CN113368004A

CN113368004A - Polypeptide composition with anti-aging and repairing effects and preparation method and application thereof

Info

Publication number: CN113368004A
Application number: CN202110662987.3A
Authority: CN
Inventors: 李阳; 刘忠; 周丹; 周丽; 唐小丹
Original assignee: Guangdong Jida Genetic Medicine Engineering Research Center Co ltd; Zhengzhou Sankai Cosmetics Co ltd
Current assignee: Guangdong Jida Genetic Medicine Engineering Research Center Co ltd; Zhengzhou Sankai Cosmetics Co ltd
Priority date: 2021-06-15
Filing date: 2021-06-15
Publication date: 2021-09-10
Anticipated expiration: 2041-06-15
Also published as: CN113368004B

Abstract

The invention belongs to the technical field of cosmetics, and particularly relates to a polypeptide composition with anti-aging and repairing effects, and a preparation method and application thereof. The polypeptide composition provided by the invention comprises the following components in percentage by mass: 5 to 45 percent of palmitoyl dipeptide-7, 7 to 50 percent of copper tripeptide-1, 3 to 22 percent of acetyl hexapeptide-8 and 5 to 20 percent of silk peptide.

Description

Polypeptide composition with anti-aging and repairing effects and preparation method and application thereof

Technical Field

The invention belongs to the technical field of cosmetics, and particularly relates to a polypeptide composition with anti-aging and repairing effects, and a preparation method and application thereof.

Background

Aging is generally defined as the accumulation of various harmful substances that occur in cells and tissues with age, leading to an increased risk of disease and death. The aging process is a dynamic, irreversible phenomenon that affects all the systems of the body.

Depending on the factors of skin aging, skin aging can be divided into two types: the first is intrinsic aging and the second is extrinsic aging. Intrinsic aging is caused by genetic factors and biochemical modifications that occur under conditions of fatigue, stress and hormonal changes (e.g., pregnancy, etc.). Extrinsic aging is caused by environmental factors (e.g., pollution, sunlight) to which the organism is subjected throughout its life.

Senescence is a slow and progressive process that affects all cells of an organism in different ways and manifests itself in different ways. "signs of aging skin" include, but are not limited to, any visible manifestations on skin caused by aging. Such as wrinkles, fine lines, dry skin cracks, enlarged pores, blemishes, decreased firmness, discoloration, keratosis, collagen loss and other changes in the dermis and epidermis. "visible signs of aging" also refer to any changes in the appearance of the skin and skin appendages due to aging, such as surface roughness of the corneal layer, fine lines and wrinkles, and also includes any internal changes in the skin that do not systematically translate into a modified appearance, such as thinning of the dermal layer or any other internal degradation of the skin after exposure to Ultraviolet (UV) light.

Human skin is composed of a dense array of extracellular matrix (ECM) proteins that are essential for the structural and mechanical properties and function of organs. Collagen-rich ECM is an important component of cutaneous vascularity, structural support, and epidermal hemostasis.

The dermis undergoes significant changes with aging of the skin. Histological and ultrastructural studies have shown that the major changes in skin aging are located in the connective tissue dermis and are smaller in the Cornified Envelope (CE). Biochemical evidence suggests that the prominent molecular feature of intrinsic aging in skin is the breakdown of collagen fibers, a weakening of collagen synthesis capacity, and their aging deterioration results in skin becoming fragile, less elastic, and more vulnerable to bruising. Changes in the skin ECM associated with age can impair the structural and mechanical properties of the skin dermis and create a tissue microenvironment that promotes the development of age-related skin disorders such as thinning, increased fragility, impaired vasculature support, and impaired wound healing.

Peptides have important signaling functions and coordinate many biochemical processes, and thus, are widely used in the pharmaceutical and cosmetic industries. At present, many peptides have remarkable anti-aging or repairing effects, but a single peptide has a single effect or is easy to generate an allergic phenomenon. Therefore, it is necessary to carry out compounding research and experiments and develop an improved product which is mild and non-irritant and can prevent aging and promote repair in a multi-aspect manner.

Disclosure of Invention

Aiming at the defects generally existing in the prior art, the invention provides a polypeptide composition with anti-aging and repairing effects, and a preparation method and application thereof. The polypeptide composition provided by the invention has a remarkable antioxidant effect, is nontoxic and harmless to cells, can promote cell proliferation and migration, can be used for preparing skin care products, and can promote anti-aging and repair of skin.

