CN113354741A

CN113354741A - SUMO-HarpinEaProtein and its production method and use

Info

Publication number: CN113354741A
Application number: CN202110498842.4A
Authority: CN
Inventors: 孙爱友; 蔡增英; 王众; 孙冰; 王立群; 乔长晟
Original assignee: Ningxia Zhongning Medlar Industry Innovation Research Institute Co ltd; Suzhou Yishuimo Biotechnology Co ltd
Current assignee: Ningxia Zhongning Medlar Industry Innovation Research Institute Co ltd; Suzhou Yishuimo Biotechnology Co ltd
Priority date: 2021-05-08
Filing date: 2021-05-08
Publication date: 2021-09-07

Abstract

The invention belongs to the technical field of biology, and relates to a fusion protein, and preparation and application thereof. In particular to a fusion protein SUMO-Harpin_EaGene sequence, preparation method and Harpin_EaThe application of the plant growth regulator in improving the immunity and stress resistance of plants and promoting the germination and growth of plants. SUMO-Harpin prepared by the invention_EaFusion protein, effectively improves Harpin_EaProduction of protein and Harpin_EaThe protein obtains comprehensive soluble expression, and the purity of the purified protein is further improved. Harpin obtained by the invention_EaThe protein still has the characteristics of the protein, is sensitive to protease and resistant to high temperature, and can enable the plant to generate resistance after being applied to the plant, quickly stimulate the HR reaction of the plant, improve the disease and insect resistance of the plant and obviously promote the growth and development of the plant.

Description

SUMO-HarpinEaProtein and its production method and use

The technical field is as follows:

the invention belongs to the technical field of biology, and relates to a fusion protein, and preparation and application thereof. In particular to a fusion protein SUMO-Harpin_EaGene sequence, preparation method and Harpin_EaThe application of the plant growth regulator in improving the immunity and stress resistance of plants and promoting the germination and growth of plants.

Technical background:

like animals, plants are also difficult to defend from insects, pathogens, and extreme living environments during their growth. Since the discovery of plant immunity by Ray and Beauverie in 1901, the induction of disease resistance in plants has been intensively studied and a system theory has been developed. Plants induce disease resistance (IR), i.e. gain immunity, defined by Kuc in 1982 as: after the induction of external factors, the resistance phenomenon to harmful pathogenic bacteria is generated in the plant body.

"Hypersensitivity" (HR) is the first term used by Stakman in 1915 to describe the response of rust bacteria to rapid and local death of plant cells in rust-resistant cereals. In 1994, Goodman and Novacky defined it as "rapid plant cell death and restriction of pathogen growth". HR may not be restricted to cells that invade or come into direct contact with pathogens. If enough cells die, a significant brown lesion may appear.

Harpin for hypersensitive protein_EaIs a protein which is coded by an HrpN gene and is separated from erwinia amylovora (Erwinia. amylovora) by Welchmin et al in 1992 and can stimulate plants to generate hypersensitive reaction. HrpN is one of three members of the Harpin family. Harpin_EaThe protein can excite various resistance mechanisms in the early stage of inducing the plant to generate resistance, and the broad-spectrum resistance of the plant to pathogens is initiated. A great deal of research shows that Harpin_EaThree pathways are involved in the process of activating defense in plants: ethylene pathway, abscisic acid pathway, systemic acquired resistance, through which plant resistance to insect pest, drought, disease, etc. can be improved.

The Small molecule ubiquitin-like modifying protein SUMO (SUMO) is the portion of the protein that is linked to lysine residues in a variety of target proteins. The addition of SUMO can modulate the ability of proteins to interact with their partners, alter their subcellular localization patterns and control their stability. Ubiquitination, as a reversible post-translational modification process, has been shown to be involved in a number of intracellular processes including nuclear cytosolic transport, apoptosis, protein activation, protein stability, stress response and cell cycle growth. In recent years, SUMO has become an effective biotechnological tool as a fusion system to enhance soluble expression of proteins and reduce proteolytic degradation, which has not been achieved by conventional expression systems.

Thereby the device is provided withVisible, Harpin_EaThe protein plays a crucial role in improving the disease resistance of plants, so the Harpin is improved_EaThe yield and purity of the protein have great significance for industrial production.

