CN113373241A - Microsatellite marker of fishes in loach, and amplification primer and application thereof - Google Patents
Microsatellite marker of fishes in loach, and amplification primer and application thereof Download PDFInfo
- Publication number
- CN113373241A CN113373241A CN202110724262.2A CN202110724262A CN113373241A CN 113373241 A CN113373241 A CN 113373241A CN 202110724262 A CN202110724262 A CN 202110724262A CN 113373241 A CN113373241 A CN 113373241A
- Authority
- CN
- China
- Prior art keywords
- seq
- amplification
- microsatellite
- microsatellite marker
- upstream
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a microsatellite marker of fishes in the genus of Hemisgurnus, an amplification primer and application thereof. The invention screens 17 microsatellite markers from genome DNA of 3 kinds of fishes (red-tailed Holothuria, short-body Holothuria and Belleville) in the genus of the Holothuria, designs specific primers in flanking regions at two ends of a microsatellite repetitive sequence for amplification, and obtains an amplification product which has higher polymorphism and better stability and can be used in the fields of population genetic diversity, genetic structure, genetic resource protection and the like of the 3 kinds of fishes in the genus of the Holothuria.
Description
Technical Field
The invention belongs to the technical field of molecular biology DNA marking, and particularly relates to a microsatellite marker of fishes belonging to the genus Hemisalanx, and an amplification primer and application thereof.
Background
The loach (Homatula) belongs to the order Cypriniformes (Cobitoidea) and the family Misgurnaceae (Nemachilidae), is a special Chinese group, and is widely distributed in water systems of Yangtze river, yellow river, Zhujiang river and Lancang river. In recent years, research on the genus of the semifascias has been focused mainly on interspecies-to-intraspecies morphological differences and classification status of the genus species, but there have been few studies on genetic diversity and genetic structure thereof, and there have been few studies on markers developed based on nuclear genes. The method is characterized in that 3 kinds of fishes belonging to the genus Hemisalangium, namely, the red-tailed Hemisalangium loach, the short-body Hemisalangium loach and the Beishi Hemisalangium loach which are distributed in the middle and upper reaches of the Yangtze river are all special Chinese species, wherein the short-body Hemisalangium loach is special fishes in the upper reaches of the Yangtze river, and the research on the genetic diversity can provide analysis data for the phylogenetic relationship of the fishes belonging to the genus Hemisalangium and lay a foundation for the research on the evolutionary biology and biophysical problems of the fishes belonging to the genus and the family.
Microsatellite markers (also known as Short Tandem Repeats (STRs) or Simple Sequence Repeats (SSRs). It is a tandem repeat sequence formed by connecting short nucleotides of 1-6 bases end to end as a basic unit, and length polymorphism of each site is caused by different repeat times and incomplete repeat degree. Because the sequences at both ends of each microsatellite are mostly relatively conservative single copy sequences, a pair of specific primers can be designed according to both ends of each microsatellite, the microsatellite sequences of corresponding sites are amplified by a PCR technology, and the polymorphism of individual microsatellites of different genotypes can be displayed by electrophoretic analysis. Therefore, the obtained polymorphic microsatellite marker for the fishes in the genus of the Hemisgurnus has important significance in population genetic diversity research, genetic resource protection and biogeological research of the fishes in the family of the Hemisguridae.
Disclosure of Invention
The invention aims to provide a polymorphic microsatellite marker for fishes in the genus of the Hemisgurnus as well as an amplification primer and application thereof, namely, 17 microsatellite markers for fishes in the genus of the Hemisgurnus and a corresponding amplification primer pair are provided, so that an effective tool is provided for research on population genetic diversity and genetic resource protection of fishes in the genus of the Hemisgurnus.
In order to solve the technical problems, the invention provides the following technical scheme:
providing a microsatellite marker for fishes in the genus of the Hemisgurnus, wherein the nucleotide sequences of the microsatellite marker are respectively shown as SEQ ID NO: 1-17.
According to the scheme, the fishes of the Holothuria genus are the Red-tailed Holothuria, the short-body Holothuria and the Belleville.