In order to achieve the purpose, the invention adopts the technical scheme that:

the composition with the anti-aging and repairing effects comprises the following components in percentage by mass: 5 to 45 percent of palmitoyl dipeptide-7, 7 to 50 percent of copper tripeptide-1, 3 to 22 percent of acetyl hexapeptide-8 and 5 to 20 percent of silk peptide.

Preferably, the polypeptide composition comprises the following components in percentage by mass: 25 to 40 percent of palmitoyl dipeptide-7, 40 to 50 percent of copper tripeptide-1, 8 to 20 percent of acetyl hexapeptide-8 and 10 to 15 percent of silk peptide.

Preferably, the polypeptide composition consists of the following components in percentage by mass: 30% palmitoyl dipeptide-7, 45% copper tripeptide-1, 15% acetyl hexapeptide-8, 10% silk peptide.

The invention also provides a preparation method of the polypeptide composition, which comprises the following steps:

s1, respectively taking palmitoyl dipeptide-7, copper tripeptide-1, acetyl hexapeptide-8 and silk peptide, and uniformly mixing to obtain a mixture I;

s2, adding the mixture I prepared in the step S1 into deionized water, stirring and dissolving, adding ethanol for assisting dissolution, and dissolving for 40min to prepare a mixed polypeptide solution;

s3, sterilizing and filtering the mixed polypeptide solution prepared in the step S2 to obtain a mixed filtrate;

s4, and finally, freeze-drying the mixed filtrate obtained in the step S3 to obtain the compound plant extract.

Preferably, the step S1 is to mix the mixture evenly for 20min at 500 rpm.

Preferably, the feed-liquid ratio of the mixture I to the deionized water in the step S2 is 1: 4 mg/mL; the ethanol is 75% ethanol solution by volume fraction, and the adding amount is 10% of the total volume.

Preferably, the sterile filtration of step S3 is performed by first filtering through a 0.45 μm diameter filter and then filtering through a 0.22 μm diameter filter.

Preferably, the freeze-drying process of step S4 is:

(1) pre-freezing for 6h in a refrigerator at the temperature of minus 20 ℃ to obtain a pre-freeze-dried product;

(2) and (3) taking out the pre-freeze-dried product obtained in the step (1), placing the product in a vacuum freeze dryer, and freeze-drying for 24 hours to obtain the freeze-dried food.

The invention also provides an application of the polypeptide composition in preparing cosmetics.

Preferably, the polypeptide composition is added in an amount of 6% in the cosmetic.

The raw materials used in the invention have the following effects:

palmitoyl dipeptide-7: is a signal peptide that stimulates the production of matrix proteins (e.g., collagen and elastin) and cell growth, as well as other cellular metabolic functions;

copper tripeptide-1: the GHK-Cu is also called as a carrier peptide, can be used as a transportation promoter of important substances or trace elements (such as copper and magnesium) in cells, can promote the degradation of 'oversized' collagen aggregates, and can promote the generation of collagen, elastin, proteoglycan and glycosaminoglycan and anti-inflammatory and antioxidant reactions regularly. Has the effects of resisting aging, removing wrinkle and repairing.

Acetyl hexapeptide-8: is a neurotransmitter inhibitory peptide which can inhibit acetylcholine release at the neuromuscular junction by acting on different molecular targets, thereby realizing targeted inhibition of wrinkle formation.

Silk peptide: is a peptide capable of inhibiting enzymes, which may decrease the activity of enzymes involved in skin aging, such as matrix metalloprotease MMP and tyrosinase inhibition.

Compared with the prior art, the polypeptide composition provided by the invention has the following advantages: the polypeptide composition provided by the invention is easy to store, mild, free of stimulation and toxic and side effects, is beneficial to promoting the generation of collagen and elastin, and has the effects of resisting aging and promoting repair.