The invention content is as follows:

to improve Harpin_EaThe invention provides a protein expression amount and yield, and provides a Harpin using SUMO label_EaModifying to realize high-efficiency soluble expression and purification, and mixing SUMO protein and Harpin_EaThe protein is subjected to fusion expression, and the fusion protein is named as SUMO-Harpin_EaA protein;

the SUMO-Harpin_EaThe protein is specifically as follows:

(1) an amino acid sequence shown in a sequence table SEQ ID NO. 1; or

(2) An amino acid sequence with more than 75% homology of SEQ ID NO. 1; or

(3) One or more amino acid substitutions and/or deletions are/is carried out on the basis of the SEQ ID NO.1, and/or an amino acid sequence with the same function of the SEQ ID NO.1 is obtained after the addition;

the invention also provides a method for coding the SUMO-Harpin_EaA nucleic acid molecule for a protein, which may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA;

further, the SUMO-Harpin_EaThe coding gene of the protein is shown as a sequence table SEQ ID NO. 2;

another object of the present invention is to provide a composition comprising the SUMO-Harpin_EaAn expression cassette, a recombinant vector or a recombinant bacterium of a coding gene of a protein;

further, the expression vector of the recombinant vector may be a pET28a plasmid, a pET30a plasmid, a pBV222 plasmid, or the like;

preferably, the expression vector of the recombinant vector is pET28a (+) plasmid containing T7 strong promoter;

further, the host of the recombinant bacterium may be escherichia coli DH5 α, BL21, C802, or the like;

preferably, the host of the recombinant bacterium is E.coli BL21(DE 3);

the invention also provides a construction method of the recombinant bacterium, which is to optimize the codon of SUMO and Harpin_EaThe coding gene is fused to obtain SUMO-Harpin_EaThe gene is obtained by carrying out enzyme digestion connection on the gene and an expression vector and then transforming the gene into a host cell;

the nucleotide sequence of the SUMO coding gene is shown in SEQ ID NO. 3;

the Harpin_EaThe nucleotide sequence of the coding gene is shown as SEQ ID NO. 4;

further, the recombinant strain takes pET28a (+) plasmid containing T7 strong promoter as a vector and E.coli BL21(DE3) as a host to obtain genetically engineered strain E.coli/SUMO-Harpin_Ea；

The invention also provides a fusion protein SUMO-Harpin_EaThe production method specifically comprises the following steps:

successfully constructed E.coli/SUMO-Harpin_EaInoculating the genetically engineered bacteria into a fermentation medium until OD is reached₆₀₀Reaching 0.6-1.8, adding IPTG to induce expression, centrifuging to obtain thallus, crushing, collecting supernatant, and purifying by Ni-NTA affinity chromatography to obtain SUMO-Harpin with purity over 90%_EaA protein;

further, the culture conditions were: inoculating 1-10% of the culture medium to OD₆₀₀Reaching 0.6-1.8, adding IPTG to the final concentration of 0.1-0.6mM, inducing at 15-20 deg.C and 200rpm for 16-20 h; after 16-20h of induction, SUMO-Harpin_EaThe yield of the protein can reach 0.2-1.7g/L fermentation liquor;

further, the fermentation medium is LB medium containing 50 mug/mL kanamycin;

further, IPTG was added at a final concentration of 0.3 mM;

the invention also provides Harpin_EaThe production method of the monomeric protein comprises the following specific steps:

the fusion protein SUMO-Harpin obtained by purifying the fusion protein by a Ni-NTA column_EaAdding SUMO protease, and performing enzyme digestion reaction in a constant temperature incubator to obtain SUMO protein and Harpin_EaThe monomer protein mixed solution is prepared by mixing the components,then purified by Ni-NTA affinity chromatography to obtain Harpin with purity of about 95%_EaA monomeric protein product;

further, the fusion protein SUMO-Harpin_EaThe protein solution eluted by 300mM imidazole is purified by a nickel column after the bacteria are broken;

further, SUMO protease and fusion protein SUMO-Harpin_EaMixing according to a ratio of 1:1000(w/w), and reacting for 2 hours at 37 ℃ in a dark place;

