CN113322250A

CN113322250A - Preparation method of MTSase immobilized enzyme and MTHase immobilized enzyme and application of MTSase immobilized enzyme and MTHase immobilized enzyme in trehalose production

Info

Publication number: CN113322250A
Application number: CN202110204735.6A
Authority: CN
Inventors: 王腾飞; 宋龙祥; 刘洪玲; 王冲; 张慧敏; 郑涵文
Original assignee: Qilu University of Technology
Current assignee: Qilu University of Technology
Priority date: 2021-02-23
Filing date: 2021-02-23
Publication date: 2021-08-31
Anticipated expiration: 2041-02-23
Also published as: CN113322250B

Abstract

The invention relates to a preparation method of MTSase immobilized enzyme and MTHase immobilized enzyme and application thereof in trehalose production, wherein the invention takes interaction polypeptide to spyTag/spyCatcher as mediation, utilizes the characteristic that spyTag/spyCatcher can form interactive short peptide of covalent bond through in vitro specificity self-assembly, carries out one-step recovery and immobilization on maltooligosyl trehalose synthetase MTSase and maltooligosyl trehalose hydrolase MTHase, carries out double-enzyme conversion to produce trehalose experiment, finds that an immobilized carrier taking interaction polypeptide to spyCatcher-CBM as mediation carries out immobilization on recombinase in cell disruption solution, finds that the recovery rate of recombinant enzyme reaches 80.3% through immobilization, and the immobilized enzyme improves enzyme temperature stability, enzyme activity and enzyme repeated utilization rate.

Description

Preparation method of MTSase immobilized enzyme and MTHase immobilized enzyme and application of MTSase immobilized enzyme and MTHase immobilized enzyme in trehalose production

Technical Field

The invention belongs to the technical field of genetic engineering and fermentation engineering, and particularly relates to a preparation method of an MTSase immobilized enzyme and an MTHase immobilized enzyme and application thereof in trehalose production.

Background

Trehalose is a non-reducing disaccharide linked by a 1, 1-glycosidic bond from a glucose residue and is widely found in nature. The sweet taste is tasty and refreshing, and the water-retaining agent has the excellent characteristics of low hygroscopicity, water retention, heat resistance, acid resistance and the like; has nonspecific protection effect on biological cells and active biological macromolecules, can improve the resistance of the biological cells and macromolecules to severe conditions such as high temperature, drying, freezing and the like, and is widely used for antibody drugs, vaccines, diagnostic reagents and biological activity protective agents of living cells during freezing and drying. The special biological characteristics of trehalose enable the trehalose to be widely applied in the fields of food, cosmetics, medicine and agriculture, and the market demand is increased year by year.

The method utilizes the maltooligosyl trehalose synthase MTSase to act on the reducing end of maltooligosaccharaccharides, and the alpha-1, 4-glycosidic bond between two glucose molecules at the reducing end is differentiated to form the alpha-1, 1-glycosidic bond to form the maltooligosaccharyl trehalose; then utilizing maltooligosaccharyl trehalose hydrolase MTHase to specifically cut alpha-1, 4-glycosidic bond adjacent to trehalose group to obtain free trehalose and maltooligosaccharyl with one less trehalose molecule. However, the enzymatic conversion generally employs free enzyme for conversion, the operation stability and storage stability of the free enzyme are poor, the converted enzyme and the product are difficult to separate and reuse, and the cost of product separation and extraction is also increased.

Chinese patent document CN105838704A (application number: 201610320569.5) discloses a nanofiber biomembrane immobilized double enzyme system and a method for catalytic synthesis of trehalose, wherein the method comprises the steps of utilizing specific covalent binding of a polypeptide tag spyCatcher/spyTag, connecting the polypeptide tag spyTag to the carbon end of a CsgA gene, and immobilizing beta-amylase on the cell surface of escherichia coli; taking soluble starch as a substrate, catalyzing the soluble starch on the extracellular surface to form maltose, allowing the maltose to enter into an escherichia coli cell expressing trehalose synthase, and catalyzing the maltose to form trehalose by virtue of the trehalose synthase; however, the preparation of extracellular MTSase and MTHase immobilized enzymes is not involved.