Detailed Description

The present invention is further explained with reference to the following specific examples, but it should be noted that the following examples are only illustrative of the present invention and should not be construed as limiting the present invention, and all technical solutions similar or equivalent to the present invention are within the scope of the present invention. The method and the device are operated according to the conventional technical method and the content of the instrument instruction, wherein the specific technology or condition is not indicated in the embodiment; the reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

The palmitoyl dipeptide-7 can be purchased from Hangzhou Xingyun Biotechnology limited, and has a CAS number of 911813-90-6; the copper tripeptide-1 can be purchased from Nanjing Maotai medicine science and technology Limited, and the purity is 99%; the acetyl hexapeptide-8 can be purchased from Nanjing Lyon Biotech, Inc., with CAS number of 616204-22-9; the silk peptide can be purchased from Hefeibomei biotechnology Limited liability company with the product number of BBM 1118.

Example 1A polypeptide composition having anti-aging and repairing effects

The polypeptide composition comprises the following components in percentage by mass: 30% palmitoyl dipeptide-7, 45% copper tripeptide-1, 15% acetyl hexapeptide-8, 10% silk peptide.

The preparation method of the polypeptide composition comprises the following steps:

s1, respectively taking palmitoyl dipeptide-7, copper tripeptide-1, acetyl hexapeptide-8 and silk peptide, stirring for 20min at the rotating speed of 500rpm until the mixture is uniformly stirred to obtain a mixture I;

s2, adding the mixture I prepared in the step S1 into deionized water, stirring and dissolving, wherein the material-liquid ratio of the mixture I to the deionized water is 1: 4 mg/mL; adding 75% by volume of ethanol solution with volume of 10% of the total volume for dissolution assisting, and dissolving for 40min to obtain mixed polypeptide solution;

s3, sterilizing and filtering the mixed polypeptide solution prepared in the step S2 to obtain a mixed filtrate; the sterilization filtration is completed by filtration with a 0.45 μm diameter filter membrane and then filtration with a 0.22 μm diameter filter membrane;

s4, finally, freeze-drying the mixed filtrate obtained in the step S3 to obtain the compound feed additive; step S4 the freeze-drying process includes: (1) pre-freezing for 6h in a refrigerator at the temperature of minus 20 ℃ to obtain a pre-freeze-dried product; (2) and (2) taking out the pre-freeze-dried product obtained in the step (1), placing the product in a vacuum freeze dryer (the vacuum degree is lower than 10Pa), and freeze-drying for 24 hours to obtain the freeze-dried food.

Example 2A polypeptide composition having anti-aging and repairing effects

The polypeptide composition comprises the following components in percentage by mass: 25% palmitoyl dipeptide-7, 40% copper tripeptide-1, 20% acetyl hexapeptide-8, 15% silk peptide;

the preparation method of the polypeptide composition is similar to that of example 1.

Example 3A polypeptide composition having anti-aging and repairing effects

The polypeptide composition comprises the following components in percentage by mass: 28% palmitoyl dipeptide-7, 30% copper tripeptide-1, 22% acetyl hexapeptide-8, 20% silk peptide;

EXAMPLE 4 an emulsion containing an anti-aging and restorative polypeptide composition

The emulsion comprises the following components in percentage by mass: component A71.485%, component B28.5%, component C0.015; the component A consists of 10 mass percent of 1, 3-butanediol and 61.485 mass percent of deionized water; the component B consists of 2.5 percent by mass of cholesterol, 10 percent by mass of glycerol, 10 percent by mass of 1-acyl-2-oleoyl-3-phospholipid acetylcholine and 6 percent by mass of the polypeptide composition prepared in the example 1; the component C comprises 0.01 percent of preservative and 0.005 percent of essence by mass percent, and the preservative is butyl p-hydroxybenzoate.

The preparation method of the emulsion containing the polypeptide composition with the anti-aging and repairing effects comprises the following steps:

(1) respectively stirring and uniformly mixing the phase B and the phase A, and heating to 75-80 ℃;

(2) adding the phase B into the phase A, mixing, keeping the temperature at 75-80 ℃, homogenizing for 4-5 min, and then cooling to 40 ℃;

(3) uniformly stirring the phase C at room temperature of 25 ℃ for later use;

(4) and (3) reducing the temperature to 40 ℃, then adding the phase C into the step (2), maintaining the temperature at 40 ℃, stirring for 10min at the stirring speed of 55rpm, and adjusting the pH value of the solution to 5.5 to obtain the product.

