CN113388020A - Anti-inflammatory polypeptide DAvp-1 in snake venom and application thereof - Google Patents

Abstract

The invention belongs to the field of molecular biology, and particularly relates to an anti-inflammatory polypeptide DAvp-1 in snake venom and application thereof. In particular to an anti-inflammatory polypeptide DAvp-1 with a polypeptide sequence shown as SEQ ID NO. 2. The invention successfully screens a brand-new polypeptide DAvp-1 which can be combined with TNFR1 from a phage library of agkistrodon acutus venom. The polypeptide DAvp-1 has potential TNF-alpha antagonism and is an excellent candidate for development of polypeptide anti-inflammatory drugs.

Description

Anti-inflammatory polypeptide DAvp-1 in snake venom and application thereof

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to an anti-inflammatory polypeptide DAvp-1 in snake venom and application thereof.

Background

Inflammation, manifested as redness, swelling, heat, pain and dysfunction, is a defense response of the body against stimuli. In most cases, inflammation is beneficial and an automatic defense response in the body, but sometimes inflammation is harmful and can cause attack on the body's own tissues. Inflammatory diseases seriously affect the quality of life of people, such as common rheumatoid arthritis, ulcerative colitis and the like.

Tumor necrosis factor (TNF- α, TNF) is a cytokine with multiple effects and is associated with a variety of autoimmune and inflammatory diseases including enteritis, rheumatoid arthritis, septic shock, and the like. The small-molecule TNF-alpha inhibitor which is currently marketed and researched is expensive in multivalence and large in side effect; and the TNF-alpha and the receptor thereof have larger binding area, so that small molecules probably cannot play a good inhibition role. In contrast, polypeptides are macromolecules and are more suitable as targets for antagonizing TNF-alpha, thus having great potential in clinical drug development.

Snakes have been used as traditional Chinese medicines for hundreds of years, but the effective components and action mechanisms of the snakes are unknown. Snake venom is a mixture of active components comprising various proteins and polypeptides, and it has been shown that these components may have biological activities of anti-tumor, anti-inflammatory, anti-stroke and analgesic properties. Thus, snake venoms have the potential to develop antagonistic TNF- α polypeptides.

Venom of Agkistrodon acutus (Deinagkstrodonacutus) has been shown to have anti-inflammatory effects, but its specific anti-inflammatory component is not clear. If the polypeptide molecule with the anti-inflammatory function in the agkistrodon acutus venom can be accurately screened, the anti-inflammatory mechanism of the agkistrodon acutus venom can be analyzed to a certain degree, and a new anti-inflammatory polypeptide is expected to be provided, so that the method has double values of clinical application and scientific research.

Disclosure of Invention

The invention aims to provide an anti-inflammatory polypeptide DAvp-1 in snake venom and application thereof.

In order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows: a polypeptide DAvp-1, the DNA sequence is shown in SEQ ID NO. 1.

Preferably, the amino acid sequence is shown as SEQ ID NO. 2.

Correspondingly, the application of the polypeptide DAvp-1 in preparing anti-inflammatory drugs.

The invention has the following beneficial effects: the invention successfully screens a brand-new polypeptide DAvp-1 which can be combined with TNFR1 from a phage library of agkistrodon acutus venom. The polypeptide DAvp-1 has potential TNF-alpha antagonism and is an excellent candidate for development of polypeptide anti-inflammatory drugs.

Drawings

FIG. 1 is a schematic diagram of total RNA gel electrophoresis of venom glands of Agkistrodon acutus;

FIG. 2 is a schematic diagram of gel electrophoresis of total RNA reverse transcription products of venom glands of Agkistrodon acutus;

FIG. 3 is a schematic diagram of gel electrophoresis of PCR products of genes contained in phages;

FIG. 4 is a three-dimensional structure simulation of DAvp-1;

FIG. 5 is a schematic structural diagram of the binding of DAvp-1 to TNFR 1;

FIG. 6 is a diagram showing a binding model between TNFR1 and DAvp-1;

FIG. 7 is a graph showing the dose-dependent resonance caused by different concentrations of DAvp-1 when it was passed through TNFR1 immobilized on a biosensor chip;

FIG. 8 is a statistical chart of the hematochezia score for animal models;

FIG. 9 is a statistical plot of stool consistency scores for animal models;

FIG. 10 is a statistical graph of body weight change scores for animal models;

FIG. 11 is a stained section of colon tissue of a control group in a pathological test;

FIG. 12 is a stained section of colon tissue in DSS group for pathology experiments;

FIG. 13 is a stained section of colon tissue of the administration group 1 in the pathology experiment;

FIG. 14 is a stained section of colon tissue of the administration group 2 in the pathology experiment;

FIG. 15 is a stained section of colon tissue of the group 3 administered in the pathology experiment.

Detailed Description

The invention provides a polypeptide with anti-inflammatory potential obtained from agkistrodon acutus venom. The DNA sequence of the polypeptide is shown as SEQ ID NO. 1, the amino acid sequence is shown as SEQ ID NO. 2, the secondary structure schematic diagram is shown as figure 4, and the three-dimensional structure simulation diagram is shown as figure 5.

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

The first embodiment is as follows: construction of Agkistrodon acutus venom phage library

The whole steps of the embodiment are as follows: firstly, extracting total RNA of venom gland tissue of Agkistrodon acutus, extracting mRNA, and carrying out reverse transcription on the extracted mRNA to obtain cDNA. The cDNA is digested by adding a synthetic cleavage site to the end of the cDNA. After the cleavage, the too short DNA fragment is eluted. T7 select vector arms was ligated, and the gene encoding the peptide of interest was inserted into the genome of phage T7, and the cDNA sequence of Agkistrodon acutus venom was fused to the C-terminus of the 10B capsid, allowing expression of the protein of interest on the surface of the phage particles, which was then transduced into E.coli cells.

The initial titer of the phage library obtained was 1.2X 10⁶pfu/mL. Randomly selecting plaques of the original library, and carrying out PCR and gel electrophoresis on the contained genes of the plaques. Gel electrophoresis shows that fragments of different sizes have been successfully inserted into the phage, and the recombination rate of the original library is close to 100% according to the calculation of PCR. Thus, the initial library has better quality and high recombination rate. The initial library obtained was amplified to a titer of 7.6X 10¹⁰pfu/ml of the amplified library. The phage display peptide library contains up to 10¹⁰The variants can make the polypeptide and protein in agkistrodon acutus venom appear on the surface of phage in various sizes and structures, and provide rich displayed peptide library for screening subsequent inflammatory polypeptide.

The media and reagents involved in this example are as follows:

1. phage extraction buffer: 2.922g of NaCl, MgSO₄0.738g of Tris 1.2114g, 500mL of ultrapure water, 1.20X 10 pH adjusted by hydrochloric acid⁵Sterilizing at 121 deg.C for 30min under Pa, and storing at 4 deg.C.

2. Liquid LB medium: 5g of Tryptone, 2.5g of Yeast extract and 5g of NaCl, and adding ultrapure water to 500mL of the mixture, namely 1.20X 10⁵Sterilizing at 121 deg.C for 30min under Pa, and storing at 4 deg.C.

3. Solid LB medium: 5g of Tryptone, namely 5g of Tryptone,yeast extract 2.5g, NaCl 5g, Agar 7.5g, adding ultrapure water to 500mL, 1.20X 10⁵Pa, high temperature sterilization at 121 ℃ for 30 min.

4. M9TB medium: TB 100mL, 5 XM 9 solution 25mL, 1M MgSO₄125. mu.L, 20% glucose after filtration 2.5 mL.

5. Phage elution buffer (1% SDS): SDS 1g was dissolved in 100mL of ultrapure water.

6. 80% Glycerol solution 80mL, adding distilled water 20mL, mixing, 1.20X 10⁵Pa, high-temperature sterilization at 121 ℃, and room-temperature storage.

7. Ampicillin: storage concentration, 50 mg/mL; use concentration, 50 μ g/mL: dissolving 50mg in lmL distilled water, filtering for sterilization, and storing at-20 deg.C.

8. Top agar layer: 1g of Tryptone, 0.5g of Yeast extract, 0.5g of NaCl, 0.6g of Agar, and adding ultrapure water to 100mL of 1.20X 10⁵Sterilizing at 121 deg.C for 30min under Pa, and storing at 4 deg.C.

The specific core steps are as follows:

1. performing anesthesia on Agkistrodon acutus with sodium pentobarbital, taking out venom gland, placing in liquid nitrogen for 2h, taking out, and storing at-80 deg.C for use.

2. Extracting total RNA. Two new round bottom tubes were prepared and 1mL of RNAasso Plus was added in advance. The venom gland tissue of the ultra-low temperature frozen agkistrodon acutus is quickly transferred to a mortar precooled by liquid nitrogen, and the tissue is ground by a grinding pestle, wherein the liquid nitrogen is continuously added until the tissue is ground into powder. The powder was transferred to a centrifuge tube and allowed to stand at room temperature for 5 min. Centrifuge at 12,000 Xg for 5min at 4 ℃ and carefully aspirate the supernatant and transfer it to a new centrifuge tube. Adding 200 mu L of chloroform into the homogenate lysate obtained in the step, tightly covering a centrifuge tube cover, and shaking up and down to mix until the solution is emulsified to be milky white. Standing at room temperature for 5 min. 12000g, 4 ℃ centrifugation for 5 min. The centrifuge tube was carefully removed from the centrifuge, and the homogenate was divided into three layers at this time, i.e.: a colorless supernatant (containing RNA), an intermediate white protein layer (mostly DNA), and a colored lower organic phase. The supernatant was aspirated and transferred to another new centrifuge tube. Adding 750 μ L isopropanol into the supernatant, inverting the centrifuge tube, mixing, standing at room temperature for 10min, and centrifuging at 12000g and 4 deg.C for 10 min. Carefully discard the supernatant, add 750. mu.L of 75% ethanol, wash the tube wall of the centrifuge tube gently upside down, centrifuge at 7500g for 5min at 4 ℃ and carefully discard the supernatant. The centrifuge tube lid was opened and the pellet was dried at room temperature for 3 min. After the precipitate was dried, 50. mu.L of RNase-free water was added to dissolve the precipitate.

mu.L of total RNA was electrophoresed in 1% agarose gel at 150V for 15 min. Clear 28S, 18S and 5S strips are obtained, as shown in FIG. 1. The total RNA extracted is proved to be free from impurities and degradation. OD determination of extracted RNA Using Nano drop₂₆₀Is 68.346, OD₂₈₀To 34.599, OD was calculated₂₆₀/OD₂₈₀The quality of the extracted RNA was confirmed to be good at 1.98. The concentration of RNA was calculated to be 2733.8 ng/. mu.L.

3. mRNA was extracted from total RNA. The oligotexmRNAmiKits were used as indicated in the specification

(Qiagen) the kit extracts mRNA from total RNA.

4. The first strand of the cDNA was synthesized. Dissolving GoScript on Ice^TMThe Reverse Transcription Mix fractions were gently mixed and briefly centrifuged for use. The RNA used for the reaction was left at 70 ℃ for 5min and quenched on ice for 5 min. First strand cDNA synthesis was performed using oligo (dt) Primer, formulated according to the component volumes of Table 1, and the reaction system was prepared on ice with gentle mixing using a pipette for each addition of component. After all were added, mix gently. Each reaction was mixed with a pipette and the tube was capped. The reaction system is placed in a PCR instrument or a temperature control module. The reverse transcription reaction was set and started according to the conditions of table 2.

TABLE 1 oligo (dt) Primer formulation Table

Components	Reaction volume of 20. mu.L
		Primer	4μL
Go Script TM Enzyme Mix	2μL
		RNA template	2μL
Nuclease-Free Water	12μL

TABLE 2 comparison of reverse transcription reactions

Step (ii) of	Temperature of	Time	Number of cycles
				Extension
	25℃	5mins			1
				Extension		42℃	60mins		1
Deactivation of the enzyme	70℃	15mins			1

The product from reverse transcription was electrophoresed in a 1% agarose gel at 180V for 15 min. The results are shown in FIG. 2. FIG. 2 shows an amplified band of 410bp, which is matched with the designed target gene. Sequencing the PCR product, and comparing the sequence to prove that the amplified target gene is the selected target gene and that the cDNA library of the agkistrodon acutus is successfully reverse transcribed.

5. Double-stranded DNA was synthesized. The reagents in Table 3, derived from the DNA second strand synthesis kit (Byun day), were added sequentially on an ice bath to a 20. mu.L reaction in which the first strand had been synthesized. After the system of table 3 was prepared, the mixture was blown up and mixed by a pipette, and then the liquid was centrifuged and precipitated. Incubate at 15 ℃ for 2 h. To this solution, 5. mu.L of 0.5M EDTA (pH 8.0) was added and mixed to terminate the reaction.

TABLE 3 reaction system correspondence table for synthesizing double-stranded DNA

Components	Reaction volume
		Reaction Buffer(10X)	8μL
Nuclease-free deionized water	68μL
		RNase H(1U/μL)	1μL
DNA Polymerase I(10U/μL)	3μL

6. And (5) concentrating and purifying the DNA. According to the instruction, using DNA purification kit (Biyun day), obtain high purity DNA.

7. PCR was used to verify whether a valid DNA was transcribed. The conserved gene sequence of agkistrodon acutus GAPDH was found using NCBI, and then the following primers were designed. Primer F1: CACTGTTTTCCAAGAGCGTGA primer R1: TGGATGCTGGGATGATATTCTGA are provided.

The system shown in Table 4 was prepared as a 50. mu.L system, and the reaction was carried out according to the procedure shown in Table 5.

TABLE 4 reaction System comparison Table

Reaction components	Reaction volume
		Primer right	1μL
Primer left	1μL
		5×PrimeSTAR Buffer	10μL
dNTP Mix	4μL
		Template	10μL
PrimeSTAR HS DNA Polymerase	0.5μL
		Sterilized water	23.5μL

TABLE 5 reaction procedure comparison Table

Step (ii) of	Temperature of	Time	Number of cycles
				Denaturation of the material	98℃	10s		30
Annealing	55.8℃	15s							30
				Extension	72℃	25s		30

8. The cDNA was end-filled using a DNA filling kit (Biyun Tian). The reaction system was set up as in Table 6. After the reaction system is prepared, a pipette is used for blowing and mixing the mixture evenly, and then the liquid is centrifugally precipitated. Incubating at 11 deg.C for 20 min; the reaction was stopped by incubation at 70 ℃ for 10 min. Storing at-20 deg.C.

TABLE 6 reaction System comparison Table

Reaction components	Reaction volume
		Reaction Buffer(5×)	4μL
dNTP Mixture(2.5mM each)	0.8μL
		DNA	14.2μL
T4 DNA Polymerase	1μL

9. The cDNA is end-modified. The sequences of the oligos used are shown in Table 7, and the reaction system is shown in Table 8. The complementarity of the complementary Oligo strands in Table 8 specifically means: "HindIII L" is complementary to "HindIII F", and "ECOR IL" is complementary to "ECOR IF F"; in each group, 20. mu.L of each Oligo strand was added. The reaction procedure is as follows: at 95 deg.C for 2min, every 8s, reducing the temperature by 0.1 deg.C to 25 deg.C, and storing at 4 deg.C for subsequent experiments.

TABLE 7 Oligo sequence comparison Table

Oligo name	Nucleotide sequence (5 'to3')
		HindⅢL	GACTAGTAAGCTTGACTAGT
HindⅢF	ACTAGTCAAGCTTACTAGTC
		ECOR I L	GACTAGTGAATTCGACTAGT
ECOR I F	ACTAGTCGAATTCACTAGTC

TABLE 8 reaction System comparison Table

Reaction components	Reaction volume
		Reaction Buffer(5×)	20μL
Water	40μL
		Complementary Oligo strands	20μL×2

The reaction system with the linker attached was then set up as in Table 9. The double strand after the single strand annealing of the Oligo is linker.

The linker sequence is:

HindⅢL：5'-GACTAGTAAGCTTGACTAGT-3'；

HindⅢF：5'-ACTAGTCAAGCTTACTAGTC-3'；

ECORI L：5'-GACTAGTGAATTCGACTAGT-3'；

ECORI F：5'-ACTAGTCGAATTCACTAGTC-3'。

the reaction procedure is as follows: incubate at 8 ℃ for 20 h. Incubating at 70 deg.C for 20min to terminate reaction, and storing at-20 deg.C.

TABLE 9 comparative Table of reaction systems to which linker was attached

Reaction components	Reaction volume
		Reaction Buffer(5×)	2μL
T4 ligase	2μL
		cDNA	10μL
Linker	3μL×2

The linker-attached cDNA was amplified by PCR using the linker sequence as a primer, and a 50. mu.L system was prepared according to Table 10, with the reaction conditions shown in Table 11, while a cDNA control was performed without linker attachment, to verify and confirm that the cDNA was successfully attached to the linker. In Table 10, Primer right and Primer left refer to double-sided primers, i.e., the Oligo strands described above are used as primers.

Table 10 reaction system comparison table for verifying whether cDNA is successfully linked to linker

Reaction components	Reaction volume
		Primer right	1μL
Primer left	1μL
		5×Prime STAR Buffer	10μL
dNTP Mix	4μL
		Template	10μL
Prime STAR HS DNA Polymerase	0.5μL
		Sterilized water	23.5μL

Table 11 reaction program comparison Table for verifying whether cDNA was successfully ligated to linker

Step (ii) of	Temperature of	Time	Number of cycles
				Denaturation of the material	98℃	10s		30
Annealing	51.3℃	15s							30
				Extension	72℃	2min		30

PCR was performed on the linker-attached cDNA using the linker sequence as a primer, and a cDNA control was performed without linker attachment. After the reaction, 5. mu.L of the reaction mixture was removed for gel electrophoresis. The linker-ligated cDNA could PCR-smear out, whereas the cDNA that was not ligated by linker could not PCR-smear out. The results demonstrate successful linker ligation of the cDNA.

10. And (6) enzyme digestion. To the EP tube containing the linker-successfully ligated cDNA of step 9, 20. mu.L of the linker-successfully ligated cDNA (i.e., two tubes were synthesized and one tube was used for the cleavage reaction), 5.5. mu.L of water, 3. mu.L of 10 XBuffer Y, and 1.5. mu.L of Hind III were added. After mixing, incubation was carried out at 37 ℃ for 2 h. Then 5. mu.L of 10 XBuffer Y, 1.5. mu.L of LEcori and 3.5. mu.L of water are added; incubate at 37 ℃ for 4 h. Completing enzyme digestion.

11. After purification, a DNA fragment of appropriate length is selected. And (3) using a DNA purification kit, and operating and purifying the enzyme-digested sample in the step 10 according to the instruction to obtain high-purity DNA. Removing CHROMA SPIN^TM+ spin column in TE200 Columns kit, turn it over several times to recover the gel matrix completely. The spin column was held vertically, the separation end was grasped and broken off, the end of the spin column was placed into a 2mL microcentrifuge collection tube, and the cap was removed. Centrifuging at 700g for 5min, allowing the column matrix to be semi-dry, removing the equilibration buffer from the column, and reestablishing the matrix layer. Spin column was placed in a second 2mL microcentrifuge tube and the purified DNA was carefully added dropwise to the center of the gel bed plane to avoid any sample flow along the inner wall of the column. Centrifuge at 700g for 5 min. The resulting liquid is the cDNA from which small fragments have been removed.

12. Both arms are accessed. Taking 1.5 mu L of the liquid obtained in the step 11, placing the liquid in a PCR tube, and adding: 2.5 μ L of step 11 purified cDNA, 1 μ L T7 select vector arms, 0.5 μ L of 10 Xligase buffer, 1 μ L T4 DNA Ligase. Mixing, incubating at 16 deg.C for 16h, and storing at 4 deg.C.

13. And (5) packaging in vitro. T7 packaging extract (packaging protein) stored at-80 ℃ was removed and carefully dissolved on ice. Adding 5 mu L of the ligation product obtained in the step 12 into 25 mu L of packaging protein, and slowly and carefully mixing the obtained mixture by using a gun head; incubate at 22 ℃ for 2 h. The reaction mixture was transferred to a sterilized 1.5mL EP tube, and 270. mu.L of liquid LB containing ampicillin was added thereto to terminate the packaging reaction. Finally, 20. mu.L of chloroform was added, gently mixed and stored at 4 ℃.

Example two: screening specifically combined phage, analyzing and obtaining anti-inflammatory polypeptide DAvp-1

In this example, based on the phage display library obtained in the first example, phage display polypeptides having binding ability to TNFR1 were obtained by three rounds of screening using human recombinant tumor necrosis factor I receptor (hrTNFR1) as a substrate. Sequencing the gradually enriched phage genome to obtain the gene sequence of the phage, and translating to obtain the amino acid sequence of the phage surface display peptide. The polypeptide sequence is synthesized, and the binding force between the polypeptide and TNFR1 and the antagonism effect on TNF-alpha are further analyzed, so that the medicine with anti-inflammatory potential is obtained by screening.

The reagents involved in this example are as follows:

1. coating Buffer 1 × Coating Buffer: suck 10 × Coating Buffer5mL into the measuring cylinder, add distilled water to 50mL, mix well to avoid generating foam. Stored at 4 ℃.

2. Washing Buffer 1 × Washing Buffer: sucking 20 × Washing Buffer50mL to a measuring cylinder, adding distilled water to 1L, and mixing to avoid generating foams. Stored at 4 ℃.

3. Reaction Buffer 1 × Assay Buffer: suck 10 × Assay Buffer5mL into a measuring cylinder, add distilled water to 50mL, mix well to avoid generating foam. Stored at 4 ℃.

4. TNFR1 protein solution: TNFR1 protein 50 μ g at-80 deg.C is taken, placed at room temperature for 30min, and added with 500 μ L double distilled water to prepare 100 μ g/mL protein solution. Subpackaging at-20 ℃ for later use.

5. TNF- α protein solution: 100 mu g of TNFR1 protein at-80 ℃ is taken, placed at room temperature for 30min and added with 1mL of double distilled water to prepare 100 mu g/mL protein solution. Subpackaging at-20 ℃ for later use.

6. Elution buffer: 1g of SDS was dissolved in 100mL of ultrapure water, and dissolved by heating in a water bath.

The specific core steps are as follows:

1. coating TNFR1 protein. TNFR1 protein was diluted to 10. mu.L/mL using 1 Xcoating Buffer as Coating Buffer. The TNFR1 protein was coated using a cognate ELISA Basic Kit. The 96-well plate was removed, 100. mu.L of TNFR 1-coated reagent at 10ng/mL was added to each well, and the plate was sealed with a sealing membrane and left at 4 ℃ overnight. The plate was discarded using a pipette, patted dry, washed twice with, for example, 300. mu.L of 1 × Washing Buffer, each time forcing the rest of the liquid to be patted dry as much as possible on a patting paper, 250. mu.L of 1 × Assay Buffer was added, the plate was closed, incubated at room temperature for 2h, and left to stand at 4 ℃ until use.

2. TNFR1 coating was verified. 50 μ L of 100-fold diluted detection antibody was added to each well of a 96-well plate. After using the closure plate membrane plates, incubate for 2h on a shaker with shaking at 300 rpm. Discard the residual liquid in the plate, beat dry, add 300. mu.L of 1 × Washing Buffer to each well, wash for 6 times in total. Horseradish peroxidase-labeled streptavidin concentrated in a 100-fold dilution kit using a1 × Assay buffer was mixed well using a pipette prior to use. 100 μ L of diluted horseradish peroxidase-labeled streptavidin was added to each well. Incubate with shaking at 300rpm for 45min using a new sealing plate membrane seal. The residual liquid in the plate was discarded using a pipette, patted dry, and 300. mu.L of 1 × Washing Buffer was added to each well for a total of 6 washes. Adding a substrate TMB for color development: adding 100 mu L of chromogenic substrate TMB into each hole, placing the chromogenic substrate TMB in a dark place, and incubating the chromogenic substrate TMB at room temperature until the standard curve hole has obvious color gradient. Adding a stop solution: 100. mu.L of stop buffer was added to each well. The color in the well turned yellow. If the color is green or the color change is not uniform, the plate frame is tapped lightly to mix the liquid in the holes. And (3) detection reading: within 30min after the stop solution is added, a dual-wavelength detection is carried out by using an enzyme-labeling instrument, and the maximum absorption wavelength under the condition of 450nm and the maximum absorption wavelength under the condition of 630nm are measured. The measured value obtained by subtracting the measured value at 630nm from the measured value at 450nm of the OD value is more than 2 and is far more than 0, thus proving that the coating is successful.

3. And (4) screening and amplifying the phage library. The plate was drained, washed twice with 1 × Washing Buffer, 100 μ L of phage was added and incubated at room temperature for 2h or overnight at 4 ℃. The plate was washed 5 times with TBST solution at 200. mu.L/well and incubated slightly to remove the residual liquid thoroughly. To elute the phage from the ELISA plate, 200. mu.L of T7 elution buffer was added to each well and incubated for 20min at room temperature. The eluted phage were transferred to a sterile enzyme-free 15mL centrifuge tube. 250 μ L of the eluted phage was added to 50mL of OD₆₀₀0.5-0.6 of the BLT5403 bacteria were shake-cultured on a shaker at 37 ℃ until lysis was observed (i.e., the turbid broth became clear again). Transferring the lysate in the Erlenmeyer flask to a 50mL sterile enzyme-free centrifuge tube, centrifuging at 8000g for 10min, transferring the supernatant to another sterile enzyme-free 50mL centrifuge tube,after the first round of selection, the mixture is stored at 4 ℃ until the next round of selection. According to the method, the phage library screened and amplified in the previous round is used as the basis, two rounds of screening and amplification are carried out, and the phage obtained in the last round is stored at 4 ℃, or 0.1 volume time of 80% glycerol is added and stored at-80 ℃.

4. The resulting phage were sequenced. 100 monoclonal plaques were removed from each LB plate using a Pasteur tube, placed in an EP tube, and 100. mu.L of a 10mM EDTA (pH 7.5) solution was added. Vortex the tube and heat at 65 ℃ for 10 min. Cooled to room temperature and centrifuged at 14000g for 3 min.

Sucking the supernatant to perform PCR, wherein the primer sequence of the PCR is as follows: t7 up: GGAGCTGTCGTATTCCAGTC, respectively; t7 down: AACCCCTCAAGACCCGTTTA are provided.

Reaction system: 25 μ L Mix, 2 μ L × 2Primer, 1 μ L of LTemplate, 20 μ L of water. The reaction sequence is shown in table 12.

TABLE 12 PCR reaction procedure for bacteriophage-containing genes

Step (ii) of	Temperature of	Time	Number of cycles
				Pre-denaturation	98℃	2min		1
Denaturation of the material	98℃	10s							30
				Annealing	53.3℃	30s		30
Extension	72℃	20s							30
				Over-extension	72℃	1min		1

The PCR product obtained was subjected to agarose gel electrophoresis, and the results are shown in FIG. 3. And recovering PCR products, and sending the recovered products to a company for gene sequencing to obtain 80 effective sequences, wherein the effective sequences are shown in Table 13.

Table 1380 available sequences

Protein species	Number of
		Metalloproteinases (blood coagulation or haemolysis)	21
Membrane-based protein	12
		Other cytokines	39
Have not been matched to in the library	8
		The effective sequences are counted together	80

4. The sequencing results were annotated after BLAST. The sequencing results were analyzed using software bioedit to obtain the inserted content sequence. Blast analysis of the intron sequences was performed using a database such as Nucleotide collection (nr/nt), and the sequences were labeled to confirm whether they were the desired protein to be screened. And (3) finding out proteins or polypeptides with potential anti-inflammatory functions according to protein annotations, and determining the anti-inflammatory functions of the polypeptides through structural analysis, SPR (surface plasmon resonance) and other experiments. Finally, an inclusion polypeptide is obtained by screening, the DNA sequence of the inclusion polypeptide is shown as SEQ ID NO. 1, and the translation of ExPASy into the amino acid sequence is shown as SEQ ID NO. 2. BLAST results for this sequence are: protobothrops cross food product family 39 member 6(SLC39A6), mRNA. Sequence ID: XM _015821691.1, matching range 2281 ~ 2336, matching degree 87.9bits (47), 53/56 (95%), interval 0/56 (0%). Comparing with the mRNA library of Agkistrodon acutus, the result is 52/52 (100%), which proves that the sequence is indeed mRNA of Agkistrodon acutus venom. This polypeptide was designated as DAvp-1.

Example three: protein structure model simulation and binding force detection of anti-inflammatory polypeptide DAvp-1

1. Configuration this example relates to the reagents:

(1)1 XPBS-EP: 450mL of filtered ultrapure water was added to 50mL of 10 XPBS-EP.

(2) Ligand protein TNFR1 solution: the protein TNFR1 was diluted to 10 μ g/mL and 100mL with pH 5.5 sodium acetate, pH 5.0 sodium acetate, and pH 4.5 sodium acetate, respectively. Since pH 5.0 was determined as the optimal coupling condition by a preconcentration experiment, TNFR1 solution was diluted to 10 μ g/mL with sodium acetate at pH 5.0 to prepare 200 μ L for the formal coupling.

(3) Preparing a polypeptide solution: to 0.8g of DAvp-1, 168. mu.L of water was added to prepare a 1mM solution.

2. And (4) predicting the protein structure. The secondary structure of DAvp-1 was predicted using a protein structure prediction (PSIPRED) server and the results are shown in FIG. 4, consisting of partial helices and curls.

The SWISS-MODEL website was used to mimic the three-dimensional structure of the polypeptide using the template sequence number of 3qxb.1.A, the results are shown in FIG. 5.

The binding model between DAvp-1 and TNFR1 was predicted using HPEPDCOCK Server. The protein crystal structure of human TNFR1(PDB ID: 1TNR) was found by the Uniprot database, the HPEPDCK Server was used to predict the possible binding site between TNFR1 and DAvp-1, and the docking structure was visualized using Pymol 2.3.0 software and the docking results were analyzed. According to molecular docking analysis, G142, F143, E147 of TNFR1 and N34, W35, K27 of DAvp-1 form four hydrogen bonds, respectively. The length of the hydrogen bond is respectively

And

they proved to have good interaction. These structures were visualized using Pymol 2.3.0 and the results are shown in FIG. 6, and the binding model between TNFR1 and DAvp-1 is shown in FIG. 7 (cartoon on the left and surface on the right).

3. Binding of DAvp-1 to TNFR1 was tested.

The biological functions of TNF- α are mediated by two functionally distinct but structurally related cell membrane receptors (TNFR1 and TNFR 2). The extracellular domains of these two receptors are structurally similar, but the cytoplasmic domain of the type I receptor contains the Death Domain (DD), whereas the type II receptor does not contain the DD. TNFR1 is an important signaling receptor for a variety of cells and is associated with most cytotoxic, pro-inflammatory and apoptotic effects. Thus, TNFR1 was selected as a specific target for screening for biological activity in the present invention. The binding force between TNFR1 and DAvp-1 was verified by SPR experiments using a Biacore T200 instrument.

(1) And (4) pre-enriching the ligand. When the ligand was coupled to a CM5 chip on a carboxyl surface, the protein was dissolved in a solution with a pH below its isoelectric point. The net charge of the protein surface is positive, and when the protein surface flows through the CM5 chip surface, the protein surface can be bonded to the carboxyl of the CM5 chip surface with negative charge through electrostatic adsorption. Since too low a pH affects the activity of the protein, pH conditions that bind and minimize damage to the protein were sought through pre-enrichment experiments. The pre-enrichment result shows that: the optimal enrichment conditions for TNFR1 were pH 5.0 and protein concentration 20 μ g/mL. The formal enrichment is carried out by using the condition until the enrichment reaches 1000 units.

(2) The ligand is coupled.

According to

The amount of TNFR1 conjugate was calculated according to the following equation.

Wherein R is_maxFor maximum binding capacity on the chip surface, 100RU is usually substituted in the protein assay. Analyte MW and ligandMW are the molecular weights, S, of protein TNFR1 and polypeptide DAvp-1, respectively_mFor the stoichiometric ratio, 1 was chosen. R_LThe actual coupling amount is 1-2 times of R in experiment as ligand coupling level_LCalculated, the target coupling amount R_LFor 597.17RU, TNFR1 conjugated to 1000RU was determined. Manual coupling was chosen and the flow rate was set at 10. mu.L/min.

Activating 1-2 channels of the chip: EDC and NHS mixtures were injected and run for 420 s. Coupling of proteins in 2-channel: a20. mu.g/mL solution of TNFR1 protein at pH 5.0 was injected in channel 2 and run for 60s and then 30s until the target conjugation amount was reached. Reinforcing: ethanolamine 420s was injected in 1-2 channels.

(3) And testing the surface of the chip. The manual mode is started, the Flow rate is set to 10. mu.L/min, the Flow path is selected 1-2, and 2-1 is selected in the Reference subset. The Rack selects Sample and Reagent Rack1, click Start. After the manual mode starts, the toolbar View → Show Only Current, and in the Current window, the tracked Fc is selected to be 2-1.

10mL of HBS-EP + buffer (running buffer on the left tray) was placed in the tube. mu.L of the stock analyte (analyte) and 990. mu.L of HBS-EP + buffer were mixed together in a tube, labeled A1, at 85 nM. mu.L of the solution was removed from the A1 tube, and 180. mu.L of HBS-EP + buffer was added and mixed in the tube, labeled A2, at a concentration of 8.5 nM. mu.L of the solution was removed from the A2 tube, and 180. mu.L of HBS-EP + buffer was added and mixed in the tube, labeled A3, at a concentration of 0.85 nM. 200 μ L of Glycine-HCl (pH 2.5) was placed in a tube and labeled R.

The tube rack is withdrawn, a1 is placed in R1D1, a2 is placed in R1D2, A3 is placed in R1D3, R is placed in R1E1, and the tube rack is placed back in the sample chamber. Click on sample injection icon, select A1 sample at R1D1, set injection time to 180s, click OK. Click wait icon, wait time selection 60s, click OK. Clicking the Regeneration information icon, selecting the position R1E1, setting the sampling time to be 30s, and clicking OK. A2 and A3 samples were injected in the same way. Click on the End Manual Run icon, and End.

The chip surface test results show that: the 2 channels of the experimental chip have different responses to positive references with different concentrations, and the 2 channels are proved to be successfully coated with TNFR1 protein.

(4) Binding experiments were performed using surface plasmon resonance to demonstrate that study DAvp-1 is able to bind TNFR 1.A New Wizard Template dialog box in the program is opened, Kinetics/Affinity is selected in the Assay column, and New is selected. In Injection Sequence, Flow path selects 2-1, CM5 is selected, and click Next to the Next step. Launch is run in the setup dialog. Before running the formal samples, run samples were simulated at the beginning for several startup cycles in order to stabilize baseline and system status, at which time buffer was used instead of analyte samples. A Buffer is input to the solution, which is HBS-EP in the present embodiment, and the Number of Cycles is set to 3. Click Next and go to the Next step. In the Injection Parameters dialog, the relevant Parameters for Injection, dissociation and regeneration are set. In Sample, Contact time is set to 180 s. The dissociation time was set to 120 s. The Regeneration reagent conditions identified in Regeneration were Glycine-HCl 2.5. The Contact time was set to 30s and the Flow rate was set to 30. mu.L/min. NaOH was selected as the regenerant, and a Stabilization period of 60 seconds was set in the Stabilization period. Click Next and go to the Next step. Sample name and concentration information is filled in a Samples dialog box. The analyte in this example was DAvp-1, molecular weight 4747.43Da, and concentrations were 0. mu.M, 0.0075. mu.M, 0.015. mu.M, 0.03. mu.M, 0.06. mu.M, 0.12. mu.M, 0.24. mu.M, 0.48. mu.M, 0.9765. mu.M, 1.95. mu.M, 3.9. mu.M, 7.8. mu.M, 15.625. mu.M, 31.25. mu.M, 62.5. mu.M, 125. mu.M, and 250. mu.M, respectively. And (4) clicking Next to enter the Next step after the injection concentration is selected from low to high.

This embodiment uses BIAcore T200 and CM5 sensor chips. When different concentrations of DAvp-1 were passed through TNFR1 immobilized on a biosensor chip, a dose-dependent resonance was induced (as shown in FIG. 8), demonstrating that DAvp-1 binds directly to TNFR 1. Binding curves were analyzed using BIA evaluation3.2software to determine a KD of 45.38. mu.M, demonstrating good binding between DAvp-1 and TNFR 1.

Example four: verification of the anti-inflammatory Activity of the anti-inflammatory polypeptide DAvp-1 Using animal experiments

The anti-inflammatory activity of DAvp-1 was verified using a mouse model of ulcerative colitis induced by Dextran Sodium Sulfate (DSS). Mice drink high molecular weight dextran sodium sulfate, which is a high salt substance, causing imbalance of intracellular and extracellular osmotic pressures, and the body generates immune defense reaction to the stimulation, thereby causing inflammation. The pathological changes of the intestinal tract of the model are most similar to the pathological changes of the human ulcerative colitis.

1. This example relates to the following reagents:

(1) injection solution 1: 1.6mg of DAvp-1 polypeptide was dissolved in 24mL of physiological saline to prepare 200/3. mu.g/mL of solution 1.

(2) Injection solution 2: 3mL of the solution 1 was diluted 4-fold to 12mL to prepare 50/3. mu.g/mL of solution 2.

(3) Injection solution 3: 2mL of the solution 2 was diluted 5-fold to 10mL to prepare 10/3. mu.g/mL of solution 3.

(4) Injection solution 4: 1mL of the solution 3 was diluted 10-fold to 10mL to obtain 1/3. mu.g/mL solution 4

(5) 2.5% DSS solution: 2.5g DSS was dissolved in 100mL water.

2. And (3) constructing a colitis model of a mouse to verify the anti-inflammatory activity of the polypeptide.

The experiment was divided into five groups of 3 mice each, one control group, one DSS model group, and three dosing groups. The grouping is specifically shown in table 14. In the remaining groups, except the control group, mice were given 2.5% DSS solution for 10 consecutive days, and Disease Activity Index (DAI), i.e., a composite score of body weight change, stool consistency and bleeding, was monitored throughout the experiment, with the score criteria shown in table 15. The administration group was injected with different concentrations of DAvp-1 solution intraperitoneally, and the model group and the blank group were injected with physiological saline.

TABLE 14 mouse grouping

Group name	Drinking water	Abdominal cavity injection medicine
			Control group	Water (W)	Physiological saline
DSS group	2.5％DSS	Physiological saline
			Administration group
1	2.5％DSS	Polypeptide solution (10 mug/kg)
			Administration group 2	2.5％DSS	Polypeptide solution (100 mug/kg)
Administration group 3	2.5％DSS	Polypeptide solution (500 mug/kg)

TABLE 15 disease Activity index Scoring criteria (DAI)

Scoring	Change in body weight%	Consistency of stool	Hematochezia
					0	0	Is normal	Is free of
1	1
				2	2	Is not solid	Occult blood
3	3
				4	4	Diarrhea (diarrhea)	Severe hemorrhage

Mice were sacrificed on day 10. After the mice were sacrificed, colon tissues were sampled, the samples were fixed with 4% paraformaldehyde, and after the fixation was good, trimming, dehydrating, embedding, sectioning, staining, and mounting were performed. The tissue sections were observed under different magnification of the microscope in detail, and the sections were scored for basic pathological changes, etc., with the scoring criteria shown in Table 16.

TABLE 16 colonic tissue injury score criteria

Scoring	Severity of inflammation	Degree of inflammation	Recessive injury
					0	Is free of	Is free of	Is free of
1	Light and slight	Mucous membrane	Foundation	1/3
					2	Medium and high grade	Mucosa and submucosa	Foundation	2/3
3	Severe severity of disease	Through the wall	Crypts are lost, but surface epithelium is present
				4			Loss of crypt and surface epithelium

According to the statistics of scores, the trend of hematochezia is reduced along with the increase of the concentration of the medicine (figure 8), the condition of stool consistency is improved (figure 9), and the weight change is also normal (figure 10).

Pathological sections of colon tissues of each group of mice are shown in FIGS. 11-15. FIG. 11 shows a control group, a, b, c are colon histopathological sections with a scale of 200 μm under a 5-fold microscope for three individuals of the control group, respectively, and d, e, f are colon histopathological sections with a scale of 50 μm under a 20-fold microscope for three individuals of the control group, respectively. The control group pathological section showed normal. A, d of fig. 11: the structures of all layers of the intestines are clear and compact, the mucous membrane epithelium is complete, the intestinal glands are rich and are arranged regularly, goblet cells in the intestinal gland epithelium are clear and visible, and larger lymph nodes (solid arrows of a) can be seen in the submucosa of the intestinal glands, and no other obvious abnormalities are seen; b, e of fig. 11: the structures of all layers of the intestines are clear and compact, the mucous membrane epithelium is complete, the intestinal glands are rich and are arranged regularly, goblet cells in the intestinal gland epithelium are clear and visible, and larger lymph nodes (solid arrows of b) can be seen in the lower layer of the mucous membrane, and no other obvious abnormalities are seen; c, f of fig. 11: the structure of each layer of the intestine is clear and compact, the mucous epithelium is complete, the intestinal glands are rich and are arranged orderly, goblet cells in the intestinal gland epithelium are clear and visible, and other obvious abnormalities are not seen.

FIG. 12 shows the pathological sections of colon at 5-fold lower scale of 200 μm for three individuals of DSS group, and the pathological sections of colon at 20-fold lower scale of 50 μm for three individuals of DSS group, respectively, for a, b, c. The DSS group was seen to show significant inflammatory manifestations. A, d of fig. 12: necrotic exfoliation of intestinal mucosal epithelium (solid arrow of d), increased lamina propria inflammatory cells (open arrow of d), infiltration of small numbers of neutrophils to the intestinal glandular epithelium (solid triangle of d); a small amount of neutrophil infiltration into the submucosa (open triangles of a) was seen; b, e of fig. 12: extensive myolayer smooth muscle cell edema degeneration, cytopenia, palliation (solid arrow of e), local smooth muscle interstitial edema, smooth muscle lytic breakdown, and concomitant inflammatory cell infiltration (open arrow of b); c, f of fig. 12: large-area ulcer of intestinal mucosa, injury invasion and muscle layer; mucosal intestinal glands disappear with massive inflammatory cell infiltration (solid arrow of f), mucosal muscularis smooth muscle extensive vacuolar degeneration (open arrow of f), submucosa with massive inflammatory cell infiltration (solid triangle of f), muscularis smooth muscle cell swelling degeneration, cytopenia palliative infection (open triangle of f).

FIG. 13 shows administration group 1(DAvp-1, 10ug/kg), a, b, and c are colon histopathological sections of 200 μm on a 5-fold microscopic scale for three individuals of administration group 1, respectively, and d, e, and f are colon histopathological sections of 50 μm on a 20-fold microscopic scale for three individuals of administration group 1, respectively. The pathological manifestations of the administered group 1 were slightly better than those of the DSS group, and the inflammatory manifestations of the individual sensitive to administration disappeared. A, d of fig. 13; the intestinal muscle layer is uneven in thickness, smooth muscle cell swelling and degeneration are frequently seen, and cytoplasm is loose and lightly stained (solid arrows of a and d); b, e of fig. 13: uneven thickness of the intestinal muscle layer, swelling and degeneration of smooth muscle cells, cytopenia, light staining (solid arrow of e); c, f of fig. 13: no significant abnormality was seen compared to the control group.

FIG. 14 shows the colon histopathological sections of 2 individuals (DAvp-1, 100ug/kg) administered, 5-fold lower scale 200 μm for a, b, and c, and 50 μm for d, e, and f, 20-fold lower scale 20 μm for 2 individuals administered. The inflammatory manifestations were further reduced in the administered group 2 compared to the DSS group. A, d of fig. 14; no obvious abnormality was seen compared to the control group; b, e of fig. 14: local thickening of the gut muscle layer, smooth muscle proliferation (solid arrows of e); c, f of fig. 14: no significant abnormality was seen compared to the control group.

FIG. 15 shows administration group 3(DAvp-1, 500ug/kg), a, b, and c are colon histopathological sections of 200 μm on a 5-fold microscopic scale for three individuals of administration group 3, respectively, and d, e, and f are colon histopathological sections of 50 μm on a 20-fold microscopic scale for three individuals of administration group 3, respectively. No significant abnormality was seen compared to the control group. According to the statistical analysis of pathological scores, the administration concentration of 500ug/kg can reduce the damage of DSS to the colon of the mouse to the maximum extent. DAvp-1 was shown to have some anti-inflammatory activity in mice.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various changes, modifications, alterations, and substitutions which may be made by those skilled in the art without departing from the spirit of the present invention shall fall within the protection scope defined by the claims of the present invention.

Sequence listing

<110> institute of biological research of Chengdu of Chinese academy of sciences

<120> anti-inflammatory polypeptide DAvp-1 in snake venom and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 123

<212> DNA

<213> anti-inflammatory polypeptide (DAvp-1)

<400> 1

aattcactag tccttcgagg gaggatgaga gacgtaaagg tacgggatga tggaagaaaa 60

tcacccagcc accatagcaa attttcagga ggaacaagaa actggcaaaa actagtcaag 120

ctt 123

<210> 2

<211> 41

<212> PRT

<213> anti-inflammatory polypeptide (DAvp-1)

<400> 2

Asn Ser Leu Val Leu Arg Gly Arg Met Arg Asp Val Lys Val Arg Asp

1 5 10 15

Asp Gly Arg Lys Ser Pro Ser His His Ser Lys Phe Ser Gly Gly Thr

20 25 30

Arg Asn Trp Gln Lys Leu Val Lys Leu

35 40

Claims (3)

1.A polypeptide, DAvp-1, characterized in that: the DNA sequence is shown in SEQ ID NO 1.

2. The polypeptide DAvp-1 according to claim 1, characterized in that: the amino acid sequence is shown as SEQ ID NO. 2.

3. Use of the polypeptide DAvp-1 according to claim 1 or 2 for the preparation of an anti-inflammatory agent.

Images