CN113337584A - pH-sensitive nucleic acid quantitative detection method and device - Google Patents
pH-sensitive nucleic acid quantitative detection method and device Download PDFInfo
- Publication number
- CN113337584A CN113337584A CN202110755544.9A CN202110755544A CN113337584A CN 113337584 A CN113337584 A CN 113337584A CN 202110755544 A CN202110755544 A CN 202110755544A CN 113337584 A CN113337584 A CN 113337584A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- time
- reaction
- initial concentration
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method and a device for detecting nucleic acid quantitatively and sensitively by pH, wherein the method comprises the following steps: s1, using a plurality of reference templates, performing a nucleic acid amplification reaction and detecting the real-time pH value of the amplification reaction solution; s2, obtaining an S-shaped curve of the pH value changing along with time in the amplification process of each reference template, and determining the pH threshold value of the S-shaped curve of each reference template in the rapid amplification period; s3, establishing an initial concentration-time standard curve according to the initial concentration of each reference template and the time taken for the amplification process to reach a pH threshold; s4, carrying out nucleic acid amplification reaction on the sample to be detected under the same condition as the step S1, detecting the real-time pH value, and determining the time for reaching the pH threshold value; wherein, the nucleic acid species and the sequence of the sample to be detected are the same as those of the reference template; and S5, determining the initial concentration of the sample to be detected according to the initial concentration-time standard curve and the time determined in the step S4. The invention is beneficial to realizing the simplification and miniaturization of the structure of the detection device, is convenient to operate and has higher detection sensitivity and accuracy.
Description
Technical Field
The invention relates to the field of nucleic acid detection, in particular to a pH-sensitive nucleic acid quantitative detection method and a pH-sensitive nucleic acid quantitative detection device.
Background
Quantitative detection of nucleic acids is a technique for amplifying nucleic acids and monitoring the amplification process by different means to obtain the initial concentration of nucleic acids before amplification. The conventional Polymerase Chain Reaction (PCR) can only roughly detect the amount of an amplification product after the reaction is completed, i.e., a so-called end-point method, and cannot be used for quantitatively detecting a nucleic acid in a sample. This is mainly because, as the reaction proceeds, primers and nucleotide raw materials are consumed and eventually cannot be exponentially amplified. Therefore, in conventional PCR, there is no linear relationship between the final yield of the amplification product and the initial copy number of the template.
To achieve quantification of nucleic acids, detection is performed during the exponential amplification phase of the nucleic acids. The basic principle of quantitative PCR is: a nucleic acid template of known concentration is added to the reaction system as a reference, and the primers used to amplify this reference template are identical to those used to amplify the target sequence in the sample. The quantitative detection is realized by comparing the amounts of the amplification products generated by the reference template and the target gene template and determining the ratio between the reference template and the target gene in the reaction system before the reaction starts. In general, this method requires quantification of the reference gene and the target gene during PCR exponential growth. There are many different methods available for detecting and quantifying the amplification product, including measuring the amount of radioactive incorporation during amplification or analyzing stained gels of ethylene bromide using computer software, etc.
In recent years, with the development of precise real-time fluorescent PCR instruments, they can amplify specific nucleic acid sequences and simultaneously determine the concentrations thereof, and can monitor the kinetic processes of PCR amplification in real time during the reaction, which revolutionized the method of nucleic acid quantitative detection. The real-time fluorescence PCR is to detect and quantify the fluorescence reporter group to realize the measurement of the amplified DNA quantity, and the increase of the fluorescence signal is in direct proportion to the quantity of the amplified product in the reaction process. The fluorescent reporter group can be excited by the light source of the real-time fluorescent PCR instrument. By recording the fluorescence emission per cycle, the progress of the PCR into the exponential growth phase can be monitored, the amount of the PCR product at this time is firstly and remarkably increased, and the amount of the PCR product at this time is related to the initial amount of the template, so that the PCR product can be used for quantitative analysis. However, the fluorescence quantitative method requires optical path devices for exciting fluorescence and detecting fluorescence, which makes the detecting instrument expensive and heavy, and is not suitable for on-site rapid detection.
In order to realize quantitative detection of nucleic acid, a new index can be searched to reflect the amplification process. Since one hydrogen ion is released every time one nucleotide is bound during nucleic acid amplification, the pH of the reaction solution is lowered, and the pH value of the reaction solution can also be used as an index for monitoring the progress of nucleic acid amplification.