EXAMPLE 5 an emulsion containing an anti-aging and restorative polypeptide composition

The components of the emulsion and the preparation method thereof are similar to example 4;

the difference from example 4 is that example 5 employs the polypeptide composition prepared in example 2.

EXAMPLE 6 an emulsion containing an anti-aging and restorative polypeptide composition

the difference from example 4 is that example 6 uses the polypeptide composition prepared in example 3.

Comparative example 1A polypeptide composition

The polypeptide composition is prepared from copper tripeptide-1, acetyl hexapeptide-8 and silk peptide in a mass ratio of 9: 3: 2, preparing a composition;

the preparation method of the polypeptide composition is similar to that of example 1;

the difference from example 1 is that comparative example 1 does not contain palmitoyl dipeptide-7.

Comparative example 2A polypeptide composition

The polypeptide composition is prepared from palmitoyl dipeptide-7, acetyl hexapeptide-8 and silk peptide in a mass ratio of 6: 3: 2, preparing a composition;

the difference from example 1 is that comparative example 2 does not contain copper tripeptide-1.

Comparative example 3A polypeptide composition

The polypeptide composition is prepared from acetyl hexapeptide-8 and silk peptide in a mass ratio of 3: 2, preparing a composition;

the difference from example 1 is that comparative example 3 does not contain palmitoyl dipeptide-7 and copper tripeptide-1.

Test example 1DPPH radical scavenging ability test

1. Test materials: the polypeptide compositions prepared in examples 1-3 and comparative examples 1-3, Vitamin C (VC) and 1, 1-diphenyl-2-trinitrophenylhydrazine (DPPH);

2. the test method comprises the following steps: diluting the polypeptide compositions prepared in the above examples 1-3 and comparative examples 1-3 with purified water to 0.2mg/mL, adding 150. mu.L of each polypeptide composition to a 96-well plate, diluting DPPH with purified water to 0.156mg/mL of DPPH solution, adding 150. mu.L of each polypeptide composition to 96-well plates containing different samples, and starting the reaction; detecting the reaction light absorption value at 517nm of the reaction for 15min at room temperature by using a microplate reader, and respectively marking as A_s，15min(ii) a The blank control group uses absolute ethyl alcohol with the same volume to replace the sample of the test sample, the positive control group uses VC solution with the same volume and 100 mu g/mL to replace the sample, A_s，0minAs a negative control result.

In the formula: absorbance of the sample set was A_s，15min(ii) a The absorbance of the negative control group was A_s，0min(ii) a The absorbance of the blank at 15min was A₀。

3. And (3) test results: the specific test results are shown in table 1.

TABLE 1 comparison of DPPH clearance for different test samples

Note: indicates significant differences compared to the blank group.

As can be seen from Table 1 above, the polypeptide compositions prepared in examples 1-3 and comparative examples 1-3 at a concentration of 200 μ g/mL have significant DPPH radical scavenging effect, and the composition in example 1 has the most significant DPPH radical scavenging rate of about 98%, but the scavenging rate in examples 1-3 is significantly higher than that in comparative examples 1-3.

Test example 2 cytotoxicity and cell proliferation test

1. Test materials: polypeptide compositions prepared in examples 1 to 3 and comparative examples 1 to 3, DMEM basal medium (DMEM medium: penicillin/streptomycin solution 99: 1, v: v), Fetal Bovine Serum (FBS), pancreatin (0.25% containing EDTA), DMSO, CCK-8, PBS solution, 95% ethanol, and DMEM complete medium (DMEM medium: FBS: penicillin/streptomycin solution 89: 10: 1, v/v/v);

2. the test method comprises the following steps:

2.1 cytotoxicity assay: respectively taking 0.2mg of the polypeptide composition, respectively adding the polypeptide composition into 1mL of DMEM complete culture medium (divided into 6 parts of complete culture medium), and taking the polypeptide composition as a detected solution after the polypeptide composition is completely dissolved; 3T3 cells in logarithmic growth phase at 5X 10⁴cells/mL, 100. mu.L/wellSeeded in 96-well cell culture plates at 37 ℃ in 5% CO₂Culturing for 24h in an incubator; discarding the old culture medium, washing with PBS solution, adding 100 μ L of the detected solution into each well of cell solution, adding equal volume of sample solvent (DMEM complete culture medium) into the blank group, and culturing at 37 deg.C for 48 hr; adding 10 mu L of CCK8 solution into each hole, placing the mixture in a constant-temperature incubator at 37 ℃, and incubating for 2h in a dark place; the absorbance was measured at 450nm with 630nm as a reference wavelength, and the measurement results were recorded.

