CN113373149A - Expression vector for specifically expressing new coronavirus spike protein by using rice endosperm cells and application thereof - Google Patents

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to an expression vector for specifically expressing a new coronavirus spike protein by using rice endosperm cells and application thereof. The invention provides a recombinant promoter for promoting expression of a new coronavirus spike protein, wherein the nucleotide sequence of the recombinant promoter is shown as SEQ ID No. 1. The method uses the protein body of the rice endosperm cell as the storage point of the recombinant protein, mediates the recombinant new coronavirus spike protein to enter an endomembrane system of the endosperm cell and store the protein body of the endosperm cell through the recombinant promoter expressed by the specificity of the rice endosperm, thereby achieving the purpose of mass production, having stable expression and being stored with high storage tolerance of the prepared new coronavirus spike protein.

Description

Expression vector for specifically expressing new coronavirus spike protein by using rice endosperm cells and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to an expression vector for specifically expressing a new coronavirus spike protein by using rice endosperm cells and application thereof.

Background

The vaccine is one of means for preventing the infection of the new coronavirus, and is a problem which is overcome globally at present. The recombinant coronavirus protein vaccine has the characteristics of high safety, high immunogenicity and the like, and is an important means for preventing new coronavirus. The traditional method is usually expressed in a prokaryotic system or animal cells, however, prokaryotes as bioreactors have no protein post-translational processing system of eukaryotes, and many functional proteins depend on post-translational modifications such as glycosylation and phosphorylation. The incomplete modification/processing systems of yeast cells compared to eukaryotes also limit widespread use. At present, the third generation bioreactor usually utilizes animal cells and transgenic animals for production, however, the problems of contamination of pathogenic bacteria and extremely high production cost cannot be overcome by animal cell culture and transgenic animals, so that the application of the technology in the medical market is limited and the global market demand cannot be met.

The use of plants to express recombinant proteins has the advantages of low production cost, no contamination by pathogenic bacteria, suitability for large-scale production, and the like. For example, KBP company of Kentucky week in the United states transiently expresses new coronavirus protein in tobacco lamina and can trigger immune response, however, the tobacco lamina expression system has the defects of poor storage tolerance and unstable transient expression, thereby limiting the application.

Disclosure of Invention

In order to solve the problems, the invention provides an expression vector for specifically expressing a novel coronavirus spike protein by using rice endosperm cells and application thereof. The recombinant promoter provided by the invention can ensure that the new coronavirus spike protein is stably expressed in rice endosperm cells, so that the new coronavirus spike protein is accumulated in rice seeds in large quantity, and the prepared new coronavirus spike protein is storage-resistant.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides a recombinant promoter for promoting expression of a new coronavirus spike protein, wherein the nucleotide sequence of the recombinant promoter is shown as SEQ ID No. 1.

The invention also provides a primer group for amplifying the recombinant promoter, wherein the nucleotide sequence of an upstream primer of the primer group is shown as SEQ ID NO. 2; the nucleotide sequence of the downstream primer of the primer group is shown as SEQ ID NO. 3.

The invention also provides a method for obtaining the recombinant promoter by utilizing PCR amplification, and the PCR amplification reaction program comprises the following steps: pre-denaturation at 94-95 ℃ for 2 min; denaturation at 94-95 ℃ for 20s, annealing at 56-58 ℃ for 20s, extension at 72 ℃ for 130-150 s, and circulating for 32 times; extension at 72 ℃ for 10 min.

Preferably, the PCR amplification reaction system is 25 μ L, and comprises: 2 XKOD PCR buffer 12.5. mu.L, KOD FX 0.25. mu.L, dNTP 2. mu.L, upstream and downstream primers of the above primer set 0.5. mu.L each, DNA template 2. mu.L and ddH as the remainder₂O。

The invention also provides an expression vector for expressing the new coronavirus spike protein, and the expression vector comprises the recombinant promoter and the coding gene of the new coronavirus spike protein.

Preferably, the nucleotide sequence of the coding gene of the new coronavirus spike protein is shown as SEQ ID NO. 4.

Preferably, the base vector of the expression vector comprises pCUbi-1390.

The invention also provides the application of the recombinant promoter or the primer group or the recombinant promoter obtained by amplification by the method or the expression vector in preparing the novel coronavirus spike protein.

The invention also provides a method for preparing the novel coronavirus spike protein by using the rice endosperm cells, which comprises the following steps:

the promoter is inserted between HindIII and KpnI enzyme cutting sites of pCUbi1390 to obtain pGt1A1390 vector;

inserting the coding gene of the new coronavirus spike protein between Kpn I and BamH I enzyme cutting sites of the pGt1A1390 vector to obtain a pGt1A1390-SP1 vector; the nucleotide sequence of the coding gene of the new coronavirus spike protein is shown as SEQ ID NO. 4;

pGt1A1390-SP1 vector is transformed into rice callus, and rice plant expressing new coronavirus spike protein is obtained through screening.

Preferably, the substance to be screened comprises hygromycin.

Has the advantages that:

the invention provides a recombinant promoter for promoting expression of a new coronavirus spike protein, wherein the nucleotide sequence of the recombinant promoter is shown as SEQ ID No. 1. The method uses the protein body of the rice endosperm cell as the storage point of the recombinant protein, mediates the recombinant new coronavirus spike protein to enter an endomembrane system of the endosperm cell and store the protein body of the endosperm cell through the recombinant promoter expressed by the specificity of the rice endosperm, thereby achieving the purpose of mass production, having stable expression and being stored with high storage tolerance of the prepared new coronavirus spike protein.

Drawings

FIG. 1 is a schematic diagram of the structure of pCUbi1390 vector;

FIG. 2 is a schematic structural diagram of pGt1A1390-SP1 vector construction;

FIG. 3 is a schematic representation of the partial fragment structure of vector pGt1A1390-SP 1;

FIG. 4 is the electrophoresis diagram of PCR detection of SP1 endosperm specific overexpression transgenic plant in example 4;

FIG. 5 is a graph showing the results of analysis of the expression level of SP1 endosperm-specific overexpression part of transgenic plants.