It is to be noted that the information disclosed in the above background section is only for understanding the background of the present application and thus may include information that does not constitute prior art known to a person of ordinary skill in the art.
Disclosure of Invention
The main objective of the present invention is to overcome the above drawbacks of the background art, and to provide a method and an apparatus for quantitative detection of nucleic acid with pH sensitivity.
In order to achieve the purpose, the invention adopts the following technical scheme:
a pH-sensitive nucleic acid quantitative detection method comprises the following steps:
s1, using a plurality of nucleic acid samples with different known initial concentrations as a plurality of reference templates, performing nucleic acid amplification reaction and detecting the real-time pH value of the amplification reaction solution;
s2, obtaining an S-shaped curve of which the pH value changes along with time in the amplification process of each reference template according to the detection result of the step S1, and determining the pH threshold value of the S-shaped curve of each reference template in the rapid amplification period;
s3, establishing an initial concentration-time standard curve according to the initial concentration of each reference template and the time taken for the amplification process to reach a pH threshold;
s4, carrying out nucleic acid amplification reaction on the sample to be detected under the same condition as the condition in the step S1, detecting the real-time pH value of an amplification reaction solution, and determining the time for the sample to be detected to reach the pH threshold value; wherein, the nucleic acid species and the sequence of the sample to be tested are the same as those of the reference template;
and S5, determining the initial concentration of the sample to be detected according to the initial concentration-time standard curve and the time determined in the step S4.
Further:
the plurality of nucleic acid samples are at least 5 nucleic acid samples of known initial concentration.
The plurality of nucleic acid samples are nucleic acid samples with initial concentration diluted according to gradient, and preferably, a gradient with logarithmic change is adopted; preferably, the initial concentration is 1, 10, 100, 1000, 10000, 100000copies/ml, respectively.
Steps S1-S2 are repeated 3 or more times, and in step S3, the initial concentration-time standard curve is established based on the initial concentrations of the respective reference templates and the respective average values of the time taken for the amplification process to reach the pH threshold.
The nucleic acid amplification method is any one of PCR, LAMP and RPA.
A nucleic acid quantitative detection device for realizing the pH-sensitive nucleic acid quantitative detection method comprises a reaction control unit, a processing unit, a reactor, an incubation system and a pH sensor, wherein the reactor is provided with a plurality of reaction holes, a sample is subjected to a nucleic acid amplification reaction in the reaction holes, the pH sensor is arranged in the reaction holes, the reaction control unit is connected with the incubation system to control the reaction temperature, and the processing unit is connected with the pH sensor, wherein when the processing unit runs a computer program, the data processing procedures in steps S2-S5 of the nucleic acid quantitative detection method are executed to determine the initial concentration of the sample to be detected.
The reaction holes are arranged in an array form, and pH sensitive electrodes are arranged in the reaction holes.
The array of reaction wells is provided with a sealing lid.
The incubation system comprises a set of heating wires.
A display for displaying the sensed data is also included.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a method and a device for quantitatively detecting nucleic acid with pH sensitivity, which realize the quantitative detection of a nucleic acid sample by monitoring the pH value of a reaction solution in real time and constructing a standard curve. Compared with a fluorescent quantitative detection mode, the pH value-based quantitative detection mode only needs to use a pH sensor, removes a complex light path, greatly reduces the volume of an instrument, and simultaneously has higher detection sensitivity and accuracy. Compared with the traditional fluorescent quantitative PCR instrument, the nucleic acid quantitative detection device has no complex light path structure, is more compact and portable, is simple and convenient to operate, has wider application range, and can meet the requirements of various on-site rapid and accurate detections.
Drawings
FIG. 1 is a schematic structural diagram of a pH-sensitive nucleic acid quantitative determination apparatus according to an embodiment of the present invention.
FIG. 2 is a schematic diagram of setting a pH threshold by an amplification curve in one embodiment of the present invention.
Detailed Description
The embodiments of the present invention will be described in detail below. It should be emphasized that the following description is merely exemplary in nature and is not intended to limit the scope of the invention or its application.
It will be understood that when an element is referred to as being "secured to" or "disposed on" another element, it can be directly on the other element or be indirectly on the other element. When an element is referred to as being "connected to" another element, it can be directly connected to the other element or be indirectly connected to the other element. In addition, the connection may be for either a fixed or coupled or communicating function.