The invention also provides a primer pair for amplifying the polymorphic microsatellite markers of the fishes in the genus of the Hemisgurnus, wherein the primer pair comprises the following components:
the upstream and downstream sequences are SEQ ID NO: 18(Hom004-F), SEQ ID NO: 19(Hom004-R) for amplifying a nucleic acid molecule having a nucleotide sequence set forth in SEQ ID NO: 1(Hom 004);
the upstream and downstream sequences are SEQ ID NO: 20(Hom005-F), SEQ ID NO: 21(Hom005-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 2(Hom005) microsatellite marker;
the upstream and downstream sequences are SEQ ID NO: 22(Hom074-F), SEQ ID NO: 23(Hom074-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 3(Hom 074);
the upstream and downstream sequences are SEQ ID NO: 24(Hom121-F), SEQ ID NO: 25(Hom121-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 4(Hom 121);
the upstream and downstream sequences are SEQ ID NO: 26(Hom127-F), SEQ ID NO: 27(Hom127-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 5(Hom127) microsatellite marker;
the upstream and downstream sequences are SEQ ID NO: 28(Hom131-F), SEQ ID NO: 29(Hom131-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 6(Hom 131);
the upstream and downstream sequences are SEQ ID NO: 30(Hom154-F), SEQ ID NO: 31(Hom154-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 7(Hom 154);
the upstream and downstream sequences are SEQ ID NO: 32(Hom157-F), SEQ ID NO: 33(Hom157-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 8(Hom157) microsatellite marker;
the upstream and downstream sequences are SEQ ID NO: 34(Hom158-F), SEQ ID NO: 35(Hom158-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 9(Hom 158);
the upstream and downstream sequences are SEQ ID NO: 36(Hom161-F), SEQ ID NO: 37(Hom161-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 10(Hom161) microsatellite marker;
the upstream and downstream sequences are SEQ ID NO: 38(Hom166-F), SEQ ID NO: 39(Hom166-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 11(Hom166) microsatellite marker;
the upstream and downstream sequences are SEQ ID NO: 40(Hom169-F), SEQ ID NO: 41(Hom169-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 12(Hom169) microsatellite marker;
the upstream and downstream sequences are SEQ ID NO: 42(Hom172-F), SEQ ID NO: 43(Hom172-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 13(Hom172) microsatellite marker;
the upstream and downstream sequences are SEQ ID NO: 44(Hom176-F), SEQ ID NO: 45(Hom176-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 14(Hom 176);
the upstream and downstream sequences are SEQ ID NO: 46(Hom189-F), SEQ ID NO: 47(Hom189-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 15(Hom189) microsatellite marker;
the upstream and downstream sequences are SEQ ID NO: 48(Hom191-F), SEQ ID NO: 49(Hom191-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 16(Hom 191);
the upstream and downstream sequences are SEQ ID NO: 50(Hom192-F), SEQ ID NO: 51(Hom192-R) for amplifying a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 17(Hom 192).
The invention provides an application of the microsatellite marker or a primer pair for amplifying the microsatellite marker in detecting the genetic diversity of the fish population of the loach.
According to the scheme, the application comprises the following steps:
(1) extracting genome DNA of the fish of the genus Hemisgurnus, wherein the number of the fish of the genus Hemisgurnus is 3, and the fish is respectively red-tailed Hemisgurnus anguillicaudatus, short-body Hemisgurnus anguillicaudatus and Belleville;
(2) micro-satellite PCR amplification: the sequence is SEQ ID NO: respectively carrying out fluorescent labeling on the 18-51 primer pairs, and carrying out PCR amplification by using the genomic DNA of the 3 kinds of fishes in the genus of the loach obtained in the step (1) as a template to obtain microsatellite amplification products;
(3) detecting the amplification product by a sequencer: storing the amplification product obtained in the step (2) in a dark place, and performing capillary electrophoresis and STR analysis;
(4) genetic diversity analysis: determining the genotype according to the molecular weight of each individual microsatellite amplification product of the fishes in the genus of the Hemisalanx, and calculating genetic diversity parameters.
Preferably, in the step (1), a magnetic bead method genome DNA extraction kit (manufacturer, NanoMagBio) is adopted to extract the genome DNA of the fin tissue of the loach fish;
preferably, the fluorescent label in step (2) is a FAM label.
Preferably, step (3) is performed by capillary electrophoresis and STR analysis using an ABI 3730XL sequencer.
Preferably, the genetic diversity parameter is calculated in step (4) using Cervus 3.0.
The invention provides application of the microsatellite marker or a primer pair for amplifying the microsatellite marker in analysis of genetic resource protection of the fishes of the genus loach.