Detailed Description

The invention provides a recombinant promoter for promoting expression of a new coronavirus spike protein, wherein the nucleotide sequence of the recombinant promoter is shown as SEQ ID NO. 1: TTGTTTTTCACCCTCAATATTTGGAAACATTTATCTAGGTTGTTTGTGTCCAGGCCTATAAATCATACATGATGTTGTCGTATTGGATGTGAATGTGGTGGCGTGTTCAGTGCCTTGGATTTGAGTTTGATGAGAGTTGCTTCTGGGTCACCACTCACCATTATCGATGCTCCTCTTCAGCATAAGGTAAAAGTCTTCCCTGTTTACGTTATTTTACCCACTATGGTTGCTTGGGTTGGTTTTTTCCTGATTGCTTATGCCATGGAAAGTCATTTGATATGTTGAACTTGAATTAACTGTAGAATTGTATACATGTTCCATTTGTGTTGTACTTCCTTCTTTTCTATTAGTAGCCTCAGATGAGTGTGAAAAAAACAGATTATATAACTTGCCCTATAAATCATTTGAAAAAAATATTGTACAGTGAGAAATTGATATATAGTGAATTTTTAAGAGCATGTTTTCCTAAAGAAGTATATATTTTCTATGTACAAAGGCCATTGAAGTAATTGTAGATACAGGATAATGTAGACTTTTTGGACTTACACTGCTACCTTTAAGTAACAATCATGAGCAATAGTGTTGCAATGATATTTAGGCTGCATTCGTTTACTCTCTTGATTTCCATGAGCACGCTTCCCAAACTGTTAAACTCTGTGTTTTTTGCCAAAAAAAAATGTATAGGAAAGTTGCTTTTAAAAAATCATATCAATCCATTTTTTAAGTTATAGCTAATACTTAATTAATCATGCGCTAATAAGTCACTCTGTTTTTCGTACTAGAGAGATTGTTTTGAACCAGCACTCAAGAACACAGCCTTAACCCAGCCAAATAATGCTACAACCTACCAGTCCACACCTCTTGTAAAGCATTTGTTGCATGGAAAAGCTAAGATGACAGCAACCTGTTCAGGAAAACAACTGACAAGGTCATAGGGAGAGGGAGCTTTTGGAAAGGTGCCGTGCAGTTCAAACAATTAGTTAGCAGTAGGGTGTTGGTTTTTGCTCACAGCAATAAGAAGTTAATCATGGTGTAGGCAACCCAAATAAAACACCAAAATATGCACAAGGCAGTTTGTTGTATTCTGTAGTACAGACAAAACTAAAAGTAATGAAAGAAGATGTGGTGTTAGAAAAGGAAACAATATCATGAGTAATGTGTGAGCATTATGGGACCACGAAATAAAAAGAACATTTTGATGAGTCGTGTATCCTCGATGAGCCTCAAAAGTTCTCTCACCCCGGATAAGAAACCCTTAAGCAATGTGCAAAGTTTGCATTCTCCACTGACATAATGCAAAATAAGATATCATCGATGACATAGCAACTCATGCATCATATCATGCCTCTCTCAACCTATTCATTCCTACTCATCTACATAAGTATCTTCAGCTAAATGTTAGAACATAAACCCATAAGTCACGTTTGATGAGTATTAGGCGTGACACATGACAAATCACAGACTCAAGCAAGATAAAGCAAAATGATGTGTACATAAAACTCCAGAGCTATATGTCATATTGCAAAAAGAGGAGAGCTTATAAGACAAGGCATGACTCACAAAAATTCATTTGCCTTTCGTGTCAAAAAGAGGAGGGCTTTACATTATCCATGTCATATTGCAAAAGAAAGAGAGAAAGAACAACACAATGCTGCGTCAATTATACATATCTGTATGTCCATCATTATTCATCCACCTTTCGTGTACCACACTTCATATATCATGAGTCACTTCATGTCTGGACATTAACAAACTCTATCTTAACATTTAGATGCAAGAGCCTTTATCTCACTATAAATGCACGATGATTTCTCATTGTTTCTCACAAAAAGCATTCAGTTCATTAGTCCTACAACAACATGGCATCCATAAATCGCCCCATAGTTTTCTTCACAGTTTGCTTGTTCCTCTTGTGCGAT are provided. The recombinant promoter provided by the invention can ensure that the new coronavirus spike protein is stably expressed in rice endosperm cells, so that the new coronavirus spike protein is accumulated in rice seeds in large quantity, and the prepared new coronavirus spike protein is storage-resistant.

The invention also provides a primer group for amplifying the recombinant promoter, wherein the nucleotide sequence of an upstream primer of the primer group is shown as SEQ ID NO. 2: CCCAAGCTTTTGTTTTTCACCCTCAATA, in which the HindIII cleavage site is underlined;

the nucleotide sequence of the downstream primer of the primer group is shown as SEQ ID NO. 3: CGGGGTACCATCGCACAAGAGGAACAAGC, wherein the KpnI cleavage sites are underlined.

The invention also provides a method for obtaining the recombinant promoter by utilizing PCR amplification, wherein a PCR amplification reaction system is calculated by 25 mu L and comprises the following steps: 2 XKOD PCR buffer 12.5. mu.L, KOD FX 0.25. mu.L, dNTP 2. mu.L, upstream primer and downstream primer of the primer set described in the above technical scheme 0.5. mu.L each, DNA template 2. mu.L and ddH as the rest₂O; the concentration of the upstream primer and the concentration of the downstream primer are both preferably 10 mu M; the concentration of the dNTP is preferably 2 mM; the DNA template preferably comprises genomic DNA from Xiuhui 11 rice. In the present invention, the PCR amplification reaction procedure preferably includes: pre-denaturation at 94-95 ℃ for 2 min; denaturation at 94-95 ℃ for 20s, annealing at 56-58 ℃ for 20s, extension at 72 ℃ for 130-150 s, and circulating for 32 times; extending for 10min at 72 ℃; more preferably: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 20s, annealing at 56 ℃ for 20s, and extension at 72 ℃ for 130s, and circulating for 32 times; extending at 72 deg.C for 10min or pre-denaturing at 95 deg.C for 2 min; denaturation at 95 ℃ for 20s, annealing at 58 ℃ for 20s, extension at 72 ℃ for 150s, and circulation for 32 times; extension at 72 ℃ for 10 min. In the present invention, the source of each reagent in the PCR amplification reaction system is not limited, and commercially available products known to those skilled in the art may be used. The 2 XKOD PCR buffer and KOD FX of the present invention are preferably purchased from Toyobo (Shanghai) Biotech Co., Ltd.

The invention also provides an expression vector for expressing the new coronavirus spike protein, and the expression vector comprises the recombinant promoter and the coding gene of the new coronavirus spike protein.