It is to be understood that the terms "length," "width," "upper," "lower," "front," "rear," "left," "right," "vertical," "horizontal," "top," "bottom," "inner," "outer," and the like are used in an orientation or positional relationship indicated in the drawings for convenience in describing the embodiments of the present invention and to simplify the description, and are not intended to indicate or imply that the referenced device or element must have a particular orientation, be constructed in a particular orientation, and be in any way limiting of the present invention.
Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the embodiments of the present invention, "a plurality" means two or more unless specifically limited otherwise.
The embodiment of the invention provides a pH-sensitive nucleic acid quantitative detection method, which comprises the following steps:
s1, using a plurality of nucleic acid samples with different known initial concentrations as a plurality of reference templates, performing a nucleic acid amplification reaction and detecting the real-time pH value of the amplification reaction solution.
S2, obtaining the S-shaped curve of the pH value changing with time in the amplification process of each reference template according to the detection result of the step S1, and determining the pH threshold value of the S-shaped curve of each reference template in the rapid amplification period. The pH value during the reaction reflects the amount of the amplified product, and each reference template is in the middle and later stages of amplification when the pH value is increased to the threshold value. As shown in FIG. 2, the pH threshold is set at the exponential-decreasing phase of each sigmoid curve, i.e., the rapid amplification phase, and it is clearly seen that the pH value is just decreased significantly, so that noise interference can be avoided well. And setting the same pH threshold value for a plurality of reference templates and samples to be detected to ensure that the amplification product quantities of the reference templates and the samples to be detected are the same.
S3, establishing an initial concentration-time standard curve according to the initial concentration of each reference template and the time taken for the amplification process to reach the pH threshold.
S4, carrying out nucleic acid amplification reaction on the sample to be detected under the same condition as the condition in the step S1, detecting the real-time pH value of an amplification reaction solution, and determining the time for the sample to be detected to reach the pH threshold value; wherein, the nucleic acid species and the sequence of the sample to be tested are the same as those of the reference template.
And S5, determining the initial concentration of the sample to be detected according to the initial concentration-time standard curve and the time determined in the step S4.
The pH change condition of the reaction solution can reflect the amplification condition of the reaction solution, and the invention uses the time for the amplification of the nucleic acid sample with known concentration to reach the pH threshold value to draw a standard curve, thereby realizing the quantitative detection of the nucleic acid sample with unknown concentration. The invention is beneficial to realizing the simplification and miniaturization of the structure of the detection device, is convenient to operate and has higher detection sensitivity and accuracy.
In a preferred embodiment, the plurality of nucleic acid samples is at least 5 nucleic acid samples of known initial concentration.
In a preferred embodiment, the plurality of nucleic acid samples are nucleic acid samples whose initial concentrations are diluted in a gradient. More preferably, the initial concentration of each sample has a gradient that varies logarithmically. In a preferred embodiment, the initial concentrations of the 6 reference templates are 1, 10, 100, 1000, 10000, 100000copies/ml, respectively.
In a preferred embodiment, steps S1-S2 are repeated 3 more times, and in step S3, the initial concentration-time standard curve is established based on the initial concentrations of the respective reference templates and the respective average values of the time taken for the amplification process to reach the pH threshold.
In different embodiments, the method of nucleic acid amplification may be any of various methods such as PCR, LAMP, RPA, and the like.
Referring to fig. 1, an embodiment of the present invention further provides a quantitative nucleic acid detecting apparatus for implementing the method for quantitatively detecting a pH-sensitive nucleic acid, the apparatus including a reaction control unit, a processing unit 1, a reactor 2, an incubation system 3, and a pH sensor, the reactor 2 having a plurality of reaction wells, a nucleic acid amplification reaction being performed on a sample in the reaction wells, the pH sensor being disposed in the reaction wells, the reaction control unit being connected to the incubation system 3 to control a reaction temperature, and the processing unit 1 being connected to the pH sensor, wherein when the processing unit 1 runs a computer program, the data processing procedures of steps S2-S5 of the method for quantitatively detecting a nucleic acid are performed to determine an initial concentration of the sample to be detected. In an exemplary embodiment, the apparatus for quantitative detection of nucleic acid further comprises a display for displaying the detection data.
In a preferred embodiment, the plurality of reaction wells are arranged in an array form, and a pH-sensitive electrode is disposed in each reaction well.
The invention realizes the quantitative detection of the nucleic acid sample by monitoring the pH value of the reaction solution in real time and constructing a standard curve. Compared with a fluorescent quantitative detection mode, the pH value-based quantitative detection mode only needs to use a pH sensor, removes a complex light path, greatly reduces the volume of an instrument, and simultaneously has higher detection sensitivity and accuracy. Compared with the traditional fluorescent quantitative PCR instrument, the nucleic acid quantitative detection device has no complex light path structure, is more compact and portable, is simple and convenient to operate, has wider application range, and can meet the requirements of various on-site rapid and accurate detections.
Specific embodiments of the present invention are described further below by way of example.
The pH sensitive nucleic acid quantitative detection method adopts a standard curve method (threshold value method) for quantification. Specifically, a standard curve can be drawn according to the time taken for the amplification of more than 5 groups of nucleic acid samples with known concentration to reach the threshold pH value and the initial concentration, and then the initial concentration of the samples is correspondingly obtained on the standard curve according to the time taken for the amplification of the nucleic acid samples with unknown concentration to reach the threshold pH value, so that the quantitative detection of the nucleic acid is realized. The nucleic acid sample with the known concentration for drawing the standard curve and the sample to be tested are the same kind of nucleic acid with the same sequence and use the same amplification reaction solution.
In one embodiment, the method for quantitatively detecting nucleic acid comprises the following steps:
(1) preparing a series of reference templates with concentration gradient dilution, preferably adopting 5 log-level template concentrations, setting the reaction type, the reaction temperature and the reaction time, amplifying the reference templates and the samples to be detected under the same conditions, and detecting the real-time pH value of the reaction solution.
(2) After the reaction is finished, determining a proper pH threshold value in the rapid amplification period according to the S-shaped curve of the pH value changing along with the time in the amplification process, and inputting the pH threshold value into a control system.
(3) The control system derives a standard curve from the initial concentration of the reference template and the time taken to reach the threshold pH. The standard curve is preferably obtained by repeating the procedure 3 or more times.
(4) And the control system correspondingly obtains the initial concentration of the sample on the standard curve according to the time for the sample to be detected to reach the threshold pH value, and outputs a quantitative detection result.
The constructed standard curve can be stored in the system, and can be directly called for use when the same kind of nucleic acid is detected next time, so that a template with known concentration is not needed to be used as a reference. The expected highest and lowest threshold ranges for the samples to be tested do not exceed the upper and lower dynamic range limits of the standard curve.
A pH sensitive nucleic acid quantitative detection device comprises a control system, a pH sensor, a reactor 2 with a reaction hole and an incubation system 3. The control system comprises a computer control system, a main control board (a processing unit 1) and a display, wherein the computer control system is connected with the main control board, and a temperature control signal is sent to the incubation system through the main control board to control the reaction temperature. The main control board is connected with the pH sensor in the reaction hole, receives the real-time pH value of the reaction liquid detected by the pH sensor, processes and analyzes the pH value, and the pH change curve is drawn and analyzed by the computer and can be displayed on the display. Preferably, the reaction holes are a detachable 4X 7 array, pH sensitive electrodes are arranged in the reaction holes, the pH values of 28 sample reaction solutions can be detected simultaneously, and the real-time pH values of the solutions are transmitted to a control system in the nucleic acid amplification reaction process. The incubation system uniformly heats the reaction solution, and different temperature control conditions are used for different nucleic acid amplification reactions. The incubation system consists of a group of heating wires, and the heating temperature and the heating time are controlled according to the reaction requirement.
The computer control system, the main control panel and the display in the control system can be integrated into one device, and a user can directly operate on the touch panel. The reaction well array is provided with a sealing cover to avoid cross contamination. The reaction hole array can be disassembled, so that each group of reaction can be taken out and cleaned after the reaction is finished.
The control system can set parameters such as reaction type, reaction time, reaction temperature, pH threshold value and the like, can input sample concentration for drawing a standard curve, and outputs the concentration of the sample to be detected according to the standard curve and the time for the sample amplification to reach the pH threshold value.
The heating temperature and time are changed by the incubation system to meet the requirements of various amplification reactions. The reaction hole can simultaneously carry out the reaction of a plurality of samples (such as 28 samples), and can realize higher-flux detection.