The invention has the beneficial effects that:
the invention screens 17 microsatellite markers from the genome DNA of 3 kinds of fishes (red-tail Hemisalanx loach, short-body Hemisalanx loach and Belleville) of the Hemisalanx, designs an applicability primer according to flanking regions at two ends of a microsatellite repetitive sequence and amplifies the microsatellite repetitive sequence, and the obtained amplification product has higher polymorphism and better stability and can be used in the fields of population genetic diversity, genetic structure, genetic resource protection and the like of the 3 kinds of fishes of the Hemisalanx.
Detailed Description
The invention will now be further illustrated by the following non-limiting examples, and it will be apparent to those skilled in the art that many modifications can be made without departing from the spirit of the invention, such modifications also falling within the scope of the invention.
For the implementation of the conditions not specified in the examples, it is generally possible to operate under conventional conditions, such as those described in the molecular cloning implementation guide, written by J. Sambruke (Sambrook), et al, or according to the conditions recommended by the manufacturer.
Example 1
1. Search of sequences containing microsatellite repeat units
Searching a microsatellite repetitive unit sequence from the sequence of the constructed gene library of the 3 fishes in the genus of the loach by using software SSRHounter 1.3; the parameters are set to find sequences containing two, three and four base repeats at 5 or more times. And screening out 192 sequences containing the microsatellite repetitive units in total, and designing primers from the sequences for detecting polymorphism, wherein 3 kinds of fishes of the genus Hemisalangium are Hemisalangium anguillicauda, short-body Hemisalangium anguillicauda and Behcet anguillicauda.
2. Designing a microsatellite primer:
from the gene sequences containing the microsatellite repeat unit, a sequence conforming to the Primer design was selected for Primer design using Primer Premier 5.0. The main parameters are set as follows: the length of the primer is 17-25bp, 20bp is the optimal length, the length range of the PCR product fragment is 100-350bp, and the optimal annealing temperature is 55-65 ℃. The GC content is generally between 40% and 60%, and secondary structures are avoided as much as possible.
3. Carrying out polymorphism detection on the amplification product of the designed primer:
(1) extraction of genomic DNA:
extracting genome DNA of fin tissues of 32-tailed red-tailed Neptunea anguillicaudatus, 33-tailed Belleville and 21-tailed short-bodied Neptunea anguillicaudatus by using a magnetic bead method genome DNA extraction kit (manufacturer, NanomagBio);
(2) micro-satellite PCR amplification:
two-step amplification using FAM fluorescent linker primers, where M13 sequences 5 '-3': tgtaaaacgacggccatt, amplification system and procedure were as follows:
the first step is as follows: amplification with adapter primers
Firstly, the amplification system is as follows:
the amplification procedure is as follows:
the second step is that: fluorescent primer amplification
Firstly, the amplification system is as follows:
| reagent | Volume (μ l) |
| 2 XTAQQ PCR Master Mix (manufacturer, GeneTech) | 5.0 |
| First step PCR product | 1.0 |
| M13 fluorescent primer (concentration 10 pmol/. mu.l) | 0.3 |
| Downstream primer (concentration 10 pmol/. mu.l) | 0.3 |
| ddH2O | 3.4 |
| Total volume | 10.0 |
The amplification procedure is as follows:
(3) detecting the amplification product by a sequencer:
and storing the amplified product in a dark place, and performing capillary electrophoresis and STR analysis on the amplified product in an ABI 3730XL sequencer to determine the sizes of the alleles of the microsatellite markers of the fishes in the genus of the loach on different individuals.
(4) Genetic diversity analysis:
determining the genotype according to the allele size of each microsatellite amplification product, and calculating genetic diversity parameters by adopting Cervus 3.0 so as to screen out the microsatellite primers with polymorphism and corresponding microsatellite markers.
Through diversity detection, the invention screens out 17 microsatellite markers with genetic polymorphism, and the nucleotide sequences of the microsatellite markers are respectively shown as SEQ ID NO: 1-17, and the information of the corresponding amplification primers is shown in Table 1.
TABLE 1 microsatellite markers of fish of the genus Hemisgurnus and primers corresponding thereto
The 17 microsatellite markers were analyzed for genetic diversity in 86 samples of 3 species of fish belonging to the genus Hemisalanx, and the results are shown in Table 2. Table 2 the results show that: the number of alleles per microsatellite marker (N) varied from 4 to 20, the average number of alleles was 10, the observed Heterozygosity (HO) ranged from 0.108 to 0.44, the average was 0.287, the desired Heterozygosity (HE) ranged from 0.318 to 0.889, the average was 0.689, the polymorphic information content PIC ranged from 0.308 to 0.871, and the average was 0.646. Thus proving that the microsatellite marker screened by the invention and the designed primer have higher genetic polymorphism.
Table 217 information on fragment length and polymorphism of microsatellite markers
The microsatellite marker and the amplification primer thereof can also be used for the research in the fields of genetic structure analysis, genetic resource protection, biogeography of loach family fishes and the like of the 3 kinds of fishes of the genus Hemisalanx.
Sequence listing
<110> institute of Water engineering ecology of national academy of sciences in Water conservancy department
<120> Holothuria fish microsatellite marker, and amplification primer and application thereof
<160> 51
<170> PatentIn version 3.5
<210> 1
<211> 175
<212> DNA
<213> Holotrichia ananatis Homatula fish microsatellite molecular marker Hom004
<400> 1
GTGCACTGAACGCATGAAATATTCTGCTGAATAATCTTCAGTTTAGTGTTTTCTAATGGTCCGGTGTTTTATGCATTGTGTGTGTGTGTAGATCTGGCGGACGTTCCTGAAGTGTTGGGACTACCCTGTCAAGGATAACACTGTGAAGTTGGCCATCGTCTGGTTCTCACTGTCG
<210> 2
<211> 179
<212> DNA
<213> Holotrichia species Homatula fish microsatellite molecular marker Hom005
<400> 2
CGATTTGCATGCAAAGATGTTCATCATAACTGTGTGTTCATGACATGGTTCAAACTAATGAAAACCAACGGATTTGAGTCTCTAAAGTCTCTAAACACAGCCTGCTAAAATGACATCTGAACATCAAGAGAGAGAGAGAGAGAGATGAACGAGTGTGTGTGATGAATTACAAAGAAAGA
<210> 3
<211> 119
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom074 of Holmatula
<400> 3
ACAAGCGGGTTCACCATAAGCGTGGAATAGCACTTCTGTGACAAAGTGACGCACACACACACACATATAGCAAGGTGGACAAGCGGCATCCAGCTGGCCCGTGTTCCAGCGAGTGAATA
<210> 4
<211> 163
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom121 of Holmatula fishes
<400> 4
GCCTCTGTGGAAACGTCTGTCTGAGAGCTTCATTGATCAAGTGAAACCGAGACACTCCAACTTCACTGAGATTAAAACAGAGTGTGTATTATACAAACACACACAAACACACACACACACACACAGGATTATGACAACTCCATGTTCTCCTGACCCATCAGGA
<210> 5
<211> 175
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom127 of Holmatula fishes
<400> 5
TTACACTCCAAGGAAACGGCTTGCAACATAGCAGTGGTAACATCTCAATGTCAGACGTGTTTCTTTACGATCTCTCTCTCTCTCGTCCACTTCACCAGCATATCCTCGGTTGGCCTTTGGACGGTGTCTCTGGAGGGAGGCGGTGCATCTGGCTATTTATCACCCAGCACTTCCC
<210> 6
<211> 182
<212> DNA
<213> Holotrichia species Homatula fish microsatellite molecular marker Hom131
<400> 6
AAAGATCTCCAGCGAGACCAGTGAACTGGCGCTCCCAGATGACCTGCTGTACACACACACACGTCAGGTGTTACATCATGGTGCGGACCTCCCACTGACTTTGATTGTTCTGAAATTAATATAATCATTATAATTTGTACACGTAAGATGTCATTTACACACGCACATGTTGGTAACCGAAA
<210> 7
<211> 222
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom154 of Homatula fish
<400> 7
CGTCTCGGAAGTGATGACAATTTACCGCATTCACGGCGGTCAACTGAGAGCTCTGCTCAACAATGAAAGAGAAATCAAATACTCTTCTAATCTGTCTAATCTACACCATCAGTTTCACACACACACACTGAGAGCAGGATGTGTGTGGACAATGGTCTGCTCTCGGGGGCTTCTGTATTGTCTGAGTTTAATGTGGAAACTGATCCATCTTTCCCTTCCCAC
<210> 8
<211> 228
<212> DNA
<213> Holotrichia species Homatula fish microsatellite molecular marker Hom157
<400> 8
AGCTGGAAGAAAGCGTACCACATCTCAGTCAATACCGAGCTTGAACTTACAAAAATCACATGTATAAGAGAAACACTGGTACAAAAATGAATGGCTTTGGGTTGTTATTCCCTTCACAAAGCTGGCCTACATAACTCTAGTTTCTTGTCTTTCTGCTTGAAGTGCATTACTGATAAAACACTTTCTTCCTCTCTCTCTCTCGGGAAGTCCTTGTTGTTTGTGCCACTG
<210> 9
<211> 273
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom158 of the fishes of Homatula
<400> 9
TAAGTGACAGTGCTTTGATTTGCTTTCTCACTTCAGATTATATTCTTTCCTTTCTCTCTCTCTCTCTCTCTCTCTCTCACTCAAAGTAAAATGCATTCCCTCGTTTTAATTTGTTCTTTAATTACCGAGCAGCCGACTTCACAAATCTACTTAAATACAGACGTGCGCTAAGCAAACACTCCATGTCCTGCAGGGAAAATACACTGAAGCTTTTCTTCTCCTGTATCACTTTCATTTCATCTCTTATTCCCGGATTAAAGACATTCACTGAGG