Chinese patent document CN111218467A (application number: 202010106831.2) discloses construction and application of recombinant bacillus subtilis synchronously secreting MTHase and MTSase; chinese patent document CN111647615A (application number: 202010519285.5) discloses a method for constructing a self-assembly expression double-enzyme strain and application thereof; although the above patent discloses the construction of the domain spyCatcher-spyTag and MTSase and MTHase multienzyme system, the technical problem to be solved is to construct MTSase-MTHase multienzyme complexes with different ratios in different bacterial cells, but the preparation of extracellular MTSase and MTHase immobilized enzymes is not involved.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a preparation method of MTSase immobilized enzyme and MTHase immobilized enzyme and application thereof in trehalose production.

The technical scheme of the invention is as follows:

a preparation method of MTSase immobilized enzyme and MTHase immobilized enzyme comprises the following steps:

step 1, constructing a recombinant cellulose binding domain protein spyCatcher-CBM strain

a. B.subtilis 168 genome of Bacillus subtilis is taken as a template, and P is amplified by PCR₄₃A promoter gene fragment;

b. using pUC57-spyCatcher plasmid as a template to amplify spyCatcher gene fragments;

c. using pUC57-CBM plasmid as a template, and carrying out PCR amplification on a cellulose binding domain protein CBM gene fragment;

d. taking pHT01 plasmid as a template, and performing reverse PCR amplification to obtain a linearized pHT vector without a promoter;

e. using seamless cloning to obtain P in step a₄₃Connecting the promoter gene fragment, the spyCatcher gene fragment obtained in the step b and the cellulose binding domain protein CBM gene fragment obtained in the step c to the linearized pHT plasmid obtained in the step d to obtain pHT-P₄₃-spyCatcher-CBM plasmid;

f. the expression plasmid pHT-P obtained in the step e₄₃The spyCatcher-CBM is transformed into B.subtilis WB800n to obtain recombinant B.subtilis WB800n/pHT-P₄₃-spyCatcher-CBM；

g. And f, fermenting the recombinant bacteria in the step f, and crushing the cells by using a high-pressure homogenizer to prepare a cell crushing liquid.

Step 2, preparation of immobilization carrier

And I, adding the regenerated cellulose microspheres into the cell disruption solution obtained in the step g, and purifying and recovering the recombinant cellulose binding domain protein CBM-spyCatcher.

And II, purifying and recovering the recombinant cellulose binding domain protein spyCatcher-CBM in the step I, and fixing the recombinant cellulose binding domain protein spyCatcher-CBM on the regenerated cellulose microspheres by using a cross-linking agent to obtain the spyCatcher-CBM mediated regenerated cellulose microsphere immobilized carrier.

Step 3, the construction of the trehalose production strain comprises the following steps:

(1) PCR amplification of P Using B.subtilis 168 genome as template₄₃A promoter gene fragment;

(2) carrying out PCR amplification on a gene fragment of maltooligosyl trehalose synthase spyTag-MTSase and a gene fragment of maltooligosyl trehalose hydrolase spyTag-MTHase by using a genome of Sulfolobus acidocaldarius ATCC 33909 as a template;

(3) utilizing multi-fragment seamless cloning to obtain P obtained in the step (1)₄₃Respectively connecting the promoter gene segment and the maltooligosyl trehalose synthetase spyTag-MTSase gene segment and the maltooligosyl trehalose hydrolase spyTag-MTHase gene segment obtained in the step (2) to the linearized pHT vector obtained in the step (d) to respectively obtain pHT-P₄₃-spyTag-MTSase plasmid, pHT-P₄₃-spyTag-MTHase plasmid;

(4) the expression plasmid pHT-P obtained in the step (3)₄₃-spyTag-MTSase、pHT-P₄₃The spyTag-MTHase is respectively transformed into B.subtilis WB800n to respectively obtain recombinant bacteria B.subtilis WB800n/pHT-P₄₃-spyTag- MTSase、B.subtilis WB800n/pHT-P₄₃-spyTag-MTHase。

(5) And (4) fermenting the recombinant bacteria in the step (4), and crushing cells by using a high-pressure homogenizer to prepare cell crushing liquid.

Step 4, one-step recovery and immobilization of enzyme

And (3) respectively adding the spyCatcher-CBM mediated regenerated cellulose microsphere immobilized carriers prepared in the step (II) into the cell disruption solution prepared in the step (3), solidifying target protein fused and expressed with spyTag by utilizing the principle that spyTag/spyCatcher can specifically and spontaneously form peptide bonds, and then filtering and recovering the regenerated cellulose microsphere immobilized carriers containing the target protein, namely MTSase immobilized enzyme and MTHase immobilized enzyme.