In the formula: absorbance of the sample set was A_s，450nm-A_s，630nm(ii) a Absorbance of blank A_0，450nm-A_0，630nm. 2.2 cell proliferation assay: respectively dissolving the polypeptide compositions in a DMEM basic culture medium to obtain 0.2mg/mL solutions, and carrying out the rest operation processes in the same way as 2.1.

In the formula: absorbance of the sample set was A_s，450nm-A_s，630nm(ii) a Absorbance of blank A_0，450nm-A_0，630nm。

3. And (3) test results: the specific test results are shown in Table 2.

TABLE 2 comparison of the cell viability and proliferation rates of the different test samples 3T3

Group of	Toxicity test cell viability (%)	Cell proliferation Rate (%)
			Blank group	100	0
Positive control group	--	--
			EXAMPLE 1 group	113	36^****
EXAMPLE 2 group	109	35^****
			EXAMPLE 3 group	107	33^****
Comparative example 1 group	102	20^***
			Comparative example 2 group	103	26^***
Comparative example 3 group	100	15^**

Note: indicates significant differences compared to the blank group; - -indicates the absence of such detection

As can be seen from Table 2, the compositions prepared in examples 1 to 3 and comparative examples 1 to 3 at a concentration of 200. mu.g/mL were not toxic to 3T3 cells; the composition has a remarkable promoting effect on the proliferation of 3T3 cells, and the proliferation promoting effect of the composition in the example 1 is most remarkable and is about 36 percent.

Test example 3 cell scratch test

1. Test samples: the polypeptide compositions obtained in examples 1 to 3 and comparative examples 1 to 3; DMEM basal medium (DMEM medium: penicillin/streptomycin solution 99: 1, v: v), Fetal Bovine Serum (FBS), pancreatin (0.25%, containing EDTA), DMSO, CCK-8, PBS solution, 95% ethanol, and DMEM complete medium (DMEM medium: FBS: penicillin/streptomycin solution 89: 10: 1, v/v/v);

2. the test method comprises the following steps: adding 1.0mg of the polypeptide composition into 5mL DMEM basal medium respectively to dissolve into 0.2mg/mL solution, and adjusting the density of 3T3 cells to about 1 × 10 with DMEM complete medium⁵cells/mL, 2mL per well, were plated in 12-well cell culture plates;

adding 5% CO at 37 deg.C₂Incubating the incubator for 24 hours to wait for adherence; simulating skin injury of a human body, specifically marking lines in each hole along a ruler by using a 200 mu L gun head, wherein the lines are vertical to the marking lines on the back of the 12-hole plate and 3 lines are arranged in each hole; discarding the old culture medium, and washing twice with PBS; adding 2mL of sample solution to be detected added with different polypeptide compositions, taking 8% of FBS with the same volume as the positive control, and giving 2mL of PBS to the blank control group; the scratch part is taken out of a plurality of fixed points under a microscope to take pictures (0h and 24 h). And measuring the scratch area of each fixed point by adopting Image J software, and calculating the healing rate.

Cell mobility%

3. And (3) test results: the specific test results are shown in Table 3.

TABLE 3 comparison of cell migration rates of different test samples

Group of	Cell migration (%)
		Blank group	8
Positive control group	67^****
		EXAMPLE 1 group	73^****
EXAMPLE 2 group	70^****
		EXAMPLE 3 group	67^****
Comparative example 1 group	50^****
		Comparative example 2 group	48^****
Comparative example 3 group	32^***

Note: indicates significant differences compared to the blank group;

as can be seen from table 3, the compositions prepared in examples 1 to 3 and comparative examples 1 to 3 at a concentration of 200 μ g/mL have a significant migration promoting effect on 3T3 cell migration, and the composition prepared in example 1 has the most significant migration on 3T3 cells, about 73%, and has a stronger effect than a positive control, so that the composition is non-toxic to 3T3 cells and can promote proliferation and migration of 3T3 cells, and further promote anti-aging, repair and other effects on the skin.

Test example 4 detection of expression of genes involved in anti-aging repair (type I collagen, elastin)

1. Test materials: the polypeptide compositions obtained in examples 1 to 3 and comparative examples 1 to 3; DMEM basal medium (DMEM medium: penicillin/streptomycin solution 99: 1, v: v), Fetal Bovine Serum (FBS), pancreatin (0.25%, EDTA-containing), PBS solution, DMEM complete medium (DMEM medium: FBS: penicillin/streptomycin solution 89: 10: 1, v/v/v), ELISA kit (type i collagen, elastin);

2. the test method comprises the following steps: taking 1.0mg of the polypeptide composition, respectively, adding the polypeptide composition into 5mL of DMEM complete culture medium, dissolving into 0.2mg/mL of solution, and then operating according to the following steps:

(1) plate laying and sample adding: 3T3 cells in logarithmic growth phase at 1X 10⁵cells/mL, 2 mL/well in 12-well plates, 24h after the medium was aspirated, 2mL of the solution containing the different test samples was added, or 2mL of DMEM complete medium was added as a blank control, or 2mL of 50.00. mu.g/L bFGF was added as a positive control, and the plates were incubated at 37 ℃ with 5% CO₂Incubating in an incubator for 24 h;

(2) and (3) RNA extraction: cells were washed with PBS and lysed by adding cell lysate TRIzon. Cell lysis solution was extracted by RNA extraction kit (kang being century permazine organism) and RNA in cells was collected. The RNA concentration of the solution is measured by using Nanodrop software, and the solution is diluted to 100 ng/. mu.L by using non-enzyme water to be used as template RNA;

(3) cDNA was synthesized by PCR and tested for expression of the relevant genes: mixing reagents according to the FastKing one-step method and the first strand synthesis premixed kit of the genomic cDNA (Guangzhou Zhenzhi Biotechnology Co., Ltd.), and finally synthesizing the cDNA by using a PCR instrument, wherein the specific PCR program is 15min at 42 ℃, 3min at 95 ℃ and 1min at 4 ℃;

(4) detecting the expression condition of related genes by qPCR technology: the cDNA obtained in (3) was diluted 10 times and used as a template in accordance with

The qPCR SYBR Green Master Mix (No Rox) kit (Shanghai assist san Bio-Tech Co., Ltd.) instruction mixes TaqDNA polymerase solution with upstream and downstream primers (5. mu.L: 0.5. mu.L), wherein the type I collagen gene primer upstream primer: TGATGGACCTGCTGGCTCT and the downstream primer: TTTCTCCTCTCTGACCGGGA (each primer is diluted to 10. mu.M, and the upstream and downstream primers are mixed in a volume ratio of 1: 1); an upstream primer of an elastin gene primer is AATATGGTGCTGCTGGCCTT, a downstream primer is GGGTTTTCCACCAACTCCCA (each primer is diluted to 10 mu M, and the upstream primer and the downstream primer are mixed according to the volume ratio of 1: 1); and finally, respectively adding 6 mu L of mixed solution and 4 mu L of cDNA into a 96-well plate, and carrying out qPCR reaction in a 10 mu L system in total, wherein the reaction program is as follows:

pre-denaturation at 95 ℃ for 15 min;

denaturation at 95 ℃ for 15s, annealing/extension at 55 ℃ for 15s (repeat 49 cycles);

annealing/extending at 60 ℃ for 20 s;

(5) and (3) adopting a 2^ -delta Delta CT method to perform data processing:

a ═ 2^ (Cq internal reference-Cq gene): wherein A represents the gene expression level of the blank control, and Cq is the original value.

B2 ^ (Cq internal reference-Cq gene); wherein B represents the gene expression level of the test sample, and Cq is the original value.

Relative expression of sample genes-B average/A average 100%.

3. And (3) test results: see table 4 for specific test results.

TABLE 4 comparison of the anti-aging repair-related gene expression results of different test samples

Note: indicates significant differences compared to the blank group

As can be seen from Table 4, the compositions prepared in examples 1 to 3 and comparative examples 1 to 3 at a concentration of 200. mu.g/mL increased the expression of the type I collagen and elastin genes, and the proliferation-promoting effect of the composition of example 1 was most significant, with the relative expression amounts of the type I collagen and elastin genes being about 78% and 69%, respectively. Therefore, the composition can promote the expression of the anti-aging repair related gene, and further promote the anti-aging and repair effects on the skin.