further, Harpin_EaMonomeric protein is present in the flow-through solution passing through the Ni-NTA column;

the invention also provides the Harpin_EaThe application of the protein in promoting the growth of plants;

preferably, said Harpin_EaThe application method of the protein in promoting plant growth comprises the following steps:

will Harpin_EaThe protein is proportioned into a solution with the final concentration of 0.125-50 mug/mL, and the solution is sprayed on leaf surfaces or irrigated to roots after being singly mixed with chemical pesticides, mixed with other pesticides/microbial fertilizers/soil conditioners/plant stimulants/plant extracts and the like, so that the immunoreaction of plants can be effectively stimulated;

preferably, Harpin_EaThe protein concentration is 0.2 mug/mL;

preferably, the application method is foliar spray;

the invention also provides the SUMO-Harpin_EaThe application of the protein in preparing a plant growth promoter;

the invention also provides the SUMO-Harpin_EaThe coding gene of the protein, or the application of an expression cassette, a recombinant vector or a recombinant bacterium containing the coding gene in promoting the growth of plants;

further, the plant may be wheat, rice, tobacco, pepper, tomato, etc.;

the application can quickly stimulate the immune response of the plant, improve the disease resistance of the plant, promote the growth of the plant and increase the fruit yield.

Has the advantages that:

SUMO-Harpin prepared by the invention_EaFusion protein, effectively improveHarpin_EaProduction of protein and Harpin_EaThe protein obtains comprehensive soluble expression, and the purity of the purified protein is further improved.

Harpin obtained by the invention_EaThe protein still has the characteristics of the protein, is sensitive to protease and resistant to high temperature, and can enable the plant to generate resistance after being applied to the plant, quickly stimulate the HR reaction of the plant, improve the disease and insect resistance of the plant and obviously promote the growth and development of the plant.

Description of the drawings:

FIG. 1: SUMO-Harpin_EaGene PCR verification map

Wherein, M, DNAmarker; 1, SUMO-Harpin_Ea。

FIG. 2: SUMO-Harpin_EaNi-NTA affinity chromatography of protein

Wherein, M, protein marker; 1, crushing a whole bacterium; 2, supernatant of the crushing liquid; 3, precipitating the crushing liquid; 4, flowing through liquid; 5, 50mM imidazole wash; 6,300 mM imidazole eluent.

FIG. 3: SUMO enzyme digestion SUMO-Harpin_EaProtein SDS-PAGE electrophoretic verification map

Wherein, M, protein marker; 1, SUMO-Harpin_Ea300mM imidazole eluent; 2, protein mixed liquor after enzyme digestion of SUMO; 3, protein mixed solution Ni-NTA affinity chromatography flow-through solution; 4, protein mixture Ni-NTA affinity chromatography 300mM imidazole eluent.

FIG. 4: harpin after enzyme digestion_EaHR response profile of protein to tobacco lamina

Wherein, 1, 15 mu g/mL Harpin_EaA protein; 2, 30. mu.g/mL Harpin_EaA protein; 3, 50 ug/mL Harpin_EaA protein; 4,100. mu.g/mL Harpin_EaA protein; 5,200. mu.g/mL Harpin_EaA protein; 6, water; 7, PBS buffer solution; 8, EVP; 9, Protein K treatment of 1h Harpin_EaA protein; 10, 200 mu g/mL Harpin after heating in water bath at 100 ℃ for 10min_EaA protein.

The specific implementation scheme is as follows:

in order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present patent and are not intended to limit the present invention.

The experimental procedures of the following examples are conventional unless otherwise specified; the test materials and reagents used in the following examples were all commercially available unless otherwise specified.

The SUMO-Harpin provided by the invention_EaThe protein can be artificially synthesized according to an amino acid sequence, and can also be obtained by carrying out biological expression on a coding gene.

The invention will be further explained with reference to the drawings and specific embodiments.

Example 1: coli/SUMO-Harpin_EaConstruction of genetically engineered bacteria

The SUMO-Harpin provided by the invention_EaThe protein can be artificially synthesized based on the amino acid sequence, or can be obtained by biologically expressing the encoding gene, and the present example will explain the form of gene expression.