Preferably, according to the invention, P in step a₄₃The nucleotide sequence of the PCR amplification primer of the promoter gene fragment is as follows:

P₄₃-spyCatcher-F：

CGGCCAGTGAATTCGAGCTCAGCTTCGTGCATGCAGGC SEQ ID NO.1；

P₄₃-spyCatcher-R：

ACCATGGCCATGTGTACATTCCTCTCTTA SEQ ID NO.2。

according to the invention, preferably: the nucleotide sequence of the PCR amplification primer of the spyCatcher gene fragment in the step b is as follows:

spyCatcher-CBM-F：

TGTACACATGGCCATGGTTGACACACTTA SEQ ID NO.3；

spyCatcher-CBM-R：

TCGGTGTCGGATCGATATGGGCATCTCCT SEQ ID NO.4。

preferably, the nucleotide sequence of the PCR amplification primer of the cellulose binding domain protein CBM gene fragment in the step c is as follows:

CBM-spyCatcher-F：

CCATATCGATCCGACACCGACACCGACAACACCG SEQ ID NO.5；

CBM-spyCatcher-R：TTAGTGGTGGTGGTGGTGGTGTTCCAGCGGTTCTTTGC SEQ ID NO.6。

preferably, the nucleotide sequences of the primers for reverse PCR amplification of the gene fragment of pHT vector linearized in step d are as follows:

pHT-F：

TTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCT SEQ ID NO.7；

pHT-R：

GAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGA SEQ ID NO.8。

according to the present invention, the PCR amplification system in steps a, b, c, d is as follows:

2.5. mu.l of 10. mu. mol/L forward primer, 2.5. mu.l of 10. mu. mol/L reverse primer, 2.5. mu.l of gene template, 2 XPhanta Max Master Mix 25. mu.l, plus ddH₂O to 50. mu.l;

the amplification procedure was as follows:

pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, extension at 72 ℃ for 30sec/kb, 30 cycles; extension at 72 ℃ for 5 min.

The extension at 72 ℃ of 30sec/kb means that the amplification rate of DNA polymerase at 72 ℃ is 30sec/kb, and the length of the amplified gene is different, so that 30 cycles of amplification are carried out, and the extension time at 72 ℃ is different.

Preferably, according to the invention, P obtained in step a is cloned seamlessly₄₃Connecting the promoter gene fragment, the spyCatcher gene fragment in the step b and the cellulose binding domain protein CBM gene fragment obtained in the step c to the linearized pHT vector obtained in the step d to obtain an expression plasmid pHT-P₄₃-spycatcher-CBM, said P₄₃The nucleotide sequence of the Catcher-CBM is shown in SEQ ID NO. 15.

According to a preferred embodiment of the invention, the expression plasmid pHT-P constructed in step f from step e₄₃After the spyCatchera-CBM is transferred into B.subtilis WB800n, a recombinant strain B.subtilis WB800n/pHT-P is obtained₄₃-spyCatcherag-CBM。

Further preferably, the recombinant strain screening of the expression plasmid comprises: coating the transformant on an LB plate containing 33ug/mL chloramphenicol resistance, culturing at 37 ℃ for 12h, picking the transformant on the LB plate containing 33ug/mL chloramphenicol resistance with a toothpick, inoculating the transformant to an LB liquid culture medium containing 33ug/mL chloramphenicol resistance, culturing at 37 ℃ for 12h, respectively performing PCR amplification verification by using the bacterial liquid as a template, and performing agarose gel electrophoresis to obtain a corresponding target band to obtain an integrated recombinant strain, namely a recombinant strain WB800n/pHT-P₄₃-spyCatcherag-CBM。

According to the invention, the regenerated cellulose microspheres in the step I are preferably prepared by treating cotton linter pulp with a mass ratio of NaOH/urea/aqueous solution of 7/2/81 after treatment at-15 ℃ to obtain a transparent cellulose solution, and emulsifying cellulose with Span80 and liquid paraffin to prepare the regenerated cellulose microspheres.

More preferably, under the condition of 25 ℃, 4g of cotton linter pulp (cellulose is more than or equal to 95%) is added into 100mL of NaOH/urea/water solution processed at the temperature of-15 ℃ with the mass ratio of 7/2/81, then stirred at 200RPM for 5min, then centrifuged at 6000RPM for 10min for deaeration to obtain transparent cellulose solution, 4g of Span80 is dissolved in 160mL of liquid paraffin and stirred at 1000RPM for 1h, 30mL of the cellulose solution is added, the obtained suspension