Example 1
A new coronavirus plasmid was used as a reference template and test sample. The plasmid sequence is as follows:
GAATTCATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAAGGATCC
the detection method comprises the following specific steps:
(1) preparing a series of reference templates (1, 10, 100, 1000, 10000, 100000copies/ml) for gradient dilution by using new corona plasmids, setting the reaction type, reaction temperature and reaction time on a control panel, mixing each reference template and a new corona plasmid sample to be detected with an amplification reaction solution respectively, adding the mixture into different reaction holes, amplifying under the same condition, and detecting the real-time pH value of the reaction solution.
(2) And after the reaction is finished, determining a proper pH threshold value in a rapid amplification period according to an S-shaped curve of which the pH value changes along with time in the amplification process, and inputting the pH threshold value into a control system.
(3) The control system generated a standard curve (3 replicates for averaging) from the initial concentration of plasmid at a known concentration and the time taken to reach the threshold pH.
(4) The control system correspondingly obtains the initial concentration of the sample on the standard curve according to the time for the plasmid sample to be detected to reach the threshold pH value, and outputs a quantitative detection result.
(5) The reaction well array is removed, cleaned and dried for the next use.
The background of the present invention may contain background information related to the problem or environment of the present invention and does not necessarily describe the prior art. Accordingly, the inclusion in the background section is not an admission of prior art by the applicant.
The foregoing is a more detailed description of the invention in connection with specific/preferred embodiments and is not intended to limit the practice of the invention to those descriptions. It will be apparent to those skilled in the art that various substitutions and modifications can be made to the described embodiments without departing from the spirit of the invention, and these substitutions and modifications should be considered to fall within the scope of the invention. In the description herein, references to the description of the term "one embodiment," "some embodiments," "preferred embodiments," "an example," "a specific example," or "some examples" or the like are intended to mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Various embodiments or examples and features of various embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction. Although embodiments of the present invention and their advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the scope of the claims.
Claims (10)
1. A pH-sensitive nucleic acid quantitative detection method is characterized by comprising the following steps:
s1, using a plurality of nucleic acid samples with different known initial concentrations as a plurality of reference templates, performing nucleic acid amplification reaction and detecting the real-time pH value of the amplification reaction solution;
s2, obtaining an S-shaped curve of which the pH value changes along with time in the amplification process of each reference template according to the detection result of the step S1, and determining the pH threshold value of the S-shaped curve of each reference template in the rapid amplification period;
s3, establishing an initial concentration-time standard curve according to the initial concentration of each reference template and the time taken for the amplification process to reach a pH threshold;
s4, carrying out nucleic acid amplification reaction on the sample to be detected under the same condition as the condition in the step S1, detecting the real-time pH value of an amplification reaction solution, and determining the time for the sample to be detected to reach the pH threshold value; wherein, the nucleic acid species and the sequence of the sample to be tested are the same as those of the reference template;
and S5, determining the initial concentration of the sample to be detected according to the initial concentration-time standard curve and the time determined in the step S4.
2. The method for the quantitative detection of pH sensitive nucleic acids according to claim 1, wherein the plurality of nucleic acid samples are at least 5 nucleic acid samples of known initial concentration.
3. The method for the quantitative detection of pH-sensitive nucleic acid according to claim 2, wherein the plurality of nucleic acid samples are nucleic acid samples whose initial concentrations are diluted in a gradient, preferably a gradient varying in logarithmic order; preferably, the initial concentration is 1, 10, 100, 1000, 10000, 100000copies/ml, respectively.
4. The method for the quantitative detection of pH sensitive nucleic acid according to any one of claims 1 to 3, wherein the steps S1-S2 are repeated 3 or more times, and in step S3, the initial concentration-time standard curve is established based on the initial concentration of each reference template and each average value of the time taken for the amplification process to reach the pH threshold.
5. The method for the quantitative detection of pH-sensitive nucleic acid according to any one of claims 1 to 4, wherein the method for nucleic acid amplification is any one of PCR, LAMP, and RPA.
6. A quantitative nucleic acid detecting apparatus for carrying out the method according to any one of claims 1 to 5, comprising a reaction control unit, a processing unit, a reactor, an incubation system, and a pH sensor, wherein the reactor has a plurality of reaction wells in which a nucleic acid amplification reaction is performed on a sample, the pH sensor is disposed in the reaction wells, the reaction control unit is connected to the incubation system to control a reaction temperature, and the processing unit is connected to the pH sensor, wherein the processing unit executes a computer program to perform data processing in steps S2-S5 of the quantitative nucleic acid detecting method to determine an initial concentration of the sample to be detected.