(1) Gene fusion

(ii) primer sequences

SUMO gene (shown in SEQ ID NO. 3) and Harpin_EaThe primers adopted by the fusion (shown in SEQ ID NO. 4) are SUMO FP, SUMO RP and Harpin_Ea FP、Harpin_EaRP, primer sequences are shown in the following table:

name (R)	Gene sequences	Remarks for note
			SUMO FP	CTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCACCATCATCACCA	NcoI cleavage site
SUMO RP	AGACCGCTGGTGTTCAGGCTGCCACCGATCTGCTCACGGT
			Harpin_Ea FP	ACCGTGAGCAGATCGGTGGCAGCCTGAACACCAGCGGTCT
Harpin_Ea RP	TCGACGGAGCTCGAATTCGGATCCTTACGCCGCACCCAGCTTGCCCAGC	BamHI cleavage site

The primer SUMO RP contains 20 bp and Harpin at the 3' end of the SUMO gene _Ea20 bp of 5' end of the gene;

the primer Harpin_Ea

FP containing Harpin

_Ea20 bp of 5 'end of gene and 20 bp of 3' end of SUMO gene;

② Gene fusion

Amplifying the SUMO gene by using a primer SUMO FP and a SUMO RP by using the SUMO gene sequence as a template; by Harpin_EaThe gene is used as a template and Harpin is used as a primer_EaFP and Harpin_EaRP amplification of Harpin_EaA gene; the amplified products were subjected to gene fusion (reaction system 50. mu.L containing 18. mu.L of water, 3. mu.L of the gene of interest, 2. mu.L of the pre-primer, 2. mu.L of the post-primer, 25. mu.L of 2 XPDU, pre-denaturation at 94 ℃ for 90s, denaturation at 94 ℃ for 20s, annealing at 60 ℃ for 20s, extension at 72 ℃ for 51s, 10 rounds of three steps of denaturation, annealing, and extension for 5 min.), using primers SUMO FP and Harpin_EaObtaining SUMO-Harpin by RP amplification and fusion_EaGene (2) engineering bacterium construction

The expression vector was pET28a (+) plasmid containing strong promoter of T7, the host was E.coli BL21(DE3), and pET28a plasmid and SUMO-Harpin were digested with NcoI/BamHI_EaThe gene is connected and transformed, and the positive clone is E.coli/SUMO-Harpin which is successfully constructed as determined by PCR verification and gene sequencing_EaThe results of PCR verification of the genetically engineered bacteria are shown in FIG. 1.

Example 2: SUMO-Harpin_EaInducible expression of fusion proteins

coli/SUMO-Harpin_EaInoculating to LB culture medium containing 50 ug/mL kanamycin, culturing at 37 deg.C overnight at 200rpm for 12h to obtain seed solution;

inoculating the seed solution into LB culture medium containing 50. mu.g/mL kanamycin at an inoculation amount of 5%, continuing the culture at 37 ℃ until OD is reached₆₀₀Reaching 1.0, adding IPTG to a final concentration of 0.3mM, and inducing at 18 ℃ and 200rpm for 18 h; SUMO-Harpin_EaThe yield of the protein can reach 1.7g/L fermentation liquor.

After induction, centrifuging at 8000rpm for 10min, collecting thallus, crushing, centrifuging at 8000rpm for 30min, taking supernatant, filtering the supernatant through a 0.45 μm filter membrane, injecting Ni-NTA affinity chromatography column, taking penetrating sample after reducing the protein sample in the tube by one column volume, washing the nickel column with 4 column volumes of buffer solution, eluting with 50mM and 300mM imidazole respectively, and collecting eluent. The results show that 300mM of imidazole can convert SUMO-Harpin_EaThe protein was completely eluted and the protein purity was about 90%. The protein samples were subjected to SDS-PAGE and the results are shown in FIG. 2, and clear SUMO-Harpin is seen in lane 6_EaThe fusion protein has a band size of about 62 kD.

Example 3: SUMO enzyme digestion SUMO-Harpin_EaValidation of fusion proteins

SUMO-Harpin obtained after purification on Ni-NTA column_EaThe SUMO protease is added into the fusion protein sample, the protease and the sample protein are mixed according to the ratio of 1:1000(w/w), and the mixture is reacted for 2 hours at 37 ℃ in a dark place. The protein mixed solution after enzyme digestion simultaneously contains Harpin_EaProteins and SUMO proteins. Re-injecting the protein mixed solution into the Ni-NTA affinity chromatographic column and loadingCollecting flow-through liquid in the sample process, washing the nickel column by using buffer solution, finally eluting by using 300mM imidazole, and collecting eluent. SDS-PAGE detection is carried out on the protein sample, the result is shown in figure 3, a lane 3 is Harpin obtained after SUMO protease enzyme digestion_EaProtein, protein purity about 95%.

Example 4: harpin_EaDetection of protein response to HR in tobacco leaves

Harpin obtained in example 3_EaThe protein product was diluted with PBS buffer and the following samples were prepared: sample 1: 15 ug/mL Harpin_EaA protein;

sample 2: 30 ug/mL Harpin_EaA protein;

sample 3: 50 ug/mL Harpin_EaA protein;

sample 4: harpin 100 mu g/mL_EaA protein;

sample 5: harpin 200 ug/mL_EaA protein;

sample 6: harpin 200 ug/mL_EaHeating protein in 100 deg.C water bath for 10 min;

negative control 1: water;

negative control 2: PBS buffer solution;

negative control 3: an EVP;

negative control 4: harpin 200 ug/mL_EaTreating Protein and Protein K for 1 h;

the protein samples and the control samples were taken and the tobacco leaves in the growth phase were injected in a volume of 50. mu.l per well. The tobacco after injection was placed in a plant incubator, cultured at 28 ℃ for 3 days, and the size of the scorched spots in the leaves was observed.

The results are shown in FIG. 4, Harpin at 100. mu.g/mL_EaThe protein can induce HR reaction of tobacco leaf, 200 μ g/mL and 100 μ g/mL Harpin_EaCompared with protein, the withered spot area of the tobacco leaf is more than 1 time larger; treating with 100 deg.C water bath for 10min, and collecting Harpin_EaThe protein still can make the tobacco leaf produce HR reaction, and does not obviously influence the biological activity of the protein, which indicates that Harpin obtained by fusing with SUMO label_EaThe protein still has immunological activity, can be prepared in large quantity and has strong practicability。

Example 5: harpin_EaExperiment for promoting seed germination and growth

Healthy and plump wheat seeds are selected and randomly grouped, and each group contains 50 seeds. Will Harpin_EaCarrying out gradient dilution on the protein product by using water, simultaneously selecting water and EVP as blank controls, respectively soaking wheat seeds for 10-12h, then placing the wheat seeds in a plant incubator at 28 ℃ for 24h, and observing the germination rate of wheat, wherein the germination rate is equal to the germination number per 20 wheat grains; the growth of wheat was then observed 7 days later.

The results are shown in Table 1, Harpin_EaThe germination of wheat seeds can be remarkably promoted, the action concentration is low, the germination rate reaches 96% to the maximum after 24h cultivation, and comparison water and PBS blank control are remarkably improved; at the same time, Harpin_EaCan also obviously promote the growth of wheat, and compared with water, the height of wheat is improved by more than 35 percent after the treatment with the optimal action concentration of 1 mu g/mL.

TABLE 1 Harpin_EaPromoting wheat germination and growth

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the claims.

SEQUENCE LISTING

<110> Soviea Biotech Co., Ltd

Ningxia Zhongning matrimony vine Innovation research institute Co., Ltd

<120> SUMO-Harpinea protein and production method and application thereof

<130> 1

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 521

<212> PRT

<213> Artificial sequence

<400> 1

Met Gly Ser Ser His His His His His His Gly Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser Ala Ser Met Ser Asp Ser Glu Val Asn Gln Glu Ala Lys