<210> 10
<211> 234
<212> DNA
<213> Holotrichia species Homatula fish microsatellite molecular marker Hom161
<400> 10
TTCTGGTGTTCCTGCAGTTGGTTCCAGCTCTCTCTCTCTCTTTTTCTTTTCATCTGCGTCTGGCTGGAGTGCTGTTCATATGTTTTCAGTCTTCCCATCTCCTATCCCTCTCTCTTATCTGCTCCTAATTCTACTCATTGTATTCCTATGGTTATCCTATTGCTTAATATAGACGGGTAGAAGCTCTCTACGGCTGATCTGAGACCAGTTTTGCTCTTTGATTGGCCATCATCA
<210> 11
<211> 241
<212> DNA
<213> Holotrichia species Homatula fish microsatellite molecular marker Hom166
<400> 11
AGCTGCGATTCTGTGAAACATGACGAAAGTATAATGAGACTGGATTCTCATCAACAAACTGACTTTCTGTTCTCCGTTTTCTCTTGCTCGCACACACACACACAGTCACACACGGGTTGTCTCTCTGATGAGATATCATTTTGTCATTTACCATGCTGCGCAACAAGATGTATATCCCCCACTAATGCATCAGCGACAGCAGCAGTTCTGTCCTTGTCTGTGTGCTCCCTCAAGGCTACAG
<210> 12
<211> 246
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom169 of Homatula fishes
<400> 12
CCTCTCGGTCAGAGAAATGCTGTTCTGAATCTGACAGTATGAAATAAATGAAGCTACTGCACCACATCACGTCTTCATCAGCCTGACGGAGATTAGCATCAGAAAAACCTGCGTGAACGGAAGAGAGTCTTTCATTCAACATTACCTCATCACCAAACTCTTACAACACATCCATTCACACGCCTTTTATCATCATCATCATCATTTATGTGCTTTTGTCCTTACTGGACCTTAACAGCACCTGGA
<210> 13
<211> 251
<212> DNA
<213> Holotrichia species Homatula fish microsatellite molecular marker Hom172
<400> 13
ATACGGGTCATGATGCCATTGTCCCAGCATCTGACACACTCACTTCTCCAGTTACACTCTCCATCTTTCTCTCTCTCTCTCTCCCTGTTTCTCTGTAATAGCCACCTGCTACTCTACCGCTGTCTATTGTGCAGCAGGTTAAAGCTTGAGCTGCCCAAAGGATCATGTCATGCCTTGTTACTCACACTTCTGTCTGTCTGGCCCTGGACCGAAGCAAAGGCTCGGCAGATGCAATCTTCGCTTCTCGGATC
<210> 14
<211> 256
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom176 of Homatula fish
<400> 14
TCCAGAGAACCGTCCCATAACAATCTTAGATAAGATAAGATACCACAGTATGTTAATTGTGATTAATAAATAATTTAACTTGAAGAATCACATGACCACAAGCTATAAAGAAACGTTAAATAGGCTTGGATAAATAATTCACGCTCATCATTCAGTGATGTTGGACTGAATAGCATGTTTATTTCATGTCCGTGTGTGTGTGTGTGTGTGTGTTCGCAGGAGGACTTGAGGATTGCTCTCTGTCAAGGAGGACGCT
<210> 15
<211> 273
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom189 for fishes of Homatula
<400> 15
TTCAGGACGCAGACCTTTCTATGCACCTGTAAAAGCATTGTTCATTCAGATCCTGAGTTCTTTGCAGTACAACACTGCTGACTCTAATGTTTATAATACTGTACCAGCTTACTCAAATAATGAAGATGGTGATTGCTAAGAAAAACATTCCTAATTTTCTATGGAATTTTCTCACGTCTAGGTAGAAAGAAAAAATGAAGTTTATTGGCTTGATTTTAGATAGACTGCAGTGGTTAAGAGAGAGAGAGGAAAAGGAGCCAGGACTCAAACTCA
<210> 16
<211> 276
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom191 for fishes of Homatula
<400> 16
CGTGTACATGATCCATGCGTTTGATTTAATAGTTCGTCATATTGATTGATTGATTGATTGAGTGAGTGCACGTATTATTTCATTTAGTATTGAGTTAAAATTAAGGTGTTTTTATAGGTAAAAGATCAGGATGCTGTTGTGATTTTGGAGAAGACCCCTATCAGACAGGACACACTCAATGAGTTACTAAAGAGCAGTGAACTCAAACTGGAGATGAGGAATGATGTGTACAGCACATACCAGCTGCATGCACCTGCCCATCTGAACCGTATGACC
<210> 17
<211> 277
<212> DNA
<213> Holotrichia microsatellite molecular marker Hom192 of Homatula fish
<400> 17
TGAGGTTGAAGTGGATGCAGCAGTATTCAGGTACAGTGTGTCATCTGCTCTCTTCACTCATATACTACAATACTTTACATTTATATACTGACACATTATTCATTAAATATCACAAACATCATCATCATCATCAGTTGTGATTGATATTCTCTGATCTCTCTCAGTGGATGTGAATCTGGATCCTGATACAGCTCATCCTAAACTCATCCTCTCTGATGATGAGAAACTAGTGAGACATGAAGACATTTATCATCATGTCCCAAAGAATCCAAAGAGG
<210> 18
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom004-F
<400> 18
GTGCACTGAACGCATGAAAT
<210> 19
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom004-R
<400> 19
CGACAGTGAGAACCAGACGA
<210> 20
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom005-F
<400> 20
TTGTCTGTTCCACAAAGCGA
<210> 21
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom005-R
<400> 21
TCTTTGCACCTAATGCCACA
<210> 22
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom074-F
<400> 22
ACAAGCGGGTTCACCATAAG
<210> 23
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom074-R
<400> 23
TATTCACTCGCTGGAACACG
<210> 24
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom121-F
<400> 24
GCCTCTGTGGAAACGTCTGT
<210> 25
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom121-R
<400> 25
TCCTGATGGGTCAGGAGAAC
<210> 26
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom127-F
<400> 26
TTACACTCCAAGGAAACGGC
<210> 27
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom127-R
<400> 27
GGGAAGTGCTGGGTGATAAA
<210> 28
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom131-F
<400> 28
AAAGATCTCCAGCGAGACCA
<210> 29
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom131-R
<400> 29
TTTCGGTTACCAACATGTGC
<210> 30
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom154-F
<400> 30
CGTCTCGGAAGTGATGACAA
<210> 31
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom154-R
<400> 31
GTGGGAAGGGAAAGATGGAT
<210> 32
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom157-F
<400> 32
AGCTGGAAGAAAGCGTACCA
<210> 33
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom157-R
<400> 33
CAGTGGCACAAACAACAAGG
<210> 34
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom158-F
<400> 34
AGGGATTGAGGGAGTGCTTT
<210> 35
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom158-R
<400> 35
CAGTGAATGCGTTTAATCCG
<210> 36
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom161-F
<400> 36
TTCTGGTGTTCCTGCAGTTG
<210> 37
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom161-R
<400> 37
TGATGATGGCCAATCAAAGA
<210> 38
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom166-F
<400> 38
AGCTGCGATTCTGTGAAACA
<210> 39
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom166-R
<400> 39
CTGTAGCCTTGAGGGAGCAC
<210> 40
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom169-F
<400> 40
CCTCTCGGTCAGAGAAATGC
<210> 41
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom169-R
<400> 41
TCCAGGTGCTGTTAAGGTCC
<210> 42
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom172-F
<400> 42
ATACGGGTCATGATGCCATT
<210> 43
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom172-R
<400> 43
GATCCGAGAAGCGAAGATTG
<210> 44
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom176-F
<400> 44
TCCAGAGAACCGTCCCATAA
<210> 45
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom176-R
<400> 45
AGCGTCCTCCTTGACAGAGA
<210> 46
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom189-F
<400> 46
TTCAGGACGCAGACCTTTCT
<210> 47
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom189-R
<400> 47
TGAGTTTGAGTCCTGGCTCC
<210> 48
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom191-F
<400> 48
CGTGTACATGATCCATGCGT
<210> 49
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom191-R
<400> 49
GGTCATACGGTTCAGATGGG
<210> 50
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom192-F
<400> 50
TGAGGTTGAAGTGGATGCAG
<210> 51
<211> 20
<212> DNA
<213> microsatellite primer sequence Hom192-R
<400> 51
CCTCTTTGGATTCTTTGGGA
Claims (6)
1. The microsatellite marker for the fishes in the genus of the Hemisgurnus is characterized in that nucleotide sequences of the microsatellite marker are respectively shown as SEQ ID NO: 1-17.