7. The quantitative nucleic acid detecting device according to claim 6, wherein the plurality of reaction wells are arranged in an array form, and each reaction well is provided with a pH sensitive electrode.
8. The quantitative nucleic acid detecting device according to claim 7, wherein the array of reaction wells is provided with a sealing lid.
9. The quantitative nucleic acid detecting device of claim 6, wherein the incubation system comprises a set of heating wires.
10. The quantitative nucleic acid detecting apparatus according to any one of claims 6 to 9, further comprising a display for displaying detection data.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110755544.9A CN113337584A (en) | 2021-07-05 | 2021-07-05 | pH-sensitive nucleic acid quantitative detection method and device |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110755544.9A CN113337584A (en) | 2021-07-05 | 2021-07-05 | pH-sensitive nucleic acid quantitative detection method and device |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113337584A true CN113337584A (en) | 2021-09-03 |
Family
ID=77482483
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110755544.9A Pending CN113337584A (en) | 2021-07-05 | 2021-07-05 | pH-sensitive nucleic acid quantitative detection method and device |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113337584A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110265089A (en) * | 2019-06-20 | 2019-09-20 | 北京科技大学 | A kind of the quantitative analysis of nucleic acids method and its application based on smart machine auxiliary |
-
2021
- 2021-07-05 CN CN202110755544.9A patent/CN113337584A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110265089A (en) * | 2019-06-20 | 2019-09-20 | 北京科技大学 | A kind of the quantitative analysis of nucleic acids method and its application based on smart machine auxiliary |
Non-Patent Citations (2)
| Title |
|---|
| CHRISTOFER TOUMAZOU等: "simultaneous DNA amplifcation and detection using a ph-sensing semiconductor system", NATURE METHODS, pages 2 * |
| SHUNBI XIE等: "Using the ubiquitous pH meter combined with a loop mediated isothermal amplification method for facile and sensitive detection of Nosema bombycis genomic DNA PTP1", CHEM. COMMUN., vol. 50, pages 15933 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200035329A1 (en) | Methods and systems for visualizing and evaluating data | |
| JP2005504543A (en) | An adaptive baseline algorithm for quantitative PCR | |
| CN105264090A (en) | Calibration method, apparatus and computer program product | |
| CN102395977B (en) | Methods for nucleic acid quantification | |
| JP4535310B2 (en) | Real-time nucleic acid amplification multiple test analysis method | |
| CN106636466A (en) | Precise quantification method of HBV (hepatitis B virus) cccDNA (covalent closed circular DNA) | |
| EP1190762B1 (en) | Method for displaying result of hybridization experiment using biochip | |
| CN102576389B (en) | Analytical tool for amplified reaction | |
| CN113337584A (en) | pH-sensitive nucleic acid quantitative detection method and device | |
| CN112888792A (en) | Method for estimating number of cells and device for estimating number of cells | |
| US10510436B2 (en) | Using serial dilutions of reference samples to construct a reference table for sigmoidal fitting in real-time PCR copy number analysis | |
| CN102141533B (en) | Method for analyzing result of loop-mediated isothermal amplification | |
| JP3880361B2 (en) | Fluorescence signal processing method and hybridization reaction result display method | |
| CN104178563B (en) | Measuring method for nucleic acid samples | |
| CN117434044B (en) | PCR instrument fluorescence crosstalk coefficient calibration method, device and application | |
| US20230029306A1 (en) | Method and Device for Determining the Number of Copies of a DNA Sequence That is Present in a Fluid | |
| US20180185838A1 (en) | A biochemical analytical technique | |
| CN118038981A (en) | Method and measuring instrument for extracting Cq value based on curvature change of qPCR amplification curve | |
| CN110358675A (en) | A kind of DNA detection PCR system of fluorescence analysis | |
| JP4271688B2 (en) | Biochip | |
| US20180127813A1 (en) | Nucleic Acid Sequencing using Indicating Polymerases | |
| KR20230089827A (en) | Deep learning-based Radio Frequency bio-sensing system and RF bio-signal analysis method | |
| CN115216523A (en) | Kit and method for detecting copy number of CAR gene in genome | |
| CN114058686A (en) | Digital PCR chip based on impedance detection and detection method thereof | |
| KR20180000261A (en) | Electrochemiluminescence(ECL) measuring method, and computer-readable recording medium for executing program therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |