MRE11 factor enrichment at the same time point makes the detection result not truly reflect all cleavage sites. In addition, since a plurality of DSBs generated by non-Cas enzyme cleavage exist in the cells, the DSBs become false positive sites for detection.

Methods for detecting off-target in vitro have potential advantages over in vivo off-target detection methods. The purified component reagent is used for in vitro experiments, so that the repeatability of detection is improved, and the influence of cell transfection efficiency and cell repair on detection is avoided. In addition, the concentration of sgRNA and Cas enzyme can be greatly improved in an in vitro experiment, and the detection of low-frequency mutation sites is facilitated. At present, there are 3 methods for in vitro whole genome-wide off-target detection, the earliest Digenome-seq detection scheme is that a Cas enzyme exonucleolytic cleaves a target DNA, all free cut ends (no matter whether DSB generated by Cas enzyme cleavage) are subjected to linker treatment, and on-target and off-target sites generated by Cas enzyme cleavage are analyzed after high-throughput whole genome sequencing. The method needs a very high sequencing depth, has a large amount of random background signals generated by non-Cas enzyme cutting, lacks sensitivity for comprehensively detecting all off-target sites including low-frequency sites, and is not suitable for screening sgRNAs in large batches. The subsequent SITE-seq detection scheme is to eliminate DSB generated by non-Cas enzyme cutting as much as possible, adopt high molecular weight genome DNA as a Cas enzyme cutting substrate, carry out biotin labeling, enrichment, sequencing and comparison on the cut genome DNA to obtain comprehensive cutting SITE information. The sequencing depth required by the method is obviously reduced compared with that of digomer-seq, but the method has the defects that high molecular weight genome DNA can only come from fresh tissues and cells, the extraction is difficult, the integrity of the DNA is difficult to ensure, a large amount of DSB can be generated in the process of extracting the DNA, and finally the false positive rate of an analysis result is high. CIRCLE-seq detection protocol, which occurs contemporaneously with SITE-seq, removes background DSB by circularizing DNA as a substrate for cleavage by Cas enzymes. The method comprises the steps of connecting broken genome DNA with a special hairpin-like joint, then carrying out enzyme digestion on a stem-loop structure, then connecting the head and the tail of the DNA into a loop by using DNA ligase, then externally cutting the loop DNA by using a Cas enzyme, and forming a sequencing-capable library for sequencing comparison after the linearized DNA is connected with a sequencing joint. The off-target detection scheme has the defects that the cyclization efficiency is low, so the initial input amount of genome DNA required by library construction is large (25ug), the application of the detection method in the detection of primary cells which are difficult to culture and precious clinical specimens is greatly limited, and on the other hand, the DNA which cannot be cyclized cannot be completely removed, so that false positive sites exist in the analysis result.

Disclosure of Invention

The invention aims to solve the problems of false positive sites and large initial DNA addition amount in the existing detection of the off-target sites, and provides a method for detecting CRISPR-Cas off-target effect in vitro in a whole genome range.

The invention relates to a method for detecting CRISPR-Cas off-target effect in vitro in a whole genome range, which comprises the following steps: first, collect 4-8 x 10⁶Putting the individual cells into a centrifuge tube, centrifuging, removing the culture medium, washing once by PBS, centrifuging again, removing the PBS, and extracting the cell genome DNA of the centrifuged solid phase substance; secondly, breaking the genomic DNA extracted in the first step into 500bp fragments, purifying the fragments, and purifying by using DNA purification magnetic beads; thirdly, carrying out end repairing, tail adding and stem-loop structure joint 1 adding on the purified DNA in the second step, then adopting exonuclease treatment, and then using ddNTP treatment; fourthly, carrying out in-vitro cutting on the DNA obtained in the third step by adopting Cas enzyme; fifthly, carrying out end repairing, tail adding A and linear joint 2 on the DNA cut in vitro, wherein the 5' end of the linear joint 2 is modified by biotin; sixthly, uniformly mixing the streptavidin magnetic beads, adding 1 xBind and wash buffer, rotating, uniformly mixing and washing at room temperature, centrifuging, removing supernatant, repeatedly washing, centrifuging and removing the supernatant for 3 times, resuspending the streptavidin magnetic beads by using 2 xBind and wash buffer, adding the DNA treated in the fifth step, rotating and uniformly mixing at room temperature, placing in a magnetic frame, and removing the supernatant to obtain DNA adsorbed by the streptavidin magnetic beads; seventhly, treating DNA adsorbed by streptavidin magnetic beads by using USER enzyme, cutting a stem-loop structure of the joint 1, and then recovering the DNA treated by the USER enzyme as a template for PCR amplificationThen, index PCR is carried out to obtain a library to be operated, and library quality inspection and sequencing are further carried out; the nucleotide sequence of the stem-loop structure joint 1 is shown in a sequence table Seq ID No: 1 is shown in the specification; the Forward sequence of the linear joint 2 is shown in a sequence table Seq ID No: 2, the Reverse sequence of the linear joint 2 is shown in a sequence table Seq ID No: 3, respectively.

The invention has the beneficial effects that:

compared with the off-target detection method based on the cell transfection technology, the method is not influenced by factors such as cell line DNA repair specificity, timeliness, target site specificity, cell cycle and the like, and still has operability for the cell line which is difficult to transfect.

Compared with the SITE-seq method, the method simplifies the genome extraction scheme and does not need fussy long-fragment DNA extraction; the initial DNA input of the AID-seq scheme is only 1/5 of CIRCLE-seq method, and the method is applicable to detection of primary cells and precious clinical specimens which are difficult to culture.

The invention removes DSB possibly existing in a Cas enzyme in-vitro cleavage substrate as far as possible through three steps of stem-loop joint connection, exonuclease digestion and ddNTP sealing, effectively reduces false positive sites in a sequencing result, and improves the specificity of off-target detection.

The invention uses streptavidin magnetic beads to capture biotin modification of the joint 2, separates DNA of the joint 2 after the Cas enzyme is cut from uncut background DNA which is not connected with the joint 2 and can not be sequenced, effectively reduces the ratio of useless data, and improves the sensitivity of off-target detection. The verification proves that the method has high detection rate of the true positive off-target sites.

Drawings

FIG. 1 is the agarose gel electrophoresis of the HEK293 genomic DNA of example 1, M: marker;

FIG. 2 is a graph showing the distribution of fragments of the Qsep apparatus in example 1;

FIG. 3 is a diagram showing the detection of off-target SITEs of SITE1sgRNA in human HEK293 cells by AID-seq method in example 1;

FIG. 4 is a Venn diagram of off-target SITEs in human HEK293 cells SITE1sgRNA in example 1.

Detailed Description

The first embodiment is as follows: the embodiment is a method for detecting CRISPR-Cas off-target effect in whole genome range in vitro, which comprises the following steps: first, collect 4-8 x 10⁶Putting the individual cells into a centrifuge tube, centrifuging, removing the culture medium, washing once by PBS, centrifuging again, removing the PBS, and extracting the cell genome DNA of the centrifuged solid phase substance; secondly, breaking the genomic DNA extracted in the first step into 500bp fragments, purifying the fragments, and purifying by using DNA purification magnetic beads; thirdly, carrying out end repairing, tail adding and stem-loop structure joint 1 adding on the purified DNA in the second step, then adopting exonuclease treatment, and then using ddNTP treatment; fourthly, carrying out in-vitro cutting on the DNA obtained in the third step by adopting Cas enzyme; fifthly, carrying out end repairing, tail adding A and linear joint 2 on the DNA cut in vitro, wherein the 5' end of the linear joint 2 is modified by biotin; sixthly, uniformly mixing the streptavidin magnetic beads, adding 1 xBindand wash buffer, rotating, uniformly mixing and washing at room temperature, centrifuging, removing supernatant, repeatedly washing, centrifuging and removing the supernatant for 3 times, resuspending the streptavidin magnetic beads by using 2 xBind and wash buffer, adding the DNA treated in the fifth step, rotating and uniformly mixing at room temperature, placing in a magnetic frame, and removing the supernatant to obtain DNA adsorbed by the streptavidin magnetic beads; seventhly, treating DNA adsorbed by streptavidin magnetic beads by using USER enzyme, cutting a stem-loop structure of the joint 1, performing recovery PCR amplification by using the DNA treated by the USER enzyme as a template, performing index PCR to obtain a library to be operated, and further performing library quality inspection and sequencing; the nucleotide sequence of the stem-loop structure joint 1 is shown in a sequence table Seq ID No: 1 is shown in the specification; the Forward sequence of the linear joint 2 is shown in a sequence table Seq ID No: 2, the Reverse sequence of the linear joint 2 is shown in a sequence table Seq ID No: 3, respectively.

In the first step of the embodiment, the Nanodrop is adopted to measure the DNA concentration to be more than 50 ng/. mu.l.

The synthesis method of the stem-loop structure joint 1 and the linear joint 2 of the embodiment comprises the following steps: stem-loop structure linker 1 sequence: (5 Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTAATTGAGTTGTCUATATGTTAATAACGGTATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC T)

Linear linker 2Forward sequence:

/5Biotin/GTTGACATGCTGGATTGAGACTTCCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T

linear linker 2Reverse sequence:

GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGAAGTCTCAATCCAGCATGTCAAC

5 Phos/represents a 5' phosphorylation modification; represents 3' end glucosinolate phosphate ester bond modification; /5 Biotin/represents a 5' biotinylation modification. The product is synthesized by Suzhou Jinzhi Biotechnology GmbH and purified by HPLC.

Annealing the stem-loop structure joint 1 and the linear joint 2 according to the following reaction system:

and (3) annealing procedure: 5min at 95 ℃; -1 ℃/min × 70 cycles;

40uM linker 1 and 5uM linker 2 were prepared for use and stored at-20 ℃.

The method is processed by three steps of stem-loop joint connection, exonuclease digestion and ddNTP sealing, so that DSB possibly existing in a Cas enzyme in-vitro cleavage substrate is removed as far as possible, false positive sites in a sequencing result are effectively reduced, and the specificity of off-target detection is improved.

In the embodiment, streptavidin magnetic beads are used for capturing biotin modification of the joint 2, and DNA of the joint 2 after cutting by the Cas enzyme is separated from uncut background DNA, which is not connected with the joint 2 and can not be sequenced, so that the ratio of useless data is effectively reduced, and the sensitivity of off-target detection is improved. The verification proves that the method has high detection rate of the true positive off-target sites.

The second embodiment is as follows: the first difference between the present embodiment and the specific embodiment is: step two, DNA breaking is carried out by using an instrument Bioruptor, and parameters are as follows: DNA 50 ng/uL; volume 100 uL; 15sON-90 sOFF; 6-8 times of circulation; the cleaved DNA was purified using DNA purification beads, and the volume of the eluted DNA was 37 uL. The rest is the same as the first embodiment.

In this embodiment, the DNA concentration >27ng/uL is measured using Qubit.

The third concrete implementation mode: the present embodiment differs from the first or second embodiment in that: in the third step, a DNA library building kit is adopted to carry out DNA end repair, A tail addition and stem ring structure joint 1, wherein the specific reaction system and reaction program of the DNA end repair and the A tail addition are as follows:

reaction procedure: 30min at 20 ℃; obtaining a terminal repairing mixture at 65 ℃ for 30 min;

the specific reaction system and reaction procedure of the stem-loop structure-added joint 1 are as follows:

reaction procedure: after 1h at 22 ℃ the beads were purified 1 XDNA purification, eluting at a volume of 30 uL. The others are the same as in the first or second embodiment.

The DNA library construction kit of the embodiment is an ABClonal rapid DNA library construction kit.

The fourth concrete implementation mode: the difference between this embodiment mode and one of the first to third embodiment modes is: the reaction system and procedure of exonuclease digestion in step three are as follows:

reaction procedure: 2h at 37 ℃; after 10min at 75 ℃ the column was purified with 1 XDNA purification beads, eluting at a volume of 44 uL. The rest is the same as one of the first to third embodiments.

In the present embodiment, 10 × Exonuclease I Buffer, Lambda Exonuclease, Exonuclease I, and Exonuclease III were purchased from NEB.

The fifth concrete implementation mode: the difference between this embodiment and one of the first to fourth embodiments is: reaction system and procedure for ddNTP treatment:

reaction procedure: at 75 ℃ for 30 min; then using 1 x DNA purification magnetic beads purification, elution volume 25uL, the Qubit measurement of DNA concentration >6.4 ng/uL. The rest is the same as one of the first to fourth embodiments.

In this embodiment, 10X Thermopolybuffer and Therminator DNA polymerase were purchased from NEB, and ddATP was purchased from Roche.

The sixth specific implementation mode: the difference between this embodiment and one of the first to fifth embodiments is: the reaction system and procedure for step four Cas enzyme in vitro cleavage are as follows:

reaction procedure: binding for 10min at room temperature, then adding 250ng of DNA treated in the third step, supplementing the volume to 50uL with enzyme-free water, incubating for 1h at 37 ℃, purifying with 50uLDNA purified magnetic beads, and eluting the volume to 37 uL. The rest is the same as one of the first to fifth embodiments.

In this embodiment, 10 × Cas9 nuclear Reaction Buffer, Cas9 nuclear, and s. The method for in vitro transcription of grnas is: the DNA sequence of the transcription template was synthesized, followed by in vitro transcription of SITE1sgRNA using NEB-EnGensgRNA Synthesis Kit as specified, and purification of SITE1sgRNA using Monarch RNA Cleanup Kit as specified, in an elution volume of 20 uL.

The seventh embodiment: the difference between this embodiment and one of the first to sixth embodiments is: fifthly, adopting a DNA library building kit to carry out DNA end repair, tail adding A and linear joint adding 2; the specific reaction system and reaction program for DNA end repair and A tail addition are as follows:

reaction procedure: reacting at 20 ℃ for 30 min; reacting at 65 ℃ for 30min to obtain a terminal repairing mixture;

the specific reaction system and reaction procedure for adding the linear linker 2 are as follows:

reaction procedure: reaction at 22 ℃ for 1h, followed by purification with 1 XDNA purification beads, elution volume 41 uL. The rest is the same as one of the first to sixth embodiments.

The specific implementation mode is eight: the present embodiment differs from one of the first to seventh embodiments in that: adding the USER enzyme into the DNA obtained in the step five, reacting for 30min at 37 ℃, then placing the DNA in a magnetic frame for 2min, removing the supernatant, adding 10mM Tris-HCl, rotating, uniformly mixing and washing at room temperature for 5min, placing the DNA in the magnetic frame for 2min, removing the supernatant, and washing for 2 times by using 10mM Tris-HCl in total; then 20uL of 10mM Tris-HCl was added for resuspension. The rest is the same as one of the first to seventh embodiments.

The specific implementation method nine: the present embodiment differs from the first to eighth embodiments in that: the recovery PCR reaction system and the reaction procedure in the seventh step are as follows.

Reaction procedure: 45s at 98 ℃; 12cycles of (98 ℃ 15s,61 ℃ 30s,72 ℃ 2min),72 ℃ 2min,4 ℃ hold, then place on magnetic rack for 2min, transfer supernatant to new Ep tube, take 3uL supernatant and add water to dilute 50 times for use. The rest is the same as the first to eighth embodiments.

This embodiment KAPA HiFi Hot Start Ready Mix (2x) is purchased from Roche.

The detailed implementation mode is ten: the present embodiment differs from one of the first to ninth embodiments in that: indexing the reaction system and procedure of PCR in step seven:

reaction procedure: 45s at 98 ℃; 12cycles of (98 ℃ 15s,60 ℃ 30s,72 ℃ 2min),72 ℃ 2min,4 ℃ hold, 0.7 XDNA purification magnetic bead purification, elution volume of 50uL, 0.6X-0.2 XDNA purification magnetic bead double-ended screening, elution volume of 20uL, get 200-. The rest is the same as one of the first to ninth embodiments.

This embodiment KAPA HiFi Hot Start Ready Mix (2x) is purchased from Roche.

The following experiments were performed to verify the beneficial effects of the present invention:

example (b): human HEK293 cell CRISPR/Cas9 gene editing SITE1sgRNA off-target SITE detection

Target point sequencePAM：GGGAAAGACCCAGCATCCGT+GGG

The implementation process comprises the following steps:

1. synthesizing a linker 1 sequence 5OD, a linker 2Forward sequence and a Reverse sequence 1OD respectively, dissolving the linker 1 sequence and the Reverse sequence by using 10mM Tris-HCl until the concentration is 100uM, configuring the following system in a 200uLPCR tube, and annealing at 95 ℃ for 5 min; circulating at minus 1 ℃/min multiplied by 70, preparing 40uM joint 1 and 5uM joint 2for standby, and subpackaging and storing at minus 20 ℃.

2. 5X ^6 HEK293 cells are collected to extract cell genome DNA, and the Nanodrop measured DNA concentration is 192 ng/mu L, and the mass is 9.6 ug.

3. 5ug HEK293 genomic DNA was taken, and the volume was filled up to 100uL with 10mM Tris-HCl, Bioruptor parameter 15sON-90 sOFF; 8cycles, break HEK293 DNA into 500bp fragments and purify with 100uLDNA purification beads, elution volume 37uL, Qubit measurement DNA concentration 82 ng/. mu.L, quality 3.034 ug. The DNA fragment distribution is shown in FIG. 1, and agarose gel electrophoresis shows that HEK293 genomic DNA is broken to 500 bp. M: marker; HEK293 genome: HEK293 genomic DNA; HEK293500 bp: the Bioruptor disruptor treated the post-treatment DNA.

4. And (3) carrying out DNA end repair, A tail addition, stem-loop structure joint 1 addition and purification on all the broken DNA, wherein a specific reaction system and a specific reaction program are as follows.

HEK293 DNA(3.034ug)	37uL
		EndPrep Buffer	10uL
EndPrepEnzymes	3uL
		Total volume	50uL

Reaction procedure: 30min at 20 ℃; 30min at 65 ℃;

the above-described end repair mix	50uL
		LigaseMM	16.5uL
Joint 1(40 μ M)	7.5uL
		LigaseMix	3uL
Total volume	77uL

Reaction procedure: 1h at 22 ℃;

purifying by 77uLDNA purification magnetic beads, eluting with 30uL volume, and measuring DNA concentration by Qubit to be 106 ng/. mu.L and quality to be 3.18 ug.

5. The DNA was divided into 4 portions of 7.5uL and 795ng, and the volume was filled up to 34uL with 10mM Tris-HCl, and the following reaction system was prepared to perform exonuclease treatment in 4 reactions.

Reaction procedure: 2h at 37 ℃; at 75 ℃ for 10min, each reaction was purified with 50uL of DNA purification beads, eluting at a volume of 44 uL.

6. The following reaction system was arranged, and ddNTP treatment was carried out for 4 reactions.

10×Thermopolbuffer	5uL
		ddATP(10mM)	0.5uL
Therminator DNA polymerase	0.5uL
		DNA obtained in step 5	44uL
Total volume	50uL

Reaction procedure: 30min at 75 ℃; each reaction was purified with 50uLDNA purified magnetic beads, eluting at a volume of 10 uL. After purification, the Qubit measured DNA concentration of 6.75 ng/. mu.L, total mass of 270 ng.

7. 5'-TTCTAATACGACTCACTATAGGGGAAAGACCCAGCATCCGTGTTTTAGAGCTAGA-3' was synthesized, 10mM Tris-HCl was dissolved to a concentration of 1uM, SITE1sgRNA was transcribed in vitro using NEB-EnGensgRNA Synthesis Kit as described, SITE1sgRNA was purified using Monarch RNAcleanup Kit as described, elution volume was 20uL, and the concentration of Qubit was 790ng/uL, i.e., 24.56uM, 1uLSITE 1sgRNA was taken and diluted to 3uM with 10mM Tris-HCl 7.19 uL. The following Cas enzymatic exocleavage reaction system was configured.

Reaction procedure: bonding at room temperature for 10min

Add step 6DNA 250ng, make up volume to 50uL with enzyme free water, incubate 1h at 37 ℃ and then purify with 50uLDNA purified magnetic beads, elute volume 37 uL.

8. DNA end repair, A tail addition, linear joint 2 addition and purification. The specific reaction system and reaction procedure are as follows.

Step 7 DNA treatment	37uL
		EndPrep Buffer	10uL
EndPrepEnzymes	3uL
		Total volume	50uL

Reaction procedure: 30min at 20 ℃; 30min at 65 DEG C

The above-described end repair mix	50uL
		LigaseMM	16.5uL
Joint 2(5 μ M)	8uL
		LigaseMix	3uL
Total volume	77.5uL

Reaction procedure: after 1h at 22 ℃ the beads were purified using 77.5uLDNA purification, eluting at a volume of 41uL, and left at 4 ℃ until use.

9. And taking out the streptavidin magnetic beads from 4 ℃ and uniformly mixing, rotating, uniformly mixing and washing the streptavidin magnetic beads at room temperature of 1 XB & W buffer for 5min, placing the streptavidin magnetic beads on a magnetic frame for 2min, removing supernatant, washing for 3 times totally, and resuspending the streptavidin magnetic beads by 41uL of 2 XB & W buffer. And (3) adding the DNA obtained in the step (9) into streptavidin magnetic beads, mixing, rotating and uniformly mixing at room temperature for 30min, placing in a magnetic frame for 2min, and removing the supernatant. Rotating at room temperature of 1 XB & Wbuffer, mixing uniformly, washing for 5min, placing on a magnetic frame for 2min, removing supernatant, and washing for 2 times; rotating and mixing 10mM Tris-HCl at room temperature, washing for 5min, placing on a magnetic frame for 2min, removing supernatant, and washing for 1 time. 47uL of 10mM Tris-HCl was resuspended.

10. 3uLUSER enzyme (1U/uL) was added to the DNA in step 9 at 37 ℃ for 30 min. Placing in magnetic frame for 2min, removing supernatant, rotating and mixing with 10mM Tris-HCl at room temperature, washing for 5min, placing in magnetic frame for 2min, removing supernatant, and washing for 2 times. 20uL of 10mM Tris-HCl was resuspended.

11. The RecoveryPCR reaction system and the reaction procedure are as follows.

Reaction procedure: 45s at 98 ℃; 12cycles of (98 ℃ 15s,61 ℃ 30s,72 ℃ 2min),72 ℃ 2min,4 ℃ hold. Placing in magnetic frame for 2min, transferring the supernatant to new Ep tube, and diluting 3uL of supernatant with water 50 times. Wherein the RecoveryPCR primer sequence: forward: GGAGTTCAGACGTGTGCTC

Reverse：GTTGACATGCTGGATTGAGACTTC

The product is synthesized by Suzhou Jinzhi Biotechnology GmbH and purified by HPLC.

12. RecoveryPCR products were diluted and IndexingPCR was performed, and the reaction system and reaction procedure were as follows.

Reaction procedure: 45s at 98 ℃; 12cycles of (98 ℃ 15s,60 ℃ 30s,72 ℃ 2min),72 ℃ 2min,4 ℃ hold

Library purification: purifying with 28uLDNA purified magnetic beads, and eluting with 50uL volume; library fragment size screening: 30uL-10uLDNA purified magnetic beads are subjected to double-end screening, the elution volume is 20uL, and the concentration of the library measured by the Qubit is 9.13 ng/uL. In this example, 10 XExonuclease I Buffer, Lambda Exonuclease, Exonuclease I, Exonuclease III, 10 XThermopolbuffer, Therminator DNA polymerase, 10 XCas 9 Nuclear Reaction Buffer, Cas9 Nuclear, S. ddATP, KAPA HiFi Hot Start Ready Mix (2x) was purchased from Roche.

13. And (4) performing quality inspection and sequencing on the library. The library fragment distribution is shown in FIG. 2. The library sequencing visualization results are shown in figure 3. The results of off-target detection compared to CIRCLE-seq, SITE-seq methods are shown in FIG. 4. As can be seen from FIG. 2, the Qsep apparatus detects the distribution of the library fragments, and the library fragments are concentrated at 492 bp. FIG. 3 uses AID-seq method to detect off-target SITEs of SITE1sgRNA in human HEK293 cells. In the target sequence shown in the top first row, the off-target cleavage site sequence is shown below, and the bases that do not match the target sequence are highlighted in color. AID-seq sequenced reads numbers are shown to the right of each site sequence. FIG. 4 comparison of AID-seq against off-target SITEs in SITE1sgRNA of human HEK293 cells with two other in vitro off-target detection methods. The Venn diagram shows the number of overlapping SITEs captured by the AID-seq, CIRCLE-seq and SITE-seq, and the AID-seq method captures the largest number of off-target SITEs.

Sequence listing

<110> Zhuhaishutong medical science and technology Limited

<120> method for detecting CRISPR-Cas off-target effect in whole genome range in vitro

<160>7

<210>1

<211>103

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of the stem-loop structure linker 1.

<400>2

gatcggaaga gcacacgtct gaactccagt cacgtttaat tgagttgtcu atatgttaat 60

aacggtatgt gactggagtt cagacgtgt gctcttccga tc*t 103

<210>2

<211>59

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of linear linker 2 Forward.

<400>3

gttgacatgc tggattgaga cttcctacac tctttcccta cacgacgctc ttccgatc*t 59

<210>3

<211>58

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of linear linker 2 Reverse.

<400>3

gatcggaaga gcgtcgtgta gggaaagagt gtaggaagtc tcaatccagc atgtcaac 58

<210>4

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of target sequence + PAM.

<400>4

gggaaagacc cagcatccgt +ggg 23

<210>5

<211>55

<212>DNA

<213> Artificial sequence

<220>

<223> sequence A was artificially synthesized.

<400>5

ttctaatacg actcactata ggggaaagac ccagcatccg tgttttagag ctaga 55

<210>6

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of forward primer of RecoveryPCR.

<400>6

ggagttcaga cgtgtgctc 19

<210>7

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> reverse primer nucleotide sequence of RecoveryPCR.

<400>7

gttgacatgc tggattgaga cttc 24

Claims

1. A kind ofMethod for the in vitro detection of CRISPR-Cas off-target effects in whole genome endosomes, characterized in that the method is performed as follows: first, collect 4-8 x 10⁶Putting the individual cells into a centrifuge tube, centrifuging, removing the culture medium, washing once by PBS, centrifuging again, removing the PBS, and extracting the cell genome DNA of the centrifuged solid phase substance; secondly, breaking the genomic DNA extracted in the first step into 500bp fragments, purifying the fragments, and purifying by using DNA purification magnetic beads; thirdly, carrying out end repairing, tail adding and stem-loop structure joint 1 adding on the purified DNA in the second step, then adopting exonuclease treatment, and then using ddNTP treatment; fourthly, carrying out in-vitro cutting on the DNA obtained in the third step by adopting Cas enzyme; fifthly, carrying out end repairing, tail adding A and linear joint 2 on the DNA cut in vitro, wherein the 5' end of the linear joint 2 is modified by biotin; sixthly, uniformly mixing the streptavidin magnetic beads, adding 1 xBind and washbuffer, rotating, uniformly mixing and washing at room temperature, centrifuging, removing supernatant, repeatedly washing, centrifuging and removing the supernatant for 3 times, resuspending the streptavidin magnetic beads by using 2 xBind wash buffer, adding the DNA treated in the fifth step, rotating and uniformly mixing at room temperature, placing in a magnetic frame, and removing the supernatant to obtain DNA adsorbed by the streptavidin magnetic beads; seventhly, treating DNA adsorbed by streptavidin magnetic beads by using USER enzyme, cutting a stem-loop structure of the joint 1, performing recovery PCR amplification by using the DNA treated by the USER enzyme as a template, performing index PCR to obtain a library to be operated, and further performing library quality inspection and sequencing; the nucleotide sequence of the stem-loop structure joint 1 is shown in a sequence table Seq ID No: 1 is shown in the specification; the Forward sequence of the linear joint 2 is shown in a sequence table Seq ID No: 2, the Reverse sequence of the linear joint 2 is shown in a sequence table Seq ID No: 3, respectively.

2. The method for detecting CRISPR-Cas off-target effect in whole genome-wide endosome in vitro according to claim 1, wherein step two is DNA disruption by using instrument Bioruptor, parameters: DNA 50 ng/uL; volume 100 uL; 15sON-90 sOFF; 6-8 times of circulation; the cleaved DNA was purified using DNA purification beads, and the volume of the eluted DNA was 37 uL.

3. The method for detecting CRISPR-Cas off-target effect in whole genome-wide endosome in vitro according to claim 1, characterized in that the kit is used in the third step to perform DNA end repair, A tail addition and stem loop structure linker 1, wherein the specific reaction system and reaction program of DNA end repair and A tail addition are as follows:

the kit comprises: ABClonal rapid DNA library building kit

reaction procedure: after 1h at 22 ℃ the beads were purified 1 XDNA purification, eluting at a volume of 30 uL.

4. The method for detecting CRISPR-Cas off-target effect in whole genome range in vitro according to claim 1, characterized in that the reaction system and procedure of exonuclease digestion in the three steps are as follows:

reaction procedure: 2h at 37 ℃; after 10min at 75 ℃ the column was purified with 1 XDNA purification beads, eluting at a volume of 44 uL.

5. The method for the in vitro detection of CRISPR-Cas off-target effects in whole genome range according to claim 1 characterized by ddNTP treated reaction system and program:

reaction procedure: at 75 ℃ for 30 min; then using 1 x DNA purification magnetic beads purification, elution volume 25uL, the Qubit measurement of DNA concentration >6.4 ng/uL.

6. The method for detecting CRISPR-Cas off-target effect in whole genome-wide endosome in vitro according to claim 1, characterized in that the reaction system and procedure of the step four-Cas enzymatic in vitro cleavage are as follows:

reaction procedure: binding for 10min at room temperature, then adding 250ng of DNA treated in the third step, supplementing the volume to 50uL with enzyme-free water, incubating for 1h at 37 ℃, purifying with 50uLDNA purified magnetic beads, and eluting the volume to 37 uL.

7. The method for detecting CRISPR-Cas off-target effect in whole genome-wide endosome in vitro according to claim 1, characterized in that the DNA end repair, A tail addition and linear linker 2 addition are carried out in the fifth step by using a DNA library building kit; the specific reaction system and reaction program for DNA end repair and A tail addition are as follows:

reaction procedure: reaction at 22 ℃ for 1h, followed by purification with 1 XDNA purification beads, elution volume 41 uL.

8. The method for detecting CRISPR-Cas off-target effect in whole genome range in vitro according to claim 1, wherein the USER enzyme treatment in the sixth step is that the USER enzyme is added into the DNA in the fifth step, the reaction is carried out for 30min at 37 ℃, then the DNA is placed in a magnetic frame for 2min, the supernatant is removed, 10mM Tris-HCl is added, the DNA is rotated, mixed uniformly and washed for 5min at room temperature, the DNA is placed in the magnetic frame for 2min, the supernatant is removed, and the DNA is washed for 2 times by 10mM Tris-HCl; then 20uL of 10mM Tris-HCl was added for resuspension.

9. The method for detecting CRISPR-Cas off-target effect in whole genome in-vitro according to claim 1, which is characterized in that the recovery PCR reaction system and the reaction program are as follows:

reaction procedure: 45s at 98 ℃; 12cycles of (98 ℃ 15s,61 ℃ 30s,72 ℃ 2min),72 ℃ 2min,4 ℃ hold, then place on magnetic rack for 2min, transfer supernatant to new Ep tube, take 3uL supernatant and add water to dilute 50 times for use.

10. The method for the in vitro detection of CRISPR-Cas off-target effects in whole genome-wide endosome according to claim 1, characterized by the reaction system and procedure of index PCR:

reaction procedure: 45s at 98 ℃; 12cycles of (98 ℃ 15s,60 ℃ 30s,72 ℃ 2min),72 ℃ 2min,4 ℃ hold, 0.7 XDNA purification magnetic bead purification, elution volume of 50uL, 0.6X-0.2 XDNA purification magnetic bead double-ended screening, elution volume of 20uL, get 200-.