20 25 30

Pro Glu Val Lys Pro Glu Val Lys Pro Glu Thr His Ile Asn Leu Lys

35 40 45

Val Ser Asp Gly Ser Ser Glu Ile Phe Phe Lys Ile Lys Lys Thr Thr

50 55 60

Pro Leu Arg Arg Leu Met Glu Ala Phe Ala Lys Arg Gln Gly Lys Glu

65 70 75 80

Met Asp Ser Leu Arg Phe Leu Tyr Asp Gly Ile Arg Ile Gln Ala Asp

85 90 95

Gln Thr Pro Glu Asp Leu Asp Met Glu Asp Asn Asp Ile Ile Glu Ala

100 105 110

His Arg Glu Gln Ile Gly Gly Ser Leu Asn Thr Ser Gly Leu Gly Ala

115 120 125

Ser Thr Met Gln Ile Ser Ile Gly Gly Ala Gly Gly Asn Asn Gly Leu

130 135 140

Leu Gly Thr Ser Arg Gln Asn Ala Gly Leu Gly Gly Asn Ser Ala Leu

145 150 155 160

Gly Leu Gly Gly Gly Asn Gln Asn Asp Thr Val Asn Gln Leu Ala Gly

165 170 175

Leu Leu Thr Gly Met Met Met Met Met Ser Met Met Gly Gly Gly Gly

180 185 190

Leu Met Gly Gly Gly Leu Gly Gly Gly Leu Gly Asn Gly Leu Gly Gly

195 200 205

Ser Gly Gly Leu Gly Glu Gly Leu Ser Asn Ala Leu Asn Asp Met Leu

210 215 220

Gly Gly Ser Leu Asn Thr Leu Gly Ser Lys Gly Gly Asn Asn Thr Thr

225 230 235 240

Ser Thr Thr Asn Ser Pro Leu Asp Gln Ala Leu Gly Ile Asn Ser Thr

245 250 255

Ser Gln Asn Asp Asp Ser Thr Ser Gly Thr Asp Ser Thr Ser Asp Ser

260 265 270

Ser Asp Pro Met Gln Gln Leu Leu Lys Met Phe Ser Glu Ile Met Gln

275 280 285

Ser Leu Phe Gly Asp Gly Gln Asp Gly Thr Gln Gly Ser Ser Ser Gly

290 295 300

Gly Lys Gln Pro Thr Glu Gly Glu Gln Asn Ala Tyr Lys Lys Gly Val

305 310 315 320

Thr Asp Ala Leu Ser Gly Leu Met Gly Asn Gly Leu Ser Gln Leu Leu

325 330 335

Gly Asn Gly Gly Leu Gly Gly Gly Gln Gly Gly Asn Ala Gly Thr Gly

340 345 350

Leu Asp Gly Ser Ser Leu Gly Gly Lys Gly Leu Gln Asn Leu Ser Gly

355 360 365

Pro Val Asp Tyr Gln Gln Leu Gly Asn Ala Val Gly Thr Gly Ile Gly

370 375 380

Met Lys Ala Gly Ile Gln Ala Leu Asn Asp Ile Gly Thr His Ser Asp

385 390 395 400

Ser Ser Thr Arg Ser Phe Val Asn Lys Gly Asp Arg Ala Met Ala Lys

405 410 415

Glu Ile Gly Gln Phe Met Asp Gln Tyr Pro Glu Val Phe Gly Lys Pro

420 425 430

Gln Tyr Gln Lys Gly Pro Gly Gln Glu Val Lys Thr Asp Asp Lys Ser

435 440 445

Trp Ala Lys Ala Leu Ser Lys Pro Asp Asp Asp Gly Met Thr Pro Ala

450 455 460

Ser Met Glu Gln Phe Asn Lys Ala Lys Gly Met Ile Lys Ser Ala Met

465 470 475 480

Ala Gly Asp Thr Gly Asn Gly Asn Leu Gln Ala Arg Gly Ala Gly Gly

485 490 495

Ser Ser Leu Gly Ile Asp Ala Met Met Ala Gly Asp Ala Ile Asn Asn

500 505 510

Met Ala Leu Gly Lys Leu Gly Ala Ala

515 520

<210> 2

<211> 1566

<212> DNA

<213> Artificial sequence

<400> 2

atgggcagca gccatcacca tcatcaccac ggtagcggtc tggtgccgcg tggtagcgcg 60

agcatgagcg acagcgaggt taaccaggaa gcgaagccgg aagtgaaacc ggaagttaag 120

ccggagaccc acattaacct gaaagtgagc gatggtagca gcgaaatctt ctttaagatt 180

aagaaaacca ccccgctgcg tcgtctgatg gaagcgttcg cgaaacgtca aggcaaggag 240

atggatagcc tgcgttttct gtacgacggc atccgtattc aggcggatca aaccccggaa 300

gatctggaca tggaggataa cgacatcatt gaagcgcacc gtgagcagat cggtggcagc 360

ctgaacacca gcggtctggg tgcgagcacc atgcaaatca gcattggtgg cgcgggtggc 420

aacaacggtc tgctgggtac cagccgtcag aacgcgggtc tgggtggcaa cagcgcgctg 480

ggtctgggtg gcggtaacca gaacgacacc gttaaccaac tggcgggcct gctgaccggt 540

atgatgatga tgatgagcat gatgggcggt ggcggtctga tgggcggtgg cctgggtggc 600

ggtctgggta acggtctggg cggtagcggc ggtctgggtg aaggcctgag caacgcgctg 660

aacgatatgc tgggcggtag cctgaacacc ctgggtagca aaggcggtaa caacaccacc 720

agcaccacca acagcccgct ggaccaggcg ctgggtatta acagcaccag ccaaaacgac 780

gatagcacca gcggcaccga tagcaccagc gatagcagcg acccgatgca gcaactgctg 840

aaaatgttca gcgagatcat gcagagcctg tttggtgatg gccaagatgg tacccaaggt 900

agcagcagcg gcggtaaaca gccgaccgag ggtgaacaaa acgcgtacaa gaaaggcgtg 960

accgacgcgc tgagcggtct gatgggtaac ggtctgagcc aactgctggg taacggcggt 1020

ctgggcggtg gccaaggtgg caacgcgggt accggtctgg atggtagcag cctgggtggc 1080

aaaggcctgc agaacctgag cggtccggtg gattatcagc aactgggtaa cgcggttggt 1140

accggcatcg gtatgaaggc gggtattcaa gcgctgaacg atatcggcac ccacagcgac 1200

agcagcaccc gtagcttcgt taacaaaggt gaccgtgcga tggcgaagga aattggccag 1260

ttcatggatc aatacccgga agtgtttggt aaaccgcagt atcaaaaggg cccgggtcag 1320

gaagttaaaa ccgacgataa gagctgggcg aaagcgctga gcaagccgga cgatgacggt 1380

atgaccccgg cgagcatgga gcagtttaac aaggcgaagg gtatgatcaa gagcgcgatg 1440

gcgggtgaca ccggtaacgg taacctgcaa gcgcgtggcg cgggtggcag cagcctgggt 1500

attgatgcga tgatggcggg cgacgcgatc aacaacatgg cgctgggcaa gctgggtgcg 1560

gcgtaa 1566

<210> 3

<211> 351

<212> DNA

<213> Intelligent (Homo Sapiens)

<400> 3

agcagccatc accatcatca ccacggtagc ggtctggtgc cgcgtggtag cgcgagcatg 60

agcgacagcg aggttaacca ggaagcgaag ccggaagtga aaccggaagt taagccggag 120

acccacatta acctgaaagt gagcgatggt agcagcgaaa tcttctttaa gattaagaaa 180

accaccccgc tgcgtcgtct gatggaagcg ttcgcgaaac gtcaaggcaa ggagatggat 240

agcctgcgtt ttctgtacga cggcatccgt attcaggcgg atcaaacccc ggaagatctg 300

gacatggagg ataacgacat cattgaagcg caccgtgagc agatcggtgg c 351

<210> 4

<211> 1209

<212> DNA

<213> erwinia amylovora (Erwinia. amylovora)

<400> 4

agcctgaaca ccagcggtct gggtgcgagc accatgcaaa tcagcattgg tggcgcgggt 60

ggcaacaacg gtctgctggg taccagccgt cagaacgcgg gtctgggtgg caacagcgcg 120

ctgggtctgg gtggcggtaa ccagaacgac accgttaacc aactggcggg cctgctgacc 180

ggtatgatga tgatgatgag catgatgggc ggtggcggtc tgatgggcgg tggcctgggt 240

ggcggtctgg gtaacggtct gggcggtagc ggcggtctgg gtgaaggcct gagcaacgcg 300

ctgaacgata tgctgggcgg tagcctgaac accctgggta gcaaaggcgg taacaacacc 360

accagcacca ccaacagccc gctggaccag gcgctgggta ttaacagcac cagccaaaac 420

gacgatagca ccagcggcac cgatagcacc agcgatagca gcgacccgat gcagcaactg 480

ctgaaaatgt tcagcgagat catgcagagc ctgtttggtg atggccaaga tggtacccaa 540

ggtagcagca gcggcggtaa acagccgacc gagggtgaac aaaacgcgta caagaaaggc 600

gtgaccgacg cgctgagcgg tctgatgggt aacggtctga gccaactgct gggtaacggc 660

ggtctgggcg gtggccaagg tggcaacgcg ggtaccggtc tggatggtag cagcctgggt 720

ggcaaaggcc tgcagaacct gagcggtccg gtggattatc agcaactggg taacgcggtt 780

ggtaccggca tcggtatgaa ggcgggtatt caagcgctga acgatatcgg cacccacagc 840

gacagcagca cccgtagctt cgttaacaaa ggtgaccgtg cgatggcgaa ggaaattggc 900

cagttcatgg atcaataccc ggaagtgttt ggtaaaccgc agtatcaaaa gggcccgggt 960

caggaagtta aaaccgacga taagagctgg gcgaaagcgc tgagcaagcc ggacgatgac 1020

ggtatgaccc cggcgagcat ggagcagttt aacaaggcga agggtatgat caagagcgcg 1080

atggcgggtg acaccggtaa cggtaacctg caagcgcgtg gcgcgggtgg cagcagcctg 1140

ggtattgatg cgatgatggc gggcgacgcg atcaacaaca tggcgctggg caagctgggt 1200

gcggcgtaa 1209

Claims

1. SUMO-Harpin_EaProtein, characterized in that said SUMO-Harpin_EaThe protein is specifically as follows:

(1) an amino acid sequence shown in a sequence table SEQ ID NO. 1; or

(2) An amino acid sequence with more than 75% homology of SEQ ID NO. 1; or

(3) An amino acid sequence with the same function as the SEQ ID NO.1 obtained after one or more amino acid substitutions, and/or deletions, and/or additions are carried out on the basis of the SEQ ID NO. 1.

2. Encoding the SUMO-Harpin of claim 1_EaA nucleic acid molecule for a protein.

3. The nucleic acid molecule of claim 2, wherein the nucleotide sequence is as set forth in SEQ ID No.2 of the sequence listing.

4. An expression cassette, recombinant vector or recombinant bacterium comprising the nucleic acid molecule of claim 2 or 3.

5. A method of making the SUMO-Harpin of claim 1_EaMethod for producing protein, characterized in that a fermentation medium is inoculated with the recombinant bacterium according to claim 4 in an inoculum size of 1-10% until OD is reached₆₀₀Reaching 0.6-1.8, adding IPTG to the final concentration of 0.0.1-0.6mM, inducing at 15-20 deg.C and 200rpm for 16-20 h.

6. The SUMO-Harpin according to any of claims 1-4_EaThe protein, the nucleic acid molecule, the expression cassette containing the nucleic acid molecule, the recombinant vector or the recombinant bacterium or the application of the protein, the nucleic acid molecule, the expression cassette containing the nucleic acid molecule, the recombinant vector or the recombinant bacterium in promoting the growth of plants or preparing plant growth promoters.

7. Preparation of Harpin_EaMethod for the production of monomeric proteins, characterized in that the protein SUMO-Harpin_EaObtained by enzyme digestion of SUMO protease.

8.Harpin_EaThe use of a protein for promoting plant growth.

9. Use according to claim 8, wherein Harpin is applied_EaThe protein is proportioned into a solution with the final concentration of 0.125-50 mug/mL, and the solution is sprayed on leaf surfaces or irrigated to roots after being singly mixed with chemical pesticides, mixed with other pesticides, microbial fertilizers, soil conditioners, plant stimulants and plant extracts.