Test example 5 human body patch test

1. Test samples: the emulsions obtained in examples 4 to 6;

2. test subjects: 120 female volunteers, 30-45 years old, randomized into 4 groups of 30 per group, asked: all volunteers are healthy and have no obvious skin diseases;

3. the test method comprises the following steps: each of the above test samples was applied in an amount of 0.025mL to a chamber of a spot tester, and applied to the back or the curved side of the forearm of the subject with a special adhesive tape for external use, after 24 hours, the spot tester was removed, and if any remaining product was wiped off with a paper towel, the skin reaction was observed 24 hours after the spot tester was removed, and the control group was not treated at all, and the results were recorded according to the skin reaction classification standard (see Table 5) in technical Specification for safety of cosmetics (2015).

TABLE 5 grading Standard of skin reactions (ref. technical Specification for safety of cosmetics (2015))

4. And (3) test results: the results of the specific tests are shown in Table 6.

TABLE 6 comparison of skin reaction results for different test samples

As can be seen from Table 6, 30 volunteers showed no adverse reaction to the products of examples 4-6 of the present invention every day, indicating that the composition of the present invention is relatively safe and does not cause allergic reactions.

Finally, it should be noted that the above-mentioned embodiments are merely illustrative of the principles of the present invention and its efficacy, and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Sequence listing

<110> Zhengzhou three armor cosmetics, Inc.; guangdong and Dagenen pharmaceutical engineering research center Co Ltd

<120> polypeptide composition with anti-aging and repairing effects, and preparation method and application thereof

<130> 2021.6.15

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Type I collagen gene-F (Type I collagen gene-F)

<400> 1

tgatggacct gctggctct 19

<210> 2

<211> 20

<212> DNA

<213> Type I collagen gene-R (Type I collagen gene-R)

<400> 2

tttctcctct ctgaccggga 20

<210> 3

<211> 20

<212> DNA

<213> Elastin Gene-F (Elastin gene-F)

<400> 3

aatatggtgc tgctggcctt 20

<210> 4

<211> 20

<212> DNA

<213> Elastin Gene-R (Elastin gene-R)

<400> 4

gggttttcca ccaactccca 20

Claims

1. The polypeptide composition with the anti-aging and repairing effects is characterized by comprising the following components in percentage by mass: 5 to 45 percent of palmitoyl dipeptide-7, 7 to 50 percent of copper tripeptide-1, 3 to 22 percent of acetyl hexapeptide-8 and 5 to 20 percent of silk peptide.

2. The polypeptide composition of claim 1, comprising the following components and mass percentages thereof: 25 to 40 percent of palmitoyl dipeptide-7, 40 to 50 percent of copper tripeptide-1, 8 to 20 percent of acetyl hexapeptide-8 and 10 to 15 percent of silk peptide.

3. The polypeptide composition of claim 2, which consists of the following components in percentage by mass: 30% palmitoyl dipeptide-7, 45% copper tripeptide-1, 15% acetyl hexapeptide-8, 10% silk peptide.

4. A method for preparing a polypeptide composition according to any one of claims 1 to 3, comprising the steps of:

s2, adding the mixture I prepared in the step S1 into deionized water, stirring and dissolving, adding ethanol for assisting dissolution, and dissolving for 30-40 min to prepare a mixed polypeptide solution;

5. The method according to claim 4, wherein the step S1 is performed by stirring at 500rpm for 10-20 min.

6. The method of claim 4, wherein the feed-to-liquid ratio of mixture I to deionized water in step S2 is 1: 4 mg/mL; the ethanol is 75% ethanol solution by volume fraction, and the adding amount is 10% of the total volume.

7. The method of claim 4, wherein the sterilizing filtration of step S3 is performed by filtration through a 0.45 μm diameter filter followed by filtration through a 0.22 μm diameter filter.

8. The method of claim 4, wherein the freeze-drying process of step S4 is:

9. Use of a polypeptide composition according to any one of claims 1 to 3 for the preparation of a cosmetic product.

10. The use according to claim 9, wherein the polypeptide composition is added to the cosmetic in an amount of 6%.