In the present invention, the nucleotide sequence of the coding gene of the novel coronavirus spike protein is preferably as shown in SEQ ID NO. 4: ATGTTTGTGTTCCTCGTCCTCCTCCCGCTCGTCTCCTCCCAGTGCGTCAACCTCACCACCAGGACTCAGCTGCCGCCGGCGTACACCAACAGCTTCACCCGCGGCGTCTACTACCCCGACAAGGTGTTCCGCTCCTCCGTCCTCCACTCCACCCAGGACCTCTTCCTCCCCTTCTTCTCCAACGTCACCTGGTTCCACGCCATCCACGTCTCCGGCACCAACGGCACCAAGAGGTTCGACAACCCGGTGCTCCCCTTCAACGACGGCGTCTACTTCGCCTCCACCGAGAAGAGCAACATCATCCGCGGCTGGATCTTCGGCACCACCCTCGACTCCAAGACACAGAGCCTCCTCATCGTCAACAACGCCACCAACGTCGTCATCAAGGTGTGCGAGTTCCAGTTCTGCAATGATCCTTTCCTCGGCGTCTACTACCACAAGAACAACAAGAGCTGGATGGAGAGCGAGTTCCGCGTCTACTCCTCCGCCAACAACTGCACCTTCGAGTACGTCTCCCAGCCGTTCCTCATGGATCTGGAGGGCAAGCAGGGCAACTTCAAGAACCTCCGCGAGTTCGTCTTCAAGAACATCGACGGCTACTTCAAGATCTACTCCAAGCACACGCCGATCAACCTCGTCCGCGACCTCCCGCAGGGCTTCTCCGCCCTCGAGCCGCTCGTCGACCTCCCCATCGGCATCAACATCACCAGGTTCCAGACCCTCCTCGCCCTCCACCGCAGCTACCTCACCCCCGGCGACTCCTCCTCCGGCTGGACCGCCGGCGCCGCCGCCTACTACGTCGGCTACCTCCAGCCGCGCACCTTCCTCCTCAAGTACAACGAGAACGGCACCATCACCGACGCCGTCGACTGCGCCCTCGACCCGCTCTCCGAGACCAAGTGCACCCTCAAGAGCTTCACCGTGGAGAAGGGCATCTACCAGACCTCCAACTTCAGGGTGCAGCCGACGGAGAGCATCGTCCGCTTCCCCAACATCACCAACCTCTGCCCGTTCGGCGAGGTGTTCAACGCCACCAGGTTCGCCTCCGTCTACGCCTGGAACAGGAAGAGGATCTCCAACTGCGTCGCCGACTACTCCGTCCTCTACAACTCCGCCTCCTTCTCCACCTTCAAGTGCTACGGCGTGTCGCCGACCAAGCTCAACGACCTCTGCTTCACCAACGTGTACGCCGACAGCTTCGTCATCCGCGGCGACGAGGTGAGGCAGATCGCGCCGGGGCAGACCGGCAAGATCGCCGACTACAACTACAAGCTCCCCGACGACTTCACCGGCTGCGTCATCGCCTGGAACAGCAACAACCTCGACTCCAAGGTCGGCGGCAACTACAACTACCTCTACCGCCTCTTCAGGAAGAGCAACCTCAAGCCATTTGAGAGGGACATCTCCACCGAGATCTACCAGGCCGGCAGCACGCCGTGCAACGGCGTGGAGGGCTTCAACTGCTACTTCCCGCTGCAGAGCTACGGCTTCCAGCCGACCAACGGCGTCGGCTACCAGCCGTACAGGGTGGTGGTGCTCTCCTTCGAGCTCCTCCACGCGCCGGCGACGGTGTGCGGCCCCAAGAAGAGCACCAACCTCGTCAAGAACAAGTGCGTCAACTTCAACTTCAACGGCCTCACCGGCACCGGCGTCCTCACCGAGAGCAACAAGAAGTTCCTCCCCTTCCAGCAGTTCGGCCGCGACATCGCCGACACCACCGACGCCGTCCGCGACCCGCAGACGCTGGAGATCCTCGACATCACCCCATGCAGCTTCGGCGGCGTCTCCGTCATCACCCCCGGCACCAACACCTCCAACCAGGTGGCGGTGCTCTACCAGGATGTGAACTGCACCGAGGTGCCGGTGGCCATCCACGCCGACCAGCTCACCCCAACATGGAGGGTGTACTCCACCGGCAGCAATGTGTTCCAGACCCGCGCCGGCTGCCTCATCGGCGCCGAGCACGTCAACAACAGCTACGAGTGCGACATCCCCATCGGCGCCGGCATCTGCGCCTCCTACCAGACCCAGACCAACTCGCCGCGCCGCGCCCGCTCCGTCGCCTCCCAGAGCATCATCGCCTACACCATGAGCCTCGGCGCCGAGAACTCCGTCGCCTACTCCAACAACTCCATCGCCATCCCCACCAACTTCACCATCTCCGTCACCACCGAGATCCTCCCCGTCTCCATGACCAAGACCTCCGTCGACTGCACCATGTACATCTGCGGCGACTCCACCGAGTGCAGCAACCTCCTCCTCCAGTACGGCAGCTTCTGCACCCAGCTCAACCGCGCCCTCACCGGCATCGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGAAGCAGATCTACAAGACGCCGCCGATCAAGGACTTCGGCGGCTTCAACTTCTCCCAGATCCTCCCCGACCCCTCCAAGCCCTCCAAGAGGAGCTTCATCGAGGACCTCCTCTTCAACAAGGTCACCCTCGCCGACGCCGGCTTCATCAAGCAGTACGGCGACTGCCTCGGCGACATCGCCGCCCGCGACCTCATCTGCGCCCAGAAGTTCAACGGCCTCACCGTGCTGCCGCCGCTCCTCACCGACGAGATGATCGCCCAGTACACCTCCGCCCTCCTCGCCGGCACCATCACCTCCGGCTGGACCTTCGGCGCCGGCGCGGCGCTGCAGATTCCTTTCGCCATGCAGATGGCGTACCGCTTCAACGGCATCGGCGTCACCCAGAATGTGCTCTACGAGAACCAGAAGCTCATCGCCAACCAGTTCAACTCCGCCATCGGCAAGATCCAGGACTCCCTCTCCTCCACCGCCTCCGCCCTCGGCAAGCTGCAGGATGTGGTGAACCAGAATGCTCAGGCGCTCAACACCCTCGTCAAGCAGCTCTCCTCCAACTTCGGCGCCATCTCCTCCGTCCTCAACGACATCCTCTCCCGCCTCGACAAGGTGGAGGCGGAGGTGCAGATCGACCGCCTCATCACCGGCCGCCTCCAGTCGCTGCAGACCTACGTCACCCAGCAGCTCATCCGCGCCGCCGAGATCCGCGCCTCCGCCAACCTCGCCGCCACCAAGATGTCGGAGTGCGTCCTCGGCCAGAGCAAGAGGGTGGACTTCTGCGGCAAGGGCTACCACCTCATGAGCTTCCCGCAGTCGGCGCCGCACGGCGTGGTGTTCCTCCACGTCACCTACGTGCCGGCGCAGGAGAAGAACTTCACCACGGCGCCGGCCATCTGCCACGACGGCAAGGCGCACTTCCCGAGGGAGGGCGTCTTCGTCTCCAACGGCACCCACTGGTTCGTCACCCAGAGGAACTTCTACGAGCCGCAGATCATCACCACCGACAACACCTTCGTCTCCGGCAACTGCGACGTCGTCATCGGCATCGTCAACAACACCGTCTACGACCCGCTGCAGCCGGAGCTCGACAGCTTCAAGGAGGAGCTCGACAAGTACTTCAAGAACCACACCTCCCCTGATGTGGACCTCGGCGACATCTCCGGCATCAACGCCTCCGTCGTCAACATCCAGAAGGAGATCGACCGCCTCAACGAGGTGGCCAAGAACCTCAACGAGAGCCTCATCGACCTCCAGGAGCTCGGCAAGTACGAGCAGTACATCAAGTGGCCATGGTACATCTGGCTCGGCTTCATCGCCGGCCTCATCGCCATCGTGATGGTGACCATCATGCTCTGCTGCATGACAAGCTGCTGCAGCTGCCTCAAGGGCTGCTGCAGCTGCGGCAGCTGCTGCAAGTTTGATGAAGATGATTCTGAGCCGGTGCTCAAGGGCGTCAAGCTCCACTACACCTAA, respectively; the coding gene of the novel coronavirus spike protein is preferably prepared by a chemical synthesis method. The chemical synthesis method of the present invention is not limited, and a chemical synthesis method known to those skilled in the art may be used. According to the invention, the GC content of the encoding gene of the new coronavirus spike protein is improved to 62.56% from the original 37.31% by optimizing the codon through software, and the CAI value is improved to 97.46% from 70.58%; KV (lysine and valine) amino acid sequences of 986 and 987 in the original sequence are mutated into PP (proline), so that the structural stability is increased, and the expression quantity of the new coronavirus spike protein is increased by more than 50%; in addition, the secretion and transportation of the new coronavirus spike protein to the protein system of endosperm cells are facilitated by fusing the signal peptide sequence of rice gluten (the amino acid sequence of the signal peptide is shown in SEQ ID NO. 5: MASINRPIVFFTVCLFLLCD) upstream of the gene encoding the new coronavirus spike protein.

In the present invention, the basic vector of the expression vector preferably includes pCUbi-1390. The basic vector pCUbi-1390 of the invention is registered in the NTCC plasmid vector strain cell gene collection center and disclosed in the Chinese patent CN 201610892616.3.

The invention also provides the application of the recombinant promoter or the primer group or the recombinant promoter obtained by amplification by the method or the expression vector in preparing the novel coronavirus spike protein. The invention uses rice seeds as the storage place of exogenous recombinant protein, and mediates the recombinant protein to enter an inner membrane system of rice endosperm cells through a high-efficiency recombinant promoter expressed by rice endosperm specificity and store the recombinant protein in a protein body of rice endosperm, so that the recombinant protein is accumulated in a large amount in the rice seeds, and the expression quantity of the recombinant protein can reach 4.69 to 89.50 times of that of wild rice. Compared with an animal expression system, the method has the advantages of easy capacity expansion and production and storage cost reduction.

The invention also provides a method for preparing the novel coronavirus spike protein by using the rice endosperm cells, which comprises the following steps:

the promoter is inserted between HindIII and KpnI enzyme cutting sites of pCUbi1390 to obtain pGt1A1390 vector;

inserting a coding gene of a new coronavirus spike protein between Kpn I and BamH I enzyme cutting sites of the pGt1A1390 vector to obtain a pGt1A1390-SP1 vector; the nucleotide sequence of the coding gene of the new coronavirus spike protein is shown as SEQ ID NO. 4;

pGt1A1390-SP1 vector is transformed into rice callus, and rice plant expressing new coronavirus spike protein is obtained through screening.

The present invention inserts the promoter between HindIII and KpnI restriction sites of pCUbi1390 to obtain pGt1A1390 vector. In the present invention, the preparation method of the pGt1A1390 vector preferably comprises: carrying out enzyme digestion on the pCUbi1390 vector by HindIII and KpnI, and then recovering a large fragment DNA; the recombinant promoter is subjected to enzyme digestion by HindIII and KpnI and then subjected to T reaction with the recovered large fragment DNA₄Forming an intermediate vector after the ligase ligation; the intermediate vector is transformed into an escherichia coli competent cell DH5 alpha, and a single clone is identified to obtain a pGt1A1390 vector. The method of transformation is not limited in the present invention, and a transformation method known to those skilled in the art may be used. The source of the E.coli competent cell DH 5. alpha. in the present invention is not limited, and commercially available products known to those skilled in the art may be used.

After the pGt1A1390 vector is obtained, the coding gene of the novel coronavirus spike protein is inserted between the Kpn I and BamH I enzyme cutting sites of the pGt1A1390 vector to obtain the pGt1A1390-SP1 vector. In the present invention, the pGt1A1390-SP1 vector is preferably prepared by a method comprising: the coding gene and the pGt1A1390 vector are cut by Kpn I and BamH I at the same time to obtain a group of same cohesive ends, a fragment with the coding gene is obtained after agarose gel electrophoresis separation, then the cut gene is connected to pGt1A1390 large fragment DNA which is cut and digested by Kpn I and BamH I, and the cut gene is subjected to T₄After ligase ligation, the strain is transformed into Escherichia coli DH5 alpha, and the pGt1A1390-SP1 vector is obtained by identifying single clone. The method of transformation is not limited in the present invention, and a transformation method known to those skilled in the art may be used.

After the pGt1A1390-SP1 vector is obtained, the pGt1A1390-SP1 vector is transformed into rice callus, and a rice plant expressing the spike protein of the new coronavirus is obtained by screening. In the present invention, the method of transformation preferably comprises: transferring the pGt1A1390-SP1 vector into agrobacterium by an electric transformation method, infecting rice callus by an agrobacterium-mediated method, and screening to obtain a rice plant expressing the spike protein of the new coronavirus; the electrotransformation is preferably carried out as described in the document [ Toki S, Hara N, Ono K, et al, early infection of cutellum tissue with Agrobacterium high-speed transformation of rice [ J ]. Plant Journal,2010,47(6): 969-; the rice variety preferably comprises Xiushui 11 or Xiushui 134; the substance to be screened preferably comprises hygromycin; the agrobacterium is preferably EHA 105. The source of the Agrobacterium of the present invention is not limited, and commercially available products known to those skilled in the art may be used. The infected callus is preferably screened and cultured according to the records of the literature [ Toki et al,2010 ], so as to obtain the rice plant expressing the new coronavirus spike protein.

The method uses the protein body of the rice endosperm cell as the storage point of the recombinant protein, mediates the recombinant new coronavirus spike protein to enter an endomembrane system of the endosperm cell and store the protein body of the endosperm cell through the recombinant promoter expressed by the specificity of the rice endosperm, thereby achieving the purpose of mass production, having stable expression and being stored with high storage tolerance of the prepared new coronavirus spike protein.

To further illustrate the present invention, the following examples are provided to describe in detail an expression vector for specifically expressing a novel coronavirus spike protein using rice endosperm cells and its application, but they should not be construed as limiting the scope of the present invention.

Example 1

A recombinant promoter for promoting expression of a new coronavirus spike protein in a plant genome, wherein the recombinant promoter is amplified by a method comprising the following steps: amplifying the genome DNA of the Xiushui 11 rice variety by using a primer group through a high-fidelity PCR method to obtain the recombinant promoter; the nucleotide sequence of the recombinant promoter is shown as SEQ ID NO. 1;

the nucleotide sequence of the upstream primer of the primer group is shown as SEQ ID NO. 2: CCCAAGCTTTTGTTTTTCACCCTCAATA, in which the HindIII cleavage site is underlined;

the nucleotide sequence of the downstream primer of the primer group is shown as SEQ ID NO. 3: CGGGGTACCATCGCACAAGAGGAACAAGC, underlined thereinIs KpnI restriction enzyme site;

the PCR amplification reaction was carried out in 25. mu.L: 2 XKOD PCR buffer 12.5. mu.L, KOD FX 0.25. mu.L, dNTP 2. mu.L, upstream and downstream primers of the above primer set 0.5. mu.L each, DNA template 2. mu.L and ddH as the remainder₂O。

The PCR amplification reaction program is as follows: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 20s, annealing at 58 ℃ for 20s, extension at 72 ℃ for 150s, and circulation for 32 times; extension at 72 ℃ for 10 min.

Example 2

Construction of rice endosperm cell specific expression vector: the promoter fragment of Gt1A prepared in example 1 with HindIII and KpnI restriction sites was cloned into large fragment DNA recovered from HindIII and KpnI restriction pCUbi1390 vector (see FIG. 1), and was ligated by T4 ligase to form an intermediate vector, which was then transformed into E.coli competent cells (DH 5. alpha.), and the rice endosperm cell-specific overexpression vector obtained by single cloning was identified and named pGt1A 1390.

Example 3

The encoding gene of the new coronavirus spike protein is prepared by chemical synthesis of Oncorhinaceae biological company, and the nucleotide sequence of the encoding gene of the new coronavirus spike protein is preferably shown as SEQ ID NO. 4;

the coding gene and the pGt1A1390 vector prepared in the embodiment 2 are cut by Kpn I and BamH I at the same time to obtain a group of same cohesive ends, a fragment with the coding gene is obtained after agarose gel electrophoresis separation, then the cut gene is connected to pGt1A1390 large fragment DNA which is cut and digested by Kpn I and BamH I, and the DNA is cut by T₄After ligase ligation, the vector is transformed into Escherichia coli DH5 alpha, and the pGt1A1390-SP1 vector is identified and obtained from a single clone (the pGt1A1390-SP1 vector construction structure is shown in figure 2, and a part of the vector is shown in figure 3).

Example 4

The pGt1A1390-SP1 vector prepared in example 3 was transformed into Agrobacterium EHA105 by electrotransformation [ Toki S, Hara N, Ono K, et al, early introduction of plasmid tissue with Agrobacterium strain high-speed transformation of rice [ J ] Plant Journal,2010,47(6):969-976 ];

removing the hull of the rice seed wash 11, disinfecting with 70% (v/v) alcohol for 1-2 min, washing with sterile water, and then disinfecting with 1 wt.% sodium hypochlorite for 20-30 min, and shaking occasionally; at the moment, the rice seeds are in light yellow, and the rice seeds are washed by sterile water until the rice seeds become white;

placing the disinfected seeds on sterilized filter paper, and drying the seeds in a super-clean workbench; inoculating the seeds to a callus induction culture medium NBD, culturing for about 10-15 days at 26-28 ℃ under a dark condition, growing callus from rice seed embryos, and stripping the callus from the seeds by using a scalpel to perform in-vitro culture; selecting callus with compact structure, bright color and granular surface for subculture every 2 weeks; embryogenic calli after 1 subculture were used for Agrobacterium transformation.

Preparing an agrobacterium infection solution: taking out the preserved agrobacterium from a-80 ℃ refrigerator, carrying out streaking culture at 28 ℃ on a YEP plate (20mg/L Rif,50mg/L Kan), picking a single colony, inoculating the single colony into 2-5 ml of YEP liquid culture medium (20mg/L Rif,50mg/L Kan), and carrying out shaking culture at 28 ℃ and 180rpm overnight (more than 16 h);

adding 2ml of Agrobacterium liquid into 50ml of AAM culture medium, shaking at 28 deg.C and 180rpm, and culturing to OD₆₀₀Is 0.6; centrifuging at 4 deg.C and 4000rpm for 10min, discarding supernatant, resuspending with 50ml AAM medium (with final concentration of 100 μmol/L AS and no antibiotics), and culturing on shaking table at 28 deg.C and 180rpm for 0.5h to recover activity; selecting embryogenic callus of about 5mm on the day of scratching, transferring to NBD culture medium, and pre-culturing for 4 days for Agrobacterium infection;

agrobacterium infection and resistant callus screening: 30ml of the appropriate concentration (OD) were prepared on a clean bench₆₀₀0.5-0.6) pouring the agrobacterium liquid into a glass vessel such as a sterile triangular flask; immersing the pre-cultured callus with a diameter of 5mm into the Agrobacterium, slowly rotating for 20min, and standing for 10 min; pouring out the agrobacterium liquid, and putting the infected callus on dry sterile filter paper for blow drying; transferring the callus particles to a co-culture medium (the AAM containing AS and no antibiotics is dripped around the callus to improve the resistant callus rate), culturing for 2-3 days at 22-25 ℃ without light, and growing agrobacterium tumefaciens around the callusThe whole callus is covered;

washing the callus with sterile water (optionally 0.1M mannitol), washing until the liquid is no longer turbid, (if turbidity indicates that there is a large amount of Agrobacterium residue), and soaking in sterile water containing 500mg/L cephalosporin for 20 min; pouring out the sterilized water, transferring the callus on dry sterile filter paper for blotting, and transferring to a screening medium (NBD + Cef 500mg/L + Hyg 50mg/L) for primary screening (20 days); the resistant callus growing on the maternal callus was peeled off and transferred to a new selection medium (properly reducing the concentrations of Cef and Hyg in the medium to favor the growth of callus), one resistant callus was a single line, and the resistant callus was subjected to a second selection culture for 2 weeks before being used for pre-differentiation.

Pre-differentiation and differentiation

Pre-differentiation: after the resistant callus is subjected to second round of screening culture, the resistant callus is subjected to dark culture for about 10 days on a pre-differentiation culture medium (MS +1mg/L NAA +2 mg/L6-BA +5mg/L ABA) at 26-28 ℃ so that the callus forms compact embryonic tissues.

Differentiation: transferring the pre-differentiated callus into a differentiation medium (MS +0.2mg/L NAA +2 mg/L6-BA, and using a glass bottle or a triangular bottle instead), and culturing for 2-3 weeks at 26-28 ℃ under the illumination of 14-16h every day to differentiate seedlings from the callus.

Rooting, seedling exercising and identifying: when the differentiated rice plantlets grow to about 3cm, the rice plantlets can be separated from the parent bodies, transferred into a rooting culture medium (1/2MS +0.5mg/L NAA), and cultured under the illumination of 28 ℃ for 14-16 h. The roots can grow after 2 days generally, the rice is carefully taken out from the rooting culture medium after about 10 days, the culture medium on the roots of the rice is washed away, and the rice is transplanted after the rice is hardened for 2 to 3 days by adding sterilized water. Extraction of T₀The genomic DNA of transgenic rice was identified by PCR using hygromycin phosphotransferase gene as a marker (functional analysis of LOX3 gene and promoter in Liunan, Rice embryo, Ph. university of Nanjing, written treatise on doctor's academic thesis, Nanjing, 2006.); designing a specific primer according to a hygromycin phosphotransferase gene hpt sequence, wherein hpt-F: 5'-ACACAGCCATCGGTCCAGAC-3' (SEQ ID NO.6), hpt-R: 5'-ATCTTAGCCAGACGAGCGGG-3' (SEQ ID NO.7), PCR reaction: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 deg.C for 1min, annealing at 58 deg.C for 1min, and annealing at 72 deg.CStretching for 1min, and performing 35 cycles; extending for 10min at 72 ℃; if the size of the amplified product band is 589bp, the amplified product band is a PCR positive plant, and the positive plant is used for subsequent Southern identification; because of T₀The seeds produced in the generation are heterozygotes, and in order to obtain homozygous transgenosis, two generations of selfings are obtained, and before each selfing, hygromycin screening is carried out on the transgenic seeds.

The experimental results are as follows: 30 independent endosperm-specific expression new coronavirus spike protein SP1 transgenic families are obtained through genetic transformation, 30 transgenic family leaves are collected and DNA is extracted, and 29 families are found to be positive plants through PCR identification (figure 4). Therefore, the acquisition of the SP1 transgenic rice provides a good material basis for mass production of the new coronavirus spike protein SP1 in the later period.

Example 5

Total RNA of 29 transgenic positive and wild type plants (Xiuhui 11) identified in example 4 was extracted by Trizol method. Grinding rice tissues stored at the temperature of minus 80 ℃ by using liquid nitrogen, adding the ground rice tissues into a 1.5ml centrifuge tube which is treated by DEPC (DePC) and is added with 1ml Trizol in advance, fully and uniformly mixing the ground rice tissues, placing the ground rice tissues at the normal temperature for 5min, centrifuging the ground rice tissues at the temperature of 4 ℃ for 10min at 12000g, taking the supernatant, transferring the supernatant into a new 1.5ml centrifuge tube, adding 200 mu l of chloroform, violently shaking the centrifuge tube for 15s, placing the centrifuge tube at the room temperature for 10min, centrifuging the centrifuge tube at the temperature of 4 ℃ for 10min at 12000g, transferring the supernatant into a new 1.5ml centrifuge tube, adding isopropanol of an equal volume ice bath, precipitating the mixture at the temperature of 20min, centrifuging the mixture at the temperature of 4 ℃ for 15min, removing the supernatant, adding 1ml of ethanol treated by 75% DEPC water, washing RNA precipitation, repeatedly centrifuging the mixture, blowing the mixture to be nearly dry by using an ultra-clean bench, and adding ultra-pure sterile water treated by DEPC to dissolve the precipitate. RNA solution was stored in small portions at-80 ℃ for future use. RNA concentration and purity were determined on a ultramicro spectrophotometer (Nanodrop 2000 spectrophotometer, Thermo Scientific).

First strand cDNA was synthesized using the PrimeScript reagent Kit with gDNA Eraser (TaKaRa, Dalian) in a 250. mu.l RNase free PCR tube in 10. mu.l reaction format with the following components added in sequence: 5 XgDNA Eraser Buffer 2. mu.l, gDNA 1. mu.l, total RNA 2. mu.l, RNase free H2O to 10. mu.l. Slightly and uniformly mixing, and the reaction procedure is as follows: storing at 42 deg.C for 2min and 4 deg.C, and removing genome DNA from RNA by the reaction; then adding in sequence: 5 × PrimeScript Buffer, 4 μ l, PrimeScript RT Enzyme Mix I, 1 μ l, RT Primer Mix, 1 μ l, RNase free H2O, 4 μ l, Reaction solution from step I, 10 μ l. Total volume 20 μ l, programmed: storing at 37 deg.C for 15min, 85 deg.C for 5s, and 4 deg.C for flever. The reversed cDNA was stored at-20 ℃ for further use.

The reverse-transcribed cDNA was used as a template for qRT-PCR, and the reaction was carried out on a CFX96 Real-Time System (Bio-Rad) using Fast Essential DNA Green Master from Roche. Preparing PCR reaction solution according to the following components:

fast Essential DNA Green Master (2X) 12.5. mu.l, SP1-RT-F (10. mu.M) 0.5. mu.l, SP1-RT-R (10. mu.M) 0.5. mu.l, cDNA template 0.5. mu.l, ddH2O (double distilled water) to 25. mu.l. The reaction program is pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 20s, annealing at 64.6 ℃ for 20s, and extension at 72 ℃ for 20s, for 40 cycles. By 2^-ΔΔCTAnd (4) analyzing the method.

SP1-RT-F:GACCCGCAGACGCTGGAGAT(SEQ ID NO.8)(T_m＝64.6)；

SP1-RT-R:GCGATGATGCTCTGGGAGGC(SEQ ID NO.9)(T_m＝65)。

The expression level of SP1 gene was found by qRT-PCR quantitative PCR analysis, and SP1 transgenic line improved the expression level of SP1 gene in endosperm to a different extent compared with wild type, wherein the expression level of SP1-15 transgenic line was even 89.5 times of wild type (FIG. 5).

In conclusion, the rice seeds are used as the storage site of the exogenous recombinant protein, a large amount of independent transgenic rice is obtained by using the efficient recombinant promoter for rice endosperm specific expression, the SP1 gene which is optimized by codons and suitable for rice expression and agrobacterium-mediated genetic transformation, the system can mediate the SP1 protein to enter an inner membrane system of rice endosperm cells and store the SP1 protein in a protein body of rice endosperm, so that the recombinant protein is accumulated in the rice seeds in a large amount, and the expression analysis shows that the transgenic plant can reach 4.69 to 89.50 times of that of wild rice. Compared with an animal expression system, the method has the advantages of easy capacity expansion and production and storage cost reduction.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> institute of Rice research in China

<120> expression vector for specifically expressing novel coronavirus spike protein by using rice endosperm cells and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1919

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttgtttttca ccctcaatat ttggaaacat ttatctaggt tgtttgtgtc caggcctata 60

aatcatacat gatgttgtcg tattggatgt gaatgtggtg gcgtgttcag tgccttggat 120

ttgagtttga tgagagttgc ttctgggtca ccactcacca ttatcgatgc tcctcttcag 180

cataaggtaa aagtcttccc tgtttacgtt attttaccca ctatggttgc ttgggttggt 240

tttttcctga ttgcttatgc catggaaagt catttgatat gttgaacttg aattaactgt 300

agaattgtat acatgttcca tttgtgttgt acttccttct tttctattag tagcctcaga 360

tgagtgtgaa aaaaacagat tatataactt gccctataaa tcatttgaaa aaaatattgt 420

acagtgagaa attgatatat agtgaatttt taagagcatg ttttcctaaa gaagtatata 480

ttttctatgt acaaaggcca ttgaagtaat tgtagataca ggataatgta gactttttgg 540

acttacactg ctacctttaa gtaacaatca tgagcaatag tgttgcaatg atatttaggc 600

tgcattcgtt tactctcttg atttccatga gcacgcttcc caaactgtta aactctgtgt 660

tttttgccaa aaaaaaatgt ataggaaagt tgcttttaaa aaatcatatc aatccatttt 720

ttaagttata gctaatactt aattaatcat gcgctaataa gtcactctgt ttttcgtact 780

agagagattg ttttgaacca gcactcaaga acacagcctt aacccagcca aataatgcta 840

caacctacca gtccacacct cttgtaaagc atttgttgca tggaaaagct aagatgacag 900

caacctgttc aggaaaacaa ctgacaaggt catagggaga gggagctttt ggaaaggtgc 960

cgtgcagttc aaacaattag ttagcagtag ggtgttggtt tttgctcaca gcaataagaa 1020

gttaatcatg gtgtaggcaa cccaaataaa acaccaaaat atgcacaagg cagtttgttg 1080

tattctgtag tacagacaaa actaaaagta atgaaagaag atgtggtgtt agaaaaggaa 1140

acaatatcat gagtaatgtg tgagcattat gggaccacga aataaaaaga acattttgat 1200

gagtcgtgta tcctcgatga gcctcaaaag ttctctcacc ccggataaga aacccttaag 1260

caatgtgcaa agtttgcatt ctccactgac ataatgcaaa ataagatatc atcgatgaca 1320

tagcaactca tgcatcatat catgcctctc tcaacctatt cattcctact catctacata 1380

agtatcttca gctaaatgtt agaacataaa cccataagtc acgtttgatg agtattaggc 1440

gtgacacatg acaaatcaca gactcaagca agataaagca aaatgatgtg tacataaaac 1500

tccagagcta tatgtcatat tgcaaaaaga ggagagctta taagacaagg catgactcac 1560

aaaaattcat ttgcctttcg tgtcaaaaag aggagggctt tacattatcc atgtcatatt 1620

gcaaaagaaa gagagaaaga acaacacaat gctgcgtcaa ttatacatat ctgtatgtcc 1680

atcattattc atccaccttt cgtgtaccac acttcatata tcatgagtca cttcatgtct 1740

ggacattaac aaactctatc ttaacattta gatgcaagag cctttatctc actataaatg 1800

cacgatgatt tctcattgtt tctcacaaaa agcattcagt tcattagtcc tacaacaaca 1860

tggcatccat aaatcgcccc atagttttct tcacagtttg cttgttcctc ttgtgcgat 1919

<210> 2

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cccaagcttt tgtttttcac cctcaata 28

<210> 3

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cggggtacca tcgcacaaga ggaacaagc 29

<210> 4

<211> 3822

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgtttgtgt tcctcgtcct cctcccgctc gtctcctccc agtgcgtcaa cctcaccacc 60

aggactcagc tgccgccggc gtacaccaac agcttcaccc gcggcgtcta ctaccccgac 120

aaggtgttcc gctcctccgt cctccactcc acccaggacc tcttcctccc cttcttctcc 180

aacgtcacct ggttccacgc catccacgtc tccggcacca acggcaccaa gaggttcgac 240

aacccggtgc tccccttcaa cgacggcgtc tacttcgcct ccaccgagaa gagcaacatc 300

atccgcggct ggatcttcgg caccaccctc gactccaaga cacagagcct cctcatcgtc 360

aacaacgcca ccaacgtcgt catcaaggtg tgcgagttcc agttctgcaa tgatcctttc 420

ctcggcgtct actaccacaa gaacaacaag agctggatgg agagcgagtt ccgcgtctac 480

tcctccgcca acaactgcac cttcgagtac gtctcccagc cgttcctcat ggatctggag 540

ggcaagcagg gcaacttcaa gaacctccgc gagttcgtct tcaagaacat cgacggctac 600

ttcaagatct actccaagca cacgccgatc aacctcgtcc gcgacctccc gcagggcttc 660

tccgccctcg agccgctcgt cgacctcccc atcggcatca acatcaccag gttccagacc 720

ctcctcgccc tccaccgcag ctacctcacc cccggcgact cctcctccgg ctggaccgcc 780

ggcgccgccg cctactacgt cggctacctc cagccgcgca ccttcctcct caagtacaac 840

gagaacggca ccatcaccga cgccgtcgac tgcgccctcg acccgctctc cgagaccaag 900

tgcaccctca agagcttcac cgtggagaag ggcatctacc agacctccaa cttcagggtg 960

cagccgacgg agagcatcgt ccgcttcccc aacatcacca acctctgccc gttcggcgag 1020

gtgttcaacg ccaccaggtt cgcctccgtc tacgcctgga acaggaagag gatctccaac 1080

tgcgtcgccg actactccgt cctctacaac tccgcctcct tctccacctt caagtgctac 1140

ggcgtgtcgc cgaccaagct caacgacctc tgcttcacca acgtgtacgc cgacagcttc 1200

gtcatccgcg gcgacgaggt gaggcagatc gcgccggggc agaccggcaa gatcgccgac 1260

tacaactaca agctccccga cgacttcacc ggctgcgtca tcgcctggaa cagcaacaac 1320

ctcgactcca aggtcggcgg caactacaac tacctctacc gcctcttcag gaagagcaac 1380

ctcaagccat ttgagaggga catctccacc gagatctacc aggccggcag cacgccgtgc 1440

aacggcgtgg agggcttcaa ctgctacttc ccgctgcaga gctacggctt ccagccgacc 1500

aacggcgtcg gctaccagcc gtacagggtg gtggtgctct ccttcgagct cctccacgcg 1560

ccggcgacgg tgtgcggccc caagaagagc accaacctcg tcaagaacaa gtgcgtcaac 1620

ttcaacttca acggcctcac cggcaccggc gtcctcaccg agagcaacaa gaagttcctc 1680

cccttccagc agttcggccg cgacatcgcc gacaccaccg acgccgtccg cgacccgcag 1740

acgctggaga tcctcgacat caccccatgc agcttcggcg gcgtctccgt catcaccccc 1800

ggcaccaaca cctccaacca ggtggcggtg ctctaccagg atgtgaactg caccgaggtg 1860

ccggtggcca tccacgccga ccagctcacc ccaacatgga gggtgtactc caccggcagc 1920

aatgtgttcc agacccgcgc cggctgcctc atcggcgccg agcacgtcaa caacagctac 1980

gagtgcgaca tccccatcgg cgccggcatc tgcgcctcct accagaccca gaccaactcg 2040

ccgcgccgcg cccgctccgt cgcctcccag agcatcatcg cctacaccat gagcctcggc 2100

gccgagaact ccgtcgccta ctccaacaac tccatcgcca tccccaccaa cttcaccatc 2160

tccgtcacca ccgagatcct ccccgtctcc atgaccaaga cctccgtcga ctgcaccatg 2220

tacatctgcg gcgactccac cgagtgcagc aacctcctcc tccagtacgg cagcttctgc 2280

acccagctca accgcgccct caccggcatc gccgtggagc aggacaagaa cacccaggag 2340

gtgttcgccc aggtgaagca gatctacaag acgccgccga tcaaggactt cggcggcttc 2400

aacttctccc agatcctccc cgacccctcc aagccctcca agaggagctt catcgaggac 2460

ctcctcttca acaaggtcac cctcgccgac gccggcttca tcaagcagta cggcgactgc 2520

ctcggcgaca tcgccgcccg cgacctcatc tgcgcccaga agttcaacgg cctcaccgtg 2580

ctgccgccgc tcctcaccga cgagatgatc gcccagtaca cctccgccct cctcgccggc 2640

accatcacct ccggctggac cttcggcgcc ggcgcggcgc tgcagattcc tttcgccatg 2700

cagatggcgt accgcttcaa cggcatcggc gtcacccaga atgtgctcta cgagaaccag 2760

aagctcatcg ccaaccagtt caactccgcc atcggcaaga tccaggactc cctctcctcc 2820

accgcctccg ccctcggcaa gctgcaggat gtggtgaacc agaatgctca ggcgctcaac 2880

accctcgtca agcagctctc ctccaacttc ggcgccatct cctccgtcct caacgacatc 2940

ctctcccgcc tcgacaaggt ggaggcggag gtgcagatcg accgcctcat caccggccgc 3000

ctccagtcgc tgcagaccta cgtcacccag cagctcatcc gcgccgccga gatccgcgcc 3060

tccgccaacc tcgccgccac caagatgtcg gagtgcgtcc tcggccagag caagagggtg 3120

gacttctgcg gcaagggcta ccacctcatg agcttcccgc agtcggcgcc gcacggcgtg 3180

gtgttcctcc acgtcaccta cgtgccggcg caggagaaga acttcaccac ggcgccggcc 3240

atctgccacg acggcaaggc gcacttcccg agggagggcg tcttcgtctc caacggcacc 3300

cactggttcg tcacccagag gaacttctac gagccgcaga tcatcaccac cgacaacacc 3360

ttcgtctccg gcaactgcga cgtcgtcatc ggcatcgtca acaacaccgt ctacgacccg 3420

ctgcagccgg agctcgacag cttcaaggag gagctcgaca agtacttcaa gaaccacacc 3480

tcccctgatg tggacctcgg cgacatctcc ggcatcaacg cctccgtcgt caacatccag 3540

aaggagatcg accgcctcaa cgaggtggcc aagaacctca acgagagcct catcgacctc 3600

caggagctcg gcaagtacga gcagtacatc aagtggccat ggtacatctg gctcggcttc 3660

atcgccggcc tcatcgccat cgtgatggtg accatcatgc tctgctgcat gacaagctgc 3720

tgcagctgcc tcaagggctg ctgcagctgc ggcagctgct gcaagtttga tgaagatgat 3780

tctgagccgg tgctcaaggg cgtcaagctc cactacacct aa 3822

<210> 5

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Ala Ser Ile Asn Arg Pro Ile Val Phe Phe Thr Val Cys Leu Phe

1 5 10 15

Leu Leu Cys Asp

20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acacagccat cggtccagac 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atcttagcca gacgagcggg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gacccgcaga cgctggagat 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcgatgatgc tctgggaggc 20

Claims (10)

1. A recombinant promoter for promoting expression of a new coronavirus spike protein is characterized in that the nucleotide sequence of the recombinant promoter is shown as SEQ ID NO. 1.

2. A primer group for amplifying the recombinant promoter of claim 1, wherein the nucleotide sequence of the upstream primer of the primer group is shown as SEQ ID No. 2; the nucleotide sequence of the downstream primer of the primer group is shown as SEQ ID NO. 3.

3. A method for obtaining the recombinant promoter of claim 1 by PCR amplification, wherein the PCR amplification reaction program comprises: pre-denaturation at 94-95 ℃ for 2 min; denaturation at 94-95 ℃ for 20s, annealing at 56-58 ℃ for 20s, extension at 72 ℃ for 130-150 s, and circulating for 32 times; extension at 72 ℃ for 10 min.

4. The method of claim 3, wherein the PCR amplification reaction system is 25 μ L and comprises: 2 XKOD PCR buffer 12.5. mu.L, KODFX 0.25. mu.L, dNTP 2. mu.L, upstream and downstream primers of the primer set of claim 2, each 0.5. mu.L, DNA template 2. mu.L and ddH as the remainder₂O。

5. An expression vector for expressing a novel coronavirus spike protein, wherein the expression vector comprises the recombinant promoter of claim 1 and a gene encoding the novel coronavirus spike protein.

6. The expression vector of claim 5, wherein the nucleotide sequence of the gene encoding the novel coronavirus spike protein is shown in SEQ ID No. 4.

7. The expression vector of claim 5, wherein the base vector of the expression vector comprises pCUbi-1390.

8. Use of the recombinant promoter according to claim 1 or the primer set according to claim 2 or the recombinant promoter amplified by the method according to claim 3 or 4 or the expression vector according to any one of claims 5 to 7 for preparing a novel coronavirus spike protein.

9. A method for preparing a novel coronavirus spike protein by using rice endosperm cells is characterized by comprising the following steps:

inserting the promoter of claim 1 between HindIII and KpnI cleavage sites of pCUbi1390 to obtain pGt1A1390 vector;

inserting the coding gene of the new coronavirus spike protein between Kpn I and BamH I enzyme cutting sites of the pGt1A1390 vector to obtain a pGt1A1390-SP1 vector; the nucleotide sequence of the coding gene of the new coronavirus spike protein is shown as SEQ ID NO. 4;

pGt1A1390-SP1 vector is transformed into rice callus, and rice plant expressing new coronavirus spike protein is obtained through screening.

10. The method of claim 9, wherein the screened material comprises hygromycin.

Images