2. The microsatellite marker according to claim 1 wherein said fish of the genus Nepeta is a red-tailed Nepeta loach, a short-bodied Nepeta loach and a Belleville loach.
3. A primer pair for amplifying the polymorphic microsatellite markers of the fish of the genus loach according to any one of claims 1 to 2, wherein the primer pair is:
the upstream and downstream sequences are respectively shown as SEQ ID NO: 18. SEQ ID NO: 19, the nucleotide sequence for amplification is SEQ ID NO: 1, microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 20. SEQ ID NO: 21, the nucleotide sequence for amplification is SEQ ID NO: 2, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 22. SEQ ID NO: 23, the nucleotide sequence for amplification is SEQ ID NO: 3, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 24. SEQ ID NO: 25, the nucleotide sequence for amplification is SEQ ID NO: 4, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 26. SEQ ID NO: 27, the nucleotide sequence for amplification is SEQ ID NO: 5, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 28. SEQ ID NO: 29, the nucleotide sequence for amplification is SEQ ID NO: 6, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 30. SEQ ID NO: 31, the nucleotide sequence for amplification is SEQ ID NO: 7, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 32. SEQ ID NO: 33, the nucleotide sequence for amplification is SEQ ID NO: 8, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 34. SEQ ID NO: 35, the nucleotide sequence for amplification is SEQ ID NO: 9, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 36. SEQ ID NO: 37, the nucleotide sequence for amplification is SEQ ID NO: 10, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 38. SEQ ID NO: 39, the nucleotide sequence for amplification is SEQ ID NO: 11, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 40. SEQ ID NO: 41, the nucleotide sequence for amplification is SEQ ID NO: 12, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 42. SEQ ID NO: 43, the nucleotide sequence for amplification is SEQ ID NO: 13, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 44. SEQ ID NO: 45, the nucleotide sequence for amplification is SEQ ID NO: 14, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 46. SEQ ID NO: 47, the nucleotide sequence for amplification is SEQ ID NO: 15, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 48. SEQ ID NO: 49, the nucleotide sequence for amplification is SEQ ID NO: 16, a microsatellite marker;
the upstream and downstream sequences are respectively shown as SEQ ID NO: 50. SEQ ID NO: 51, the nucleotide sequence for amplification is SEQ ID NO: 17, microsatellite marker.
4. Use of a microsatellite marker according to any one of claims 1 to 2 or a primer pair for amplifying said microsatellite marker according to claim 3 for detecting genetic diversity in a fish population of the genus Leptobotia.
5. The application according to claim 4, characterized in that it comprises the following steps:
(1) extracting genome DNA of the fish of the genus Hemisgurnus, wherein the number of the fish of the genus Hemisgurnus is 3, and the fish is respectively red-tailed Hemisgurnus anguillicaudatus, short-body Hemisgurnus anguillicaudatus and Belleville;
(2) micro-satellite PCR amplification: the sequence is SEQ ID NO: respectively carrying out fluorescent labeling on the 18-51 primer pairs, and carrying out PCR amplification by using the genomic DNA of the 3 kinds of fishes in the genus of the loach obtained in the step (1) as a template to obtain microsatellite amplification products;
(3) detecting the amplification product by a sequencer: storing the amplification product obtained in the step (2) in a dark place, and performing capillary electrophoresis and STR analysis;
(4) genetic diversity analysis: determining the genotype according to the molecular weight of each individual microsatellite amplification product of the fishes in the genus of the Hemisalanx, and calculating genetic diversity parameters.
6. Use of a microsatellite marker according to any one of claims 1 to 2 or a primer pair for amplifying said microsatellite marker according to claim 3 for analyzing genetic resource conservation in fish of the genus Leptobotia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110724262.2A CN113373241B (en) | 2021-06-29 | 2021-06-29 | Microsatellite marker of fishes in loach, and amplification primer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110724262.2A CN113373241B (en) | 2021-06-29 | 2021-06-29 | Microsatellite marker of fishes in loach, and amplification primer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113373241A true CN113373241A (en) | 2021-09-10 |
| CN113373241B CN113373241B (en) | 2022-07-08 |
Family
ID=77579735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110724262.2A Active CN113373241B (en) | 2021-06-29 | 2021-06-29 | Microsatellite marker of fishes in loach, and amplification primer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113373241B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114480668A (en) * | 2022-01-24 | 2022-05-13 | 水利部中国科学院水工程生态研究所 | Microsatellite marker of leptopossum anguillicaudatus and fish as well as amplification primer and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108559782A (en) * | 2018-04-26 | 2018-09-21 | 水利部中国科学院水工程生态研究所 | Short body pair loach microsatellite locus and its primer and application |
| KR102230553B1 (en) * | 2019-10-22 | 2021-03-22 | 목포대학교 산학협력단 | Method for identification of individual genetic diversity using microsatellite marker in spotted halibut |
-
2021
- 2021-06-29 CN CN202110724262.2A patent/CN113373241B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108559782A (en) * | 2018-04-26 | 2018-09-21 | 水利部中国科学院水工程生态研究所 | Short body pair loach microsatellite locus and its primer and application |
| KR102230553B1 (en) * | 2019-10-22 | 2021-03-22 | 목포대학교 산학협력단 | Method for identification of individual genetic diversity using microsatellite marker in spotted halibut |
Non-Patent Citations (2)
| Title |
|---|
| WEITAO LI等: "Development and characterization of 10 novel polymorphic", 《J APPL ICHTHYOL》 * |
| 王雪等: "赤水河两种荷马条鳅属鱼类的遗传多样性及谱系生物地理学过程分析", 《水生生物学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114480668A (en) * | 2022-01-24 | 2022-05-13 | 水利部中国科学院水工程生态研究所 | Microsatellite marker of leptopossum anguillicaudatus and fish as well as amplification primer and application thereof |
| CN114480668B (en) * | 2022-01-24 | 2023-05-02 | 水利部中国科学院水工程生态研究所 | Microsatellite marker for fine tail plateau loach fish, amplification primer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113373241B (en) | 2022-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105695572B (en) | Method for developing molecular markers in large scale and efficiently based on Indel and SSR site technology | |
| CN110042171A (en) | Identify the method and related molecular marker of Yield Traits of Wheat | |
| KR20180077873A (en) | SNP markers for selection of marker-assisted backcross in watermelon | |
| CN111575400A (en) | Wheat stripe rust resistant QTL molecular marker IWB12253 and application thereof | |
| CN101818195B (en) | Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application | |
| CN113373241B (en) | Microsatellite marker of fishes in loach, and amplification primer and application thereof | |
| CN104846093A (en) | Brassica juncea EST-SSR (expressed sequence tag-simple sequence repeat) marker primer group based on development of transcriptome sequence | |
| CN101671726B (en) | Method for detecting single nucleotide polymorphism (SNP) of ox PRDM16 gene | |
| CN111560464A (en) | Molecular marker IWB59718 and application thereof in detection of wheat stripe rust resistance | |
| CN107937493B (en) | Hairpin modified primer for allele PCR | |
| CN107365873B (en) | Molecular marker linked with foxtail sheath color characteristic of millet and application thereof | |
| CN107058602B (en) | Primer group of wheat puccinia triticina EST-SSR molecular marker and detection method and application thereof | |
| CN105671189A (en) | Molecular breeding method based on single nucleotide polymorphism of cattle Angpt18 genes | |
| CN106755422B (en) | Detection method of MEG3 gene SNP related to cattle growth traits and application thereof | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN114438223B (en) | Microsatellite marker for loach and Dysosma tsugae as well as amplification primer and application thereof | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| CN114480668B (en) | Microsatellite marker for fine tail plateau loach fish, amplification primer and application thereof | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| KR101448964B1 (en) | Novel marker and primer to identify and discriminate cultivars in Brassica napus L. and use thereof | |
| CN111778346A (en) | Molecular marker for detecting stripe rust resistant QTL QYr. hbaas-4BL.1 and using method thereof | |
| CN107574167B (en) | Hyriopsis cumingii microsatellite marker and application thereof | |
| CN106868186B (en) | Andrias davidianus microsatellite marker and application thereof | |
| KR101854896B1 (en) | Single nucleotide polymorphism markers for identifying korean traditional dog breeds and uses thereof | |
| CN104087584A (en) | Dasyatis zugei microsatellite sites, primers and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |