CN113398251A

CN113398251A - Recombinant human chorionic gonadotropin freeze-dried powder injection and preparation method thereof

Info

Publication number: CN113398251A
Application number: CN202110869934.9A
Authority: CN
Inventors: 夏星辉; 胡锦锦; 王群芳
Original assignee: Ningbo Renjian Pharmaceutical Group Co ltd
Current assignee: Ningbo Renjian Pharmaceutical Group Co ltd
Priority date: 2021-07-30
Filing date: 2021-07-30
Publication date: 2021-09-17
Anticipated expiration: 2041-07-30
Also published as: CN113398251B

Abstract

The application relates to the field of recombinant proteins, in particular to a recombinant human chorionic gonadotropin freeze-dried powder injection and a preparation method thereof. A lyophilized powder for injection is prepared from human chorionic gonadotropin, at least one excipient and at least one pH regulator by lyophilizing. The chorionic gonadotropin freeze-dried powder injection adopts sucrose as a freeze-drying excipient, and is freeze-dried under a proper pH condition, so that the obtained freeze-dried product is full in appearance and good in supporting structure.

Description

Recombinant human chorionic gonadotropin freeze-dried powder injection and preparation method thereof

Technical Field

The application relates to the field of recombinant proteins, in particular to a recombinant human chorionic gonadotropin freeze-dried powder injection and a preparation method thereof.

Background

The research and application of hCG dates back to the thirties of the twentieth century at the earliest. The urine of pregnant women is taken as a raw material and is prepared by methods such as precipitation, ion exchange chromatography and the like. The compound has the advantages of containing more impurities, uncertain sources, infectious disease risks, batch difference, easy generation of anaphylactic reaction and the like, has risks in clinical use, and then researchers focus on preparation and production by utilizing a recombinant technology and gradually replace urine-derived HCG clinically.

Although the rhCG and the u-HCG have basically the same molecular structure and pharmacological pharmacokinetic characteristics, the rhCG has greater advantages in the aspects of purity, titer, safety and the like than the u-HCG. rhCG exists in a culture solution of CHO cells, and various impurities exist in the culture solution, and can be removed by an effective separation and purification method to obtain the recombinant protein with purity, specific activity and safety meeting the pharmacopoeia requirements. The purification methods currently in common use are also a combination of various chromatographic and membrane filtration methods. The related patents were obtained by applied research systems, Inc. (ARS) using C4 silica gel, DEAE sepharose, CM sepharose and C18 reverse phase chromatography, followed by ultrafiltration concentration and removal of small molecule impurities, and finally gel filtration chromatography to remove and dissociate alpha and beta subunits (EP 2001/000665, ZL 01805363.7).

According to the information reported in the literature: recombinant chorionic gonadotrophin serving as marketed medicine

The prescription of the powder injection preparation comprises 285 micrograms of recombinant chorionic gonadotrophin, 30mg of sucrose, 0.98mg of phosphoric acid and sodium hydroxide (used for pH adjustment) in each powder. The pH value of the redissolution is 6.5 to 7.5. In addition, phosphoric acid and sodium hydroxide are used as auxiliary materials in the recombinant chorionic gonadotrophin powder injection preparation on the market to maintain the pH value range by using a buffer system. The fewer adjuvants used in the injection, the fewer ionic species in the solution, and the less potential for unknown risks of the formulation.

Disclosure of Invention

The invention aims to provide a recombinant human chorionic gonadotropin freeze-dried powder injection with good stability and less related substances.

The invention also aims to provide a preparation method of the recombinant human chorionic gonadotropin freeze-dried powder injection.

In order to achieve the purpose of the invention, the invention adopts the following technical scheme: a lyophilized powder for injection is prepared from human chorionic gonadotropin, at least one excipient and at least one pH regulator by lyophilizing.

Further, the excipient is sucrose. Further, the pH regulator is composed of sodium dihydrogen phosphate monohydrate and disodium hydrogen phosphate. Further, the weight percentage of the sodium dihydrogen phosphate monohydrate and the disodium hydrogen phosphate is 1: 1.6. further, the pH regulator controls the pH after the redissolution to be 6.5 to 7.5. Further, the human chorionic gonadotropin is obtained by using recombinant protein rhCG which is fermented and expressed in CHO cells and purifying. Furthermore, manganese chloride is added into the fermentation mixed culture medium expressed by fermentation in CHO cells, and hydrocortisone and sodium pyrophosphate are added into the feed culture medium.

A lyophilized powder for injection of human chorionic gonadotropin is prepared from solution, aseptic filtering, bottling, and lyophilizing by using 2.5-inch filter core made of 0.22 μm polyethersulfone. Furthermore, the preparation process of the human chorionic gonadotropin freeze-dried powder injection is characterized in that when the solution is prepared, 1000ml of the solution comprises 500mg of human chorionic gonadotropin, 1.076mg of monosodium phosphate monohydrate and 1.732mg of disodium phosphate, and water for injection is added to 1000 ml. Further, a preparation process of the human chorionic gonadotropin freeze-dried powder injection, wherein the freeze-drying process parameters are as follows: pre-freezing: the temperature of the plate layer is-40 to-50 ℃; cooling at full speed; the maintaining time is 2-4 hours; first sublimation: the vacuum degree is less than 20Pa, the temperature is raised to minus 25 to minus 32 ℃ within 1 hour, the temperature is kept for 30 to 40 hours, and the vacuum degree is controlled to be 10Pa +/-2 Pa; and (3) carrying out second sublimation: heating to 0 deg.C within 1 hr, maintaining at constant temperature for 5-10 hr, controlling vacuum degree at 20Pa + -2 Pa, heating to 32 deg.C within 1 hr, controlling vacuum degree at 20Pa + -2 Pa, and maintaining at constant temperature for 5-10 hr.

The chorionic gonadotropin freeze-dried powder injection adopts sucrose as a freeze-drying excipient, and is freeze-dried under a proper pH condition, so that the obtained freeze-dried product is full in appearance and good in supporting structure. And a buffer system with the weight percentage of sodium dihydrogen phosphate monohydrate to disodium hydrogen phosphate of 1: 1.6 is adopted, so that ions in the redissolved solution are single and controllable, and the potential risk of unknown impurities in phosphoric acid to products is avoided.

The human chorionic gonadotropin is obtained by CHO cell fermentation, after factors such as fermentation parameters, cells and the like are optimized in the early stage, the applicant tries to improve a fermentation mixed culture medium and a feeding culture medium, researches the influence of various special additives on CHO expression rhCG, and finds that the rhCG expression level can be effectively improved by adding manganese ions, hydrocortisone and sodium pyrophosphate into the culture medium, and the purity of the human chorionic gonadotropin reaches more than 99 percent through a purification process, thereby meeting the requirements of pharmacopoeia.

Drawings

FIG. 1: a preparation process diagram of recombinant protein rhCG expressed in CHO cells is used;

FIG. 2: the relative abundance of each subunit of hCG at day 6 of fermentation culture;

FIG. 3: high performance liquid chromatogram of reference rhCG

FIG. 4: performing high performance liquid chromatogram of the rhCG of the test sample;

FIG. 5: test and sample peptide profiles;

FIG. 6: and (5) a real picture of rhCG freeze-dried powder.

Detailed Description

Example 1: rhCG was produced and purified using CHO cell fermentation.

First, cells, media and other reagents used for fermentation:

the CHO cells used for the fermentation, made by the applicant, were transfected with vectors carrying rhCG alpha, beta subunits into CHO cell K1 strain using Lipofectamine TM2000 Lipofectase transfection reagent, which was subsequently acclimated without serum and had been used for more than 18 months in the applicant's pilot production of rhCG.

Subculture medium: CD CHO AGT 24.3mg/ml, dihydrogen phosphate monohydrate 2.69mg/ml, disodium hydrogen phosphate 4.33mg/ml, L-arginine 550mg/ml, L-asparagine 1300mg/ml, L-aspartic acid 400 mg/ml;

fermentation mixed culture medium: 24.3mg/ml of CD CHO AGT, 9.66mg/ml of CD OPTICHO AGT, 2.69mg/ml of monobasic sodium phosphate monohydrate, 4.33mg/ml of dibasic sodium phosphate, 0.15mg/ml of biotin, 11.5mg/ml of folic acid, 120mg/ml of inositol, 300mg/ml of potassium chloride, 5500mg/ml of glucose, 2100mg/ml of sodium chloride and 30mg/ml of soybean protein hydrolysate;

a supplemented medium: balancd CHO Feee 366 mg/ml, sodium dihydrogen phosphate monohydrate 2.69mg/ml, disodium hydrogen phosphate 4.33mg/ml, L-arginine 2000mg/L, L-aspartic acid 4500mg/L, vitamin C15mg/L, vitamin H5 mg/L folic acid 30mg/L, inositol 400mg/L, vitamin B125 mg/L, potassium chloride 0.0015mg/L, F-68950 mg/L, glucose 18000 mg/L;

HCG ELISA kit: japanese east Cao; MnCl₂: jinan Kai Chuang chemical Co., Ltd; CD CHO AGT: gibco;

CD OPTICHO AGT: gibco; balancd CHO Feee 3: irvine scientific; sodium pyrophosphate: food grade, Shandong Guante bioengineering, Inc.; hydrocortisone: shanghai Michelin Biochemical technology, Inc.; other reagents and instruments including PCR reagents and instruments are all made in the conventional countries.

II, basic fermentation production process: as shown in the cell fermentation process in FIG. 1

Cell recovery:

1) and taking the cell freezing tube, and placing the tube in a water bath kettle at 37 ℃ until the frozen cell suspension is melted.

2) And (3) transferring the frozen cells to a centrifugal tube filled with 6-7 ml of CHO subculture medium, centrifuging at 1000rpm for 5 minutes, and removing the supernatant.

3) Gently blow and beat the conglomerated cells at the bottom in the centrifuge tube by using 10ml of CHO subculture medium sucked in times.

4) Inoculating into 125ml shake flask containing 10ml CHO subculture medium to obtain final volume of about 20ml, and inoculating with cell density of 0.4-1.0 x 10⁶Individual cells/ml. Placing the shake flask in a carbon dioxide incubator at 36.5 + -1 deg.C and 5 + -3% CO₂And 125. + -. 10 rpm.

Passage:

1) and (3) shake flask culture: placing the cell shake flask in a carbon dioxide incubator at 36.5 + -1 deg.C and 5 + -3% CO₂And 125. + -. 10 rpm. Cell counts were performed daily when cell density reached 1.5 x 10⁶When the cell density is above 0.4-1.0 x 10, adding CHO passage culture medium, and adjusting cell density⁶Individual cells/ml.

2) wave culture: when the cell density reaches 1.5 x 10⁶Collecting cell sap in shake flask into sterile bottle, inoculating into cell culture bag via sterile tube connecting machine, and adjusting cell density to 0.4-1.0 × 10⁶Each cell/ml, the cell culture bag was placed on a rocking apparatus at 36.5. + -. 1 ℃ and 20. + -. 5rpm for culture. When the cell density reaches 1.5 x 10⁶When the cell density is above 0.4-1.0 x 10, adding CHO passage culture medium, and adjusting cell density⁶Individual cells/ml.

Fermentation: (100L scale):

cell density 1.5 x 10 in 20L volume cell culture bag⁶When the cell/ml is more than 20L, inoculating to 50L of fermentation mixed culture medium which is pre-cultured overnight, determining the first day on the day of inoculation, and adding 10L of feeding culture medium respectively on the 3 rd, 6 th and 9 th days of culture. Culturing for 12 days until fermentation is finished (culture parameters: 36.5 + -1 deg.C, pH is controlled at 6.8-7.2, dissolved oxygen is controlled at 40-60%)The speed is controlled at 60 +/-5 rpm).

After and during the fermentation, HCG levels were measured using the kit described in example 1, and alpha and beta subunit transcription levels were measured using PCR primers of the prior art (alpha subunit: upstream CTGGTCACATTGTGCTATCTTTC, downstream TGAGGTGACGTTCTTTTGGAC; beta subunit: upstream ATGTTCCAGGGGCTGCTGCTGTT, downstream CGCGGTAGTTATTGCACCACACCACCTGA).

Thirdly, optimization of fermentation process

Through the optimization of factors such as fermentation parameters, cells and the like in the early stage, the expression level of the recombinant protein of about 180mg/L is realized within 12 days by the method. To further increase yield/reduce costs at similar yields, we have further improved the customized media themselves. With reference to the prior art, attempts were made to add MnCl to the culture medium₂(3 mg/ml added to the fermentation mix), hydrocortisone, sodium pyrophosphate, the results are as follows:

TABLE 1 optimization of the effect of manganese ion addition to cell lines and fermentation Medium mixtures on expression levels (mean of three jar samples)

The results of further studies on the transcript level are shown in FIG. 2: we found that the ratio of beta subunit to alpha subunit in the optimized cell line significantly exceeded that of the original cell line, which means that alpha subunit transcriptional expression may be a yield-limiting factor in the optimized cell line, whereas MnCl was added to the fermentation mix₂The transcription level of the alpha subunit can be effectively improved, and the yield is further improved;

TABLE 2 Effect of hydrocortisone and sodium pyrophosphate addition to feed medium on expression levels (optimized cell lines, three pot sample averages)

The addition of hydrocortisone or sodium pyrophosphate into the feed medium alone has no obvious effect on increasing the yield, while the combination of hydrocortisone and sodium pyrophosphate can realize the effect of obviously improving the expression amount of the recombinant protein (the combination of the two in the feed can inhibit the growth of cells and arrest the cell cycle to accumulate the product).

After combining manganese ions, hydrocortisone and sodium pyrophosphate, we achieved a high expression level of 280.22mg/L over a 12 day culture period.

Example 2: rHCG protein purification

As shown in the protein purification process flow in FIG. 1, the whole rhCG purification process comprises cell submerged tank treatment, affinity chromatography, first step ultrafiltration, virus inactivation chromatography, hydrophobic chromatography, second step ultrafiltration, CHT chromatography, virus filtration and sterile filtration. The column diameters for the four-step chromatography were 350mm, 72mm, 72mm and 40mm, respectively, for purification of 100kg of cell sap (based on the actual pot). The height of the CHT chromatographic packing is 15-20 cm. The membranes for 2 times of ultrafiltration are all polyethersulfone ultrafiltration membranes with the density of 10KD, and the specific membrane area is selected according to the actual situation. Both the virus prefilter and virus filter manufacturers are Merck. The specific membrane area is selected according to actual conditions.

1. Fermentation broth treatment

Adding a certain amount of zinc chloride solution after the cell liquid is put into a tank, standing at room temperature for a period of time, centrifuging or deep-layer filtering by using a centrifuge, then top-washing by using a buffer solution with a certain volume, putting the centrifuged solution into a buffer tank with cooling water circulation, and filtering in series by using a polyether sulfone filter element in front and back, wherein the harvested solution is an affinity chromatography sample.

2. Affinity chromatography

Preparation of reagents: 0.1M NaOH solution, 20% ethanol-0.1M KH₂PO₄Solution, affinity equilibrium solution: pH7.5 + -0.2, 20mmol/L Tris +50mmol/L sodium chloride, affinity rinsing liquid pH7.5 + -0.2, 20mmol/L Tris +300mmol/L sodium chloride +5mmol/L LEDTA metal chelating agent, and affinity eluent pH7.5 + -0.2, 20mmol/L Tris +1.5mol/L sodium chloride +0.5mmol/L dithiothreitol +0.5mmol/L beta-mercaptoethanol + 5% ethanol.

And (3) purification process:

1) washing with water for injection: washing 2-4 column volumes (the washing can be finished in advance when the conductance is less than 0.1 ms/cm);

2)0.1M NaOH solution rinse: washing for 20-40 min;

3) washing with water for injection: washing with water for injection until the pH value is reduced, stabilizing the UV and conductance curves, and generally washing for 2-4 column volumes (the washing can be finished in advance when the conductance is less than 0.1 ms/cm);

4) washing with an affinity balancing solution: washing the column with an affinity balancing solution, adjusting the UV curve to zero after the UV and conductance curves are stable, and washing for 2-4 volumes generally;

5) loading the sample on a column: loading the sample solution on the column;

6) washing with an affinity equilibrium solution: after the sample is applied, washing with an affinity equilibrium solution until UV is stable (the UV absorption value is lower than 100mAU), changing the solution after the UV dropping speed is slow, and generally washing for 2-4 column volumes;

7) washing with an affinity rinsing solution: washing with an affinity rinsing solution until UV is stable (the UV absorption value is lower than 100mAU) after a miscellaneous peak appears, changing the solution after the UV dropping speed is slow, and generally washing for 2-4 column volumes;

8) affinity eluent wash (sample elution): washing with affinity elution solution, and starting to collect the eluted product when the UV absorption value is higher than 100mAU, and ending the collection when the UV absorption value is lower than 100 mAU;

9)0.1M NaOH solution rinse: washing with 0.1M NaOH solution for 30-40 min;

10) washing with water for injection: washing the column with water for injection until the pH value and the conductance value are reduced, wherein the conductance curve is stable, and the column is generally washed for 2-4 column volumes (the washing can be finished in advance when the conductance is less than 0.1 ms/cm);

11) determining the loading times according to the column loading capacity and the sample amount, and repeating the operations from 1) to 10) when multiple times of loading are needed. Finally, combining the eluates collected for multiple times for further production.

EDTA metal chelating agent is added into the rinsing liquid of affinity chromatography to prevent the damage of heavy metal to target protein, and the EDTA metal chelating agent can eliminate residual manganese ion in the chromatographic column.

3. First step ultrafiltration

Preparation of reagents: 0.5M NaOH aqueous solution, 20mmol/L Tris ion exchange equilibrium solution, pH7.5 +/-0.2;

and (3) cleaning an ultrafiltration membrane: and (4) washing the ultrafiltration membrane by using 0.5M NaOH, and circularly washing for about 30 min.

Washing with water for injection: the ultrafiltration membrane was washed neutral with water for injection.

Washing with ion exchange balance liquid: and (4) washing and wetting the ultrafiltration membrane by using ion exchange equilibrium liquid.

And (3) ultrafiltration of a sample: and (2) carrying out ultrafiltration on the sample eluted by the affinity chromatography, controlling the inlet pressure to be 1-3 bar and the outlet pressure to be less than 1bar, concentrating the affinity eluent by about 3 times of volume, and then replacing the affinity eluent by an ion exchange equilibrium solution (usually 5-8 times of the volume after concentration). As the next step ion exchange chromatography solution.

And (3) cleaning an ultrafiltration membrane: the ultrafiltration membrane was washed with 0.5M NaOH for about 30 min.

Washing with water for injection: the ultrafiltration membrane was washed with water for injection until the effluent liquid was neutral.

4. Virus inactivation and ion exchange chromatography

Virus inactivation: slowly adding a certain amount of TritonX-100 into the ultrafiltered sample under stirring, and stirring at room temperature to inactivate viruses.

Ion exchange chromatography:

preparation of reagents: 0.5M NaOH aqueous solution, ion exchange regeneration solution pH7.5 +/-0.2, 20mmol/L Tris +1mol/L sodium chloride, ion exchange equilibrium solution pH7.5 +/-0.2, 20mmol/L Tris, ion exchange eluent pH7.5 +/-0.2, 20mmol/L Tris +0.5mol/L sodium chloride;

and (3) purification process:

2)0.5M NaOH solution rinse: washing for 20-40 min;

4) and (3) activation: activating the filler by using an ion exchange regeneration liquid, and basically activating for 2-4 column volumes;

5) balancing: balancing the columns by using ion exchange balancing liquid, balancing 3-5 column volumes until the conductivity and the pH base line are stable, and manually zeroing the purification instrument UV 280;

6) column mounting: loading the inactivated sample solution into a column, washing with an ion exchange balancing solution after all the sample solution is loaded until UV is stable (the UV absorption value is lower than 100mAU), changing the solution after the UV dropping speed is slow, and generally washing for 5-7 column volumes;

7) and (3) elution: eluting the sample with ion exchange eluent, and when the UV absorption value is higher than 100mAU, starting to collect the eluted product until the UV absorption value is 100mAU, and finishing the collection;

8) regeneration: eluting the column by using ion exchange regeneration liquid, wherein the volume of the column is generally 2-4;

9)0.5M NaOH solution rinse: washing the column with 0.5M NaOH solution for 30-40 min;

5. Hydrophobic chromatography

Preparation of reagents: 0.5M NaOH aqueous solution, hydrophobic equilibrium solution pH7.5 +/-0.2, 20mmol/L Tris +1.5mol/L ammonium sulfate, hydrophobic rinsing solution pH7.5 +/-0.2, 20mmol/L Tris +1mol/L ammonium sulfate, hydrophobic eluent pH7.5 +/-0.2, 20mmol/L Tris +0.5mol/L ammonium sulfate, hydrophobic buffer solution pH7.5 +/-0.2, 20mmol/L Tris +2mol/L ammonium sulfate.

Sample treatment: adjusting the conductivity of the sample after ion exchange elution to be consistent with that of the hydrophobic equilibrium solution (within 2 ms/cm) by using a hydrophobic buffer solution, testing the pH value of the sample after adjustment to be within +/-0.2 of the pH value of the hydrophobic equilibrium solution, and if the pH value is not within the range, adjusting the pH value to be within the range by using 0.1M hydrochloric acid or 0.1M sodium hydroxide.

And (3) purification process:

2)0.5M NaOH solution rinse: washing for 20-40 min;

4) balancing: balancing the columns by using a hydrophobic balancing solution, balancing 2-4 column volumes until UV and conductivity baselines are stable, and manually zeroing a purifier UV 280;

5) loading the sample on a column: loading the ion exchange eluent after the conductivity is adjusted into a column, washing the column by using a hydrophobic equilibrium solution, wherein UV and conductivity curves are stable, and the volume of the column is generally 2-4 times that of the column;

6) rinsing: flushing with a hydrophobic rinsing solution until UV is stable (the UV absorption value is lower than 100mAU) after a miscellaneous peak appears, changing the solution after the UV dropping speed is slow, and generally flushing for 2-4 column volumes;

6) sample elution: eluting the sample with hydrophobic eluent, and when the UV absorption value is higher than 100mAU, starting to collect the eluted product until the UV absorption value is 100mAU, and finishing the collection;

7) regeneration: washing the column with water for injection, generally washing 2-4 volumes;

8)0.5M NaOH solution rinse: washing the column with 0.5M NaOH solution for 30-40 min;

9) washing with water for injection: washing the column with water for injection, generally washing 2-4 volumes (the conductivity is less than 0.1ms/cm, the washing can be finished in advance);

10) and (3) determining the loading times according to the column loading capacity and the sample amount, and repeating the operations from 1) to 9) when multiple times of loading are required. Finally, combining the eluates collected for multiple times for further production.

6. Second step ultrafiltration

Preparation of reagents: 0.5M NaOH aqueous solution, 0.1M NaOH aqueous solution, CHT equilibrium solution pH7.5 + -0.2, 20mmol/L PB.

Washing with CHT balance liquid: and washing and wetting the ultrafiltration membrane by using a CHT balance solution.

And (3) ultrafiltration of a sample: and (3) carrying out ultrafiltration on the sample eluted by the hydrophobic chromatography, controlling the inlet pressure to be 1-3 bar and the outlet pressure to be less than 1bar, controlling the weight of the sample to be unchanged, and using CHT balance liquid to be 5-8 times of the amount of the ultrafiltration sample.

7. Hydroxyapatite chromatography (CHT chromatography)

Preparation of reagents: 1M NaOH aqueous solution, 0.1M NaOH aqueous solution, CHT regeneration solution pH7.5 + -0.2, 1mol/L PB, CHT equilibrium solution pH7.5 + -0.2, 20mmol/L PB

And (3) purification process:

2)1M NaOH solution rinse: washing 2-4 column volumes;

4) activating the column by using a CHT regeneration solution, and basically activating 2-4 column volumes;

5) using CHT balance liquid to balance the column, balancing 2-4 column volumes until UV, conductivity and pH base lines are stable, and manually zeroing a purifier UV 280;

6) sample on column (sample collected): loading all samples on the column, after the samples are loaded, washing the samples by using a CHT equilibrium solution, starting to collect the flow-through product when the UV absorption value is higher than 100mAU, and ending the collection when the UV absorption value is lower than 100 mAU;

7) regeneration: eluting the column by using a CHT regeneration solution, and basically washing 2-4 column volumes;

8) and (3) washing with NaOH solution: washing the column with 1M NaOH solution for 2-4 column volumes;

9) washing with water for injection: washing the column with water for injection until the pH value and the conductance value are reduced, wherein the conductance curve is stable, and the column is generally washed for 2-4 column volumes (the washing can be finished in advance when the conductance is less than 0.1 ms/cm);

8. Virus filtration

Washing the prefilter and the virus filter with water for injection, filtering viruses after washing, washing the prefilter and the virus filter with 20mM phosphate buffer solution after the sample solution is completely filtered, collecting the filtered liquid, testing the protein concentration by using a spectrophotometer, and stopping collecting when the sample at the outlet of the virus filter has no protein concentration basically.

And (4) carrying out integrity test on the virus filter to determine whether the virus filter is qualified, and if the virus filter is not qualified, carrying out virus filtration again.

And selecting a proper virus prefilter and a proper virus filter according to the sample amount.

9. Sterile filtration

The sterile filter is selected according to the sample size. Connecting the sterile filter with the sterile liquid storage bag, filtering the sample solution after virus filtration into the sterile liquid storage bag, after the sample is completely filtered, washing the filter by using 20mM phosphate buffer solution, testing the protein concentration by using a spectrophotometer, and stopping filtration after the protein concentration is basically not existed.

10. Dispensing

According to the sample amount, subpackaging into sterile liquid storage bags, and storing at the temperature below-20 ℃.

Example 3: high performance liquid chromatography identification

Briefly, the following steps are carried out: the high performance liquid chromatography is a high specificity identification method, and the identification is carried out according to whether the retention time of the main peak of the test solution is consistent with that of the main peak of the reference solution, and the content determination of the product adopts the high performance liquid chromatography, so the method can be used for identifying the recombinant chorionic gonadotrophin.

Instruments and equipment: high performance liquid chromatograph (with ultraviolet detector), pH meter, and electronic analytical balance.

The determination method comprises the following steps: control solution: a solution (0.25mg/ml) containing 250. mu.g of the control per 1ml was prepared with water, and the chromatogram was recorded.

Sample solution: according to the concentration determined by OD280, a solution (0.25mg/ml) containing 250. mu.g of the sample per 1ml was prepared with water, injected, and the chromatogram was recorded.

And (4) judging a result: as shown in FIGS. 3 and 4, the retention time of the main peak of the test solution should be consistent with that of the main peak of the control solution.

Three pilot plant test results:

and (4) conclusion: the retention time of the main peak of the 3 batches of pilot sample solutions and the retention time of the main peak of the control solution are determined to be consistent.

Example 4: biological assay

Briefly, the following steps are carried out: the bioassay method is a high-specificity identification method, and the titer of the product is determined by adopting the bioassay method, so the method can be used for identifying the recombinant chorionic gonadotrophin.

Animal and experimental device:

animals: taking healthy and qualified female young mice with birth time of 15-23 days and weight of 9-13 g from the same source, wherein the difference of the birth days and the weight of the young mice used in one experiment is not more than 3 days, and the difference of the weight of the young mice is not more than 3 g; the weight of the animals was randomly divided into 6 groups of not less than 10 animals.

Appliance: electronic balance, surgical scissors, ophthalmic scissors, tweezers, 1ml syringe, flat weighing bottle, culture dish, ground reagent bottle, 50ml burette, 1000ml or 500ml beaker, etc.

Reagent: bovine serum albumin, sodium chloride, purified water and sodium hydroxide.

And (3) test operation:

preparing a solvent: 2.00g of bovine serum albumin and 18.00g of sodium chloride are taken, 2000ml of water is added for dissolution, and the pH value is adjusted to 7.2 +/-0.2 by 1mol/L of sodium hydroxide.

Preparing a standard substance: on the day of the experiment, a standard substance is taken, 0.9% sodium chloride solution containing 0.1% bovine serum albumin is added according to the marked titer for dissolving and quantitatively diluting to prepare 1ml solution containing 10 units, 0.9% sodium chloride solution containing 0.1% bovine serum albumin is added after full dissolution to prepare high, medium and low concentration diluent, and the ratio of two adjacent doses is 1: 0.6, storing in a refrigerator at 2-10 ℃ for 3 days.

Preparing a test article: according to the marked potency or estimated potency, the preparation method is based on the preparation method of standard solution, the ratio (r) of adjacent concentrations should be equal to the standard, and the reaction mean value caused by each dosage of the standard and the sample should be similar.

The determination method comprises the following steps: the animals are evenly divided into a plurality of groups according to the weight, each group comprises 10 animals, and 0.2ml of standard substance or test solution with a certain concentration is respectively injected to the two sides of the thigh and the back of each group of animals subcutaneously at approximately the same time every day, once a day and continuously for 3 days.

After about 24 hours after the last injection, the animals were sacrificed and weighed, the lower abdomen of the mice was cut with surgical scissors to expose both sides of the uterus, the ovaries and kidneys were cut with ophthalmic scissors to pick up both sides of the uterus, the roots of the vagina were cut to remove the uterus, the attached tissue was peeled off, the intrauterine fluid was squeezed dry, weighed and recorded.

And (4) judging a result: the assay should be able to increase uterine weight in immature female mice.

Three pilot plant test results:

and (4) conclusion: all 3 batches of the pilot samples were determined to be able to increase uterine weight in immature female mice.

Example 5: peptide spectrum detection method

Briefly, the following steps are carried out: the peptide spectrum is a high-specificity identification method, proteolytic enzyme with strong specificity is used for acting on a special peptide chain site to crack polypeptide into small fragments, a spectrum is formed by a certain separation detection means, the retention time of each peak of a sample and a standard substance is recorded, the similarity of the peaks is calculated, and the purpose of characteristic identification is achieved.

And (4) judging a result: as shown in FIG. 5, the peak shape of the test solution should have the same similarity (similarity ≥ 0.90) as that of the control solution. Three pilot plant test results:

and (4) conclusion: the peak profiles of the 3 batches of the pilot sample solutions were determined to be consistent with the peak profile of the control solution.

Example 6: bacterial endotoxins

Bacterial endotoxin detection method

Briefly, the following steps are carried out: the assay was set up with reference to the bacterial endotoxin test method (general rule 1143) first method (gel method).

Instruments and appliances: a test tube thermostat, a vortex mixer, an electrothermal blowing dry box and a pyrogen-free test tube.

Reagent: limulus reagent, water for bacterial endotoxin test, and bacterial endotoxin standard substance with a sensitivity of 0.25EU/ml or higher.

The operation method comprises the following steps: the method quantifies the content of endotoxin in the test sample by determining the concentration of the reaction endpoint.

Test solution: calculating the maximum effective dilution multiple of the concentrated solution according to the following formula, gradually diluting the concentrated solution with water for bacterial endotoxin detection to the maximum effective dilution multiple concentration to obtain the test solution, wherein the dilution multiple of each step in the dilution process is not more than 10 times.

Wherein MVD represents the maximum effective dilution factor; l represents the limit of endotoxin, unit EU/U; c represents the concentration of the concentrated solution of the test sample, and the unit is U/ml; lambda is the labeling sensitivity (EU/ml) of the limulus reagent.

And (3) detecting by using a gel limiting method: an amount of limulus reagent and an equivalent amount of solution (usually 0.1ml) were mixed separately as shown in the following table, and the reaction mixture was incubated at a constant temperature for a period of time (usually 37. + -. 1 ℃ C., 60. + -. 2 minutes) according to the recommendations of the limulus reagent supplier, avoiding shaking.

Each solution was prepared as follows:

and (4) judging a result:

after incubation is finished, taking out each test tube or ampoule from the incubator in turn, and slightly turning over the test tubes for 180-degree observation, wherein if the contents form solid gel and do not slip from the tube wall after the test tubes are turned over, the result is marked as positive; if no complete gel was formed, it was scored as negative.

The test was effective when all replicate tubes in positive control solutions B and C were positive results and all replicate tubes in negative control solution D were negative results. If both duplicate tubes of solution A are positive, the test article is not in compliance with the regulations. If one tube in solution A has a positive result and the other tube has a negative result, the test is repeated, and if both tubes in solution A have negative results, the test article meets the specification in the repeated test. The amount of endotoxin in 1mg of recombinant chorionic gonadotropin should be less than 60 EU.

Three pilot plant test results:

and (4) conclusion: the bacterial endotoxin of the 3 batches of the pilot sample solutions was determined to meet the standard requirements.

Example 7: purity (SEC-HPLC)

Briefly, the following steps are carried out: the purity of the product is determined by HPLC method, and the calculation method adopts area normalization method. SEC-HPLC is called size exclusion chromatography, also called gel chromatography and molecular sieve chromatography, and takes porous gel as a stationary phase to achieve the separation purpose according to the molecular weight of a sample. The macromolecules do not enter the gel holes, flow out along the gaps of the porous gel particles and are eluted firstly; the small molecules enter most of the gel pores, are strongly retained in the column, and are then eluted. The method can be divided into gel filtration and gel permeation according to the sample properties, and the gel filtration is mainly used for analyzing water-soluble samples such as polypeptide, protein, biological enzyme, nucleotide, polysaccharide and the like. Gel permeation is mainly used for analyzing fat-soluble samples, such as determining the molecular weight of high polymers. The purity analysis method is the same as the content detection method for the purity under the content item.

The determination method comprises the following steps: a solution (0.25mg/ml) containing about 250. mu.g of the sample per 1ml was prepared with water, and 40. mu.l was precisely measured and injected into a liquid chromatograph, and the chromatogram was recorded. And (4) detecting the blank control which is aqueous solution according to the chromatographic conditions, and recording a chromatogram map.

And (4) judging a result: calculated according to an area normalization method, the purity of the main peak is more than 95 percent except the system peak.

Three pilot plant test results:

and (4) conclusion: the purity of the 3 batches of pilot sample solutions is determined to meet the standard requirements.

Example 8 DNA remaining

DNA residue detection method

Briefly, the following steps are carried out: the product is prepared by CHO cell culture expression, and needs to detect DNA residue produced by CHO cell. The DNA extraction kit is adopted to extract the CHO DNA, and then the CHO DNA detection kit is used to detect the DNA, wherein the detection method is a fluorescence quantitative method, the specificity is better, the salt tolerance is realized to a certain degree, and the detection sensitivity is high.

And (3) calculating the result: obtaining a linear formula through the measured SD value and the DNA concentration, obtaining a result through calculating the SD value of the sample, wherein the recovery rate is between 80 and 120 percent, the PCR amplification efficiency is between 90 and 110 percent, and the linearity R is²≥0.98。

Acceptance criteria: the DNA residue was not more than 400 pg/mg.

Three pilot plant test results:

and (4) conclusion: through determination, the DNA residues of 3 batches of pilot sample solutions all meet the standard requirements.

Example 9 HCP residual

HCP residual assay, briefly described: the product is prepared by CHO cell culture, although the product is purified by various purification methods, trace host protein residue (HCP) possibly exists in the medicine, thereby influencing the safety and the drug property of the medicine, and carrying out HCP detection. Instruments and appliances: enzyme-linked immunosorbent assay (ELISA) instrument

The operation method comprises the following steps:

the reagents and kit were taken out and equilibrated to room temperature. Mu.l of anti-CHO: HRP was added to each well of the pre-antibody-coated microplate. Standards (100ng/ml, 40ng/ml, 12ng/ml, 3ng/ml, 1ng/ml, 0ng/ml), quality controls (diluted from standards) and test samples were added to the wells at 50. mu.l each.

The product dilution method comprises the following steps: estimating HCP residual in the test sample by PBST₂₀(0.05%, v/v) diluting to proper concentration, loading order of the standard substance is from low concentration to high concentration, and loading order of the quality control substance is from high concentration to low concentration.

The plate was incubated at room temperature (24. + -. 4 ℃) for 2h at 180 rpm. Add 250. mu.l of diluted wash solution to each well and wash 4 times. Adding 100 μ l of TMB substrate color development solution into each well, developing at room temperature for 30min, and taking care not to shake. The color development was stopped by adding 100. mu.l of stop buffer to each well. And (5) placing the plate on a microplate reader to read OD450/650nm, and performing editing and data processing analysis.

Acceptance criteria: linear R²Not less than 0.99, and the quality control recovery rate is between 80 and 120 percent. The result was not higher than 100 ppm.

Three pilot plant test results:

and (4) conclusion: HCP residues from 3 batches of pilot sample solutions were determined to meet standard requirements.

Example 10: lyophilized powder for injection of human chorionic gonadotropin

First, prescription screening optimization

According to the characteristics and production process requirements of the freeze-dried powder injection, the method comprises the screening of a prescription and the development of a production process, and the development of the production process mainly comprises the following steps: preparing solution, sterilizing, filtering, filling, and freeze drying.

As for the freeze-dried powder injection, mannitol, dextran and sucrose are good excipients, and experiments show that after single materials or combined materials are mixed with recombinant chorionic gonadotrophin, freeze-drying is carried out under the condition of proper pH, the obtained freeze-dried product is full in appearance and good in supporting structure, and the excipients can be used as the excipients of the preparation. According to the information reported in the literature: recombinant chorionic gonadotrophin serving as marketed medicine

The prescription of the powder injection preparation comprises 285 micrograms of recombinant chorionic gonadotrophin, 30mg of sucrose, 0.98mg of phosphoric acid and sodium hydroxide (used for pH adjustment) in each powder. The pH value of the redissolution is 6.5 to 7.5. Therefore, the company finally selects sucrose as an excipient of the developed preparation, and the dosage of the sucrose is also the same as that of the marketed medicine

The consistency of the powder injection preparation is kept. The auxiliary materials used in the medicines on the market also comprise sodium hydroxide, wherein the sodium hydroxide is a pH regulator, phosphoric acid is replaced by a buffer system of sodium dihydrogen phosphate and disodium hydrogen phosphate, the pH is the same on the premise of ensuring that the phosphate ions in the solution are the same as the medicines on the market, the strength of the sodium ions in the solution is basically the same, and the buffer system of the sodium dihydrogen phosphate and the disodium hydrogen phosphate can basically obtain the solution with the corresponding pH value range, so the buffer system of the sodium dihydrogen phosphate and the disodium hydrogen phosphate is finally selected to replace the buffer system of the sodium dihydrogen phosphate and the disodium hydrogen phosphate

Phosphoric acid and sodium hydroxide in the powder injection preparation, thereby avoiding the potential risk of unknown impurities in the phosphoric acid to the product. Therefore, the finally used auxiliary materials are sucrose, sodium dihydrogen phosphate monohydrate, disodium hydrogen phosphate and water for injection, and the weight percentage of the sodium dihydrogen phosphate monohydrate and the disodium hydrogen phosphate is 1: 1.6, the investigation of the stability of the solution and the stability of the freeze-dried product indicates that the prescription is feasible.

Second, study of degerming Process

1. Stability of solutions at different pH

According to the prescription information, recombinant chorionic gonadotrophin solutions with different pH values are prepared at room temperature, the stability of the solutions is inspected by taking the change of protein content as an index, and the measurement results are shown in the following table.

Stability of recombinant chorionic gonadotrophin solutions at different pH values (Room temperature)

The result shows that the recombinant chorionic gonadotrophin solution with the pH value of 6.0-8.0 is stable within 24 hours at room temperature, and the protein content of the recombinant chorionic gonadotrophin solution with the pH value of 6.0 and the protein content of the recombinant chorionic gonadotrophin solution with the pH value of 8.0 begin to decrease after 48 hours, so that the conditions for preparing the solution are finally set to be room temperature and pH value of 7.0-7.6, and the time from the beginning of preparing the solution to the end of filling should not exceed 24 hours.

2. Filter adsorption study

In the production process, 2 aseptic filtrations are needed, in order to investigate the adsorption of 2 2.5-inch polyethersulfone filter elements used in the filtration process of the aseptic filter on protein and ensure that the adsorption capacity of the filter elements on the protein is in a reasonable range, three batches of samples are subjected to adsorption research, each batch of aseptic filtration filter elements with different batches of numbers (2 filter elements with the same batch number are used in the same batch), samples before and after filtration are sampled and detected, and the results are summarized as follows.

TABLE 10-3 Filter element information

TABLE 10-4 summary of the results of the experiments

And (4) conclusion: the protein content is between 0.565 and 0.595mg/ml before and after filtration, and the percentage value of each batch after filtration and before filtration is between 97.65 and 101.59 percent, the change is not large before and after, and the purity is more than 99 percent. Meets the requirements. Therefore, in the production process of the recombinant fluff-promoting freeze-dried powder injection, a 2.5-inch filter element made of polyethersulfone of 0.22 micron and produced by Hangzhou Koppet company is used for filtering to carry out sterile filtration on feed liquid.

3. Bacterial entrapment study

In the production process, a 2.5-inch filter element made of 0.22 micron polyethersulfone is used for filtering to perform aseptic filtration on feed liquid, so that the microorganism interception capability of a sterilization grade filter needs to be examined.

The sterilization-grade liquid filter can retain 10 per square centimeter of effective filtering area under the process condition⁷Filter for cfu pseudomonas defectives. GMP and other related regulations have proposed that when a sterile filtration method is employed, it is first confirmed that the employed filter is "sterile grade". After this requirement is met, other sterility safeguards in the sterile filtration process are of interest. The purpose of bacterial retention validation is to demonstrate that under simulated process conditions, the filtration process can continue to remove high concentrations of standard bacterial or related microbial contamination isolates suspended in the product or replacement fluid. The conditions of the bacterial challenge test should simulate the actual production process. The scale of the experiment was adjusted in terms of flux, i.e. flow rate per unit area.

The 0.22 μm filter was validated with Brevundimonas diminuta ATCC 19146 as the challenge microorganism. The test results show that: 1. the testing recombinant chorionic gonadotrophin solution has no bacteriostasis, and the testing bacterial suspension is directly added into the liquid medicine for testing; 2. positive pairThe bacteria challenge result is effective when the result is normal; 3. the downstream filtrate of the filter grows aseptically, and the filter for sterilization, namely test can effectively intercept the challenge level of more than or equal to 10 under the test condition⁷cfu/cm²A challenge bacterial suspension of b.diminuta (ATCC 19146). Under the test conditions, the sterilization performance of the sterilization grade filter meets the requirement.

Third, study of lyophilization Process

Based on the results of the pilot and pilot studies, the final scale-up lyophilization process parameters were determined as follows.

Freeze drying process parameters

The specific operation is as follows: starting a circulating pump, a compressor and a plate cooling valve, and controlling the temperature of a plate layer to be-40 to-50 ℃; cooling at full speed; the maintaining time is 2-4 hours; first sublimation: the vacuum degree is less than 20Pa, the temperature is increased to-25 to-32 ℃ within 1 hour, the temperature is kept for 30 to 40 hours, and the vacuum degree is controlled to be 10Pa +/-2 Pa; and (3) carrying out second sublimation: heating to 0 deg.C within 1 hr, maintaining at constant temperature for 5-10 hr, controlling vacuum degree at 20Pa + -2 Pa, heating to 32 deg.C within 1 hr, controlling vacuum degree at 20Pa + -2 Pa, and maintaining at constant temperature for 5-10 hr. And finishing the freeze-drying. And (5) when the micro vacuum is left in the drying process after the air is discharged, pressing the plug by pressing the descending button, and discharging the air after the product is completely pressed and plugged. After the freeze-drying is finished, the mixture is put into an ampoule bottle for storage, and the picture of the rhCG freeze-dried powder material object is shown in figure 6.

Example 11: methodology study of formulations

Quality standard of recombinant human chorionic gonadotrophin for injection

According to the regulation of chorionic gonadotrophin pharmacopoeia for injection and the relevant characteristics of the product, the recombinant human chorionic gonadotrophin for injection is correspondingly researched, and the quality standards are as follows:

quality standard

1. The characteristics are as follows: 1.1. briefly, the following steps are carried out: the properties are the definition of the color and the appearance of the drug. 1.2. The operation method comprises the following steps: taking appropriate amount of the product, and performing visual inspection under natural light. 1.3. And (4) judging a result: the product should be white lyophilized cake or powder. 1.4. Three pilot test results

1.5. And (4) conclusion: the appearance of the 3 batches of pilot samples was checked as white lyophilized cakes and powders, consistent with the above criteria.

2. pH value

2.1. Briefly, the following steps are carried out: pH measurement is a method of measuring the activity of hydrogen ions in aqueous solutions. The product uses sodium dihydrogen phosphate monohydrate and disodium hydrogen phosphate solution as pH regulator. In order to control the product quality and ensure the medication safety, the pH value of the product is checked. 2.2. Instruments and appliances: and a pH meter. 2.3. Reagent: water, pH 6.86 phosphate standard buffer solution, pH 9.18 sodium tetraborate standard buffer solution. 2.4. Operating method 2.4.1 instrument calibration: calibrating the instrument with a standard buffer solution of sodium tetraborate, pH 9.18, and a standard buffer solution of phosphate, pH 6.86; 2.4.2pH determination: taking the product, adding 1ml of water for injection into each branch for dissolving, directly measuring pH value, measuring in parallel for 3 times, and calculating average value. 2.5. If the pH value is 6.5-7.5, the result is judged to be in accordance with the regulation; otherwise, the result is judged to be not in accordance with the regulation.

2.6. Three pilot test results

2.7. And (4) conclusion: the pH values of the 3 batches of pilot sample solutions were determined to be within the standard range.

3. Clarity and color of solution

3.1. Briefly, the following steps are carried out: the method is to check the turbidity degree and color of the medicine solution. The clarity can reflect the quality and production process level of the medicine to a certain extent, and the color can reflect the impurity level of the medicine to a certain extent. 3.2. Instruments and appliances: a clarity detector and a nano colorimetric tube. 3.3. Reagent: water and standard colorimetric solution. 3.4. Preparation of a test solution: 1 part of the product is taken and added into 1ml of water for injection to dissolve. 3.5. And (4) judging a result: the water solution of the product should be clear and colorless; if the turbidity appears, the turbidity is not deeper compared with the turbidity standard solution No. 2; if the color is developed, the color should not be darker than that of the yellow No. 4 standard colorimetric solution.

3.6. Three pilot test results

3.7. And (4) conclusion: the water solution of the 3 batches of pilot samples is clear and colorless after determination, and meets the standard requirements.

4. Loss on drying: 4.1. briefly, the following steps are carried out: the amount of water content and volatile substances in the sample can affect the quality and stability of the product, and therefore, the control is needed. 4.2. Instruments and appliances: a dryer and a vacuum pump. 4.3. Reagent: phosphorus pentoxide. 4.4. The operation method comprises the following steps: taking the product, placing the product in a phosphorus pentoxide dryer, drying the product at room temperature under reduced pressure until the weight is constant, wherein the weight loss reduction amount is not more than 5.0 percent and 4.5, and judging the result: the weight loss of the product is not more than 5.0%. 4.6. Three pilot test results

4.7. And (4) conclusion: the weight loss on drying of 3 batches of pilot samples was determined to meet the standard requirements.

5. Polymer and method of making same

5.1. Brief description of the drawings

HPLC method is adopted to measure related substances of the product, and area normalization method is adopted as calculation method. SEC-HPLC is called size exclusion chromatography, also called gel chromatography and molecular sieve chromatography, and takes porous gel as a stationary phase to achieve the separation purpose according to the molecular weight of a sample. The macromolecules do not enter the gel holes, flow out along the gaps of the porous gel particles and are eluted firstly; the small molecules enter most of the gel pores, are strongly retained in the column, and are then eluted. The method can be divided into gel filtration and gel permeation according to the sample properties, and the gel filtration is mainly used for analyzing water-soluble samples such as polypeptide, protein, biological enzyme, nucleotide, polysaccharide and the like. Gel permeation is mainly used for analyzing fat-soluble samples, such as determining the molecular weight of high polymers. 5.2. Instruments and equipment: high performance liquid chromatograph, ten-thousandth balance, chromatographic column, sample introduction bottle, volumetric flask, pipette 5.3. reagent and test solution: water, sodium sulfate, phosphoric acid and sodium hydroxide. 5.4. And (3) test operation: measuring, taking the product, adding 0.12ml water according to 1000 units to dissolve, preparing as sample solution, precisely measuring 40 μ l, injecting into liquid chromatograph, operating to twice of main peak retention time, and recording chromatogram. And (4) detecting the blank control which is aqueous solution according to the chromatographic conditions, and recording a chromatogram map. 5.5. And (4) judging a result: calculated by an area normalization method, the polymer cannot exceed 5.0 percent except the system peak.

5.6. Three pilot test results

5.7. And (4) conclusion: the polymers of the 3 batches of pilot samples were determined to meet the standard requirements.

6. Insoluble microparticles

6.1. Briefly, the following steps are carried out: the photoresistance method is that when a certain volume of test solution passes through a narrow detection zone, the incident light perpendicular to the flow direction of the solution is weakened because of being blocked by the particles in the test solution, so that the signal output by the sensor is reduced, the signal change is related to the size of the cross section of the particles, and then the number of insoluble particles with the size of more than 10 microns and more than 25 microns in each 1ml of test solution is calculated according to the volume of the test solution passing through the detection zone. 6.2. Instruments and appliances: insoluble particle detector. 6.3. Reagent: water for insoluble microparticle inspection. 6.4. The operation method comprises the following steps: taking a sample, carefully opening a bottle cap, respectively and precisely adding an appropriate amount of water for particle inspection, slowly shaking to dissolve the contents, carefully combining the solutions in the container, placing in a sampling cup, standing for a proper time, degassing, and placing on a sampler. And starting stirring to uniformly mix the solution (avoiding generating bubbles), sequentially measuring for at least 4 times, counting the first time data, taking the average value of subsequent measurement results, and calculating the number of particles in each bottle. 6.5. And (4) judging a result: the content of fine particles with a particle size of 10 μm or more and 10 μm or more in each bottle should be 6000, and the content of fine particles with a particle size of 25 μm or more and 25 μm or more should be 600. 6.6. Three pilot test results

6.7. And (4) conclusion: the insoluble particles of all 3 pilot samples were determined to meet the above standard.

Example 12: formulation stability

The data of recombinant human chorionic gonadotrophin for injection (batch number 190227) examined at 25 +/-2 ℃ for 6 months shows that the content is determined to be 108.80%, and the specific activity is 9035 IU/count, and other indexes such as subunit oxide and subunit dissociate are all in the qualified range.

Claims

1. A lyophilized powder for injection is prepared from human chorionic gonadotropin, at least one excipient and at least one pH regulator by lyophilizing.

2. The lyophilized human chorionic gonadotropin powder for injection according to claim 1, wherein said excipient is sucrose.

3. The lyophilized powder for injection of human chorionic gonadotropin according to claim 1 wherein said PH adjusting agent is selected from the group consisting of sodium dihydrogen phosphate monohydrate and disodium hydrogen phosphate.

4. The lyophilized powder for injection of human chorionic gonadotropin according to claim 3, wherein the weight percentage of the monosodium phosphate monohydrate and the disodium phosphate is 1: 1.6.

5. the lyophilized powder for injection of human chorionic gonadotropin according to claim 1, wherein said pH adjusting agent controls pH after reconstitution to 6.5 to 7.5.

6. The lyophilized powder for injection of human chorionic gonadotropin according to claim 1, wherein said human chorionic gonadotropin is obtained by using rhCG, a recombinant protein expressed by fermentation in CHO cell and purifying.

7. The lyophilized powder for injection of human chorionic gonadotropin according to claim 6, wherein manganese chloride is added to the fermentation mixed culture medium expressed by fermentation in CHO cells, and hydrocortisone and sodium pyrophosphate are added to the feed medium.

8. The process for preparing the lyophilized powder for injection of human chorionic gonadotropin according to any one of claims 1 to 7, comprising the steps of solution preparation, sterile filtration, filling, and freeze drying, wherein the sterile filtration employs a 2.5 inch filter element made of polyethersulfone of 0.22 micron.

9. The process for preparing lyophilized powder for injection of human chorionic gonadotropin according to claim 8 wherein the solution is prepared by adding 500mg of human chorionic gonadotropin, 1.076mg of monobasic sodium phosphate monohydrate, 1.732mg of dibasic sodium phosphate to 1000ml of solution.

10. The process of claim 8, wherein the freeze-drying process comprises the following parameters: pre-freezing: the temperature of the plate layer is-40 to-50 ℃; cooling at full speed; the maintaining time is 2-4 hours; first sublimation: the vacuum degree is less than 20Pa, the temperature is raised to minus 25 to minus 32 ℃ within 1 hour, the temperature is kept for 30 to 40 hours, and the vacuum degree is controlled to be 10Pa +/-2 Pa; and (3) carrying out second sublimation: heating to 0 deg.C within 1 hr, maintaining at constant temperature for 5-10 hr, controlling vacuum degree at 20Pa + -2 Pa, heating to 32 deg.C within 1 hr, controlling vacuum degree at 20Pa + -2 Pa, and maintaining at constant temperature for 5-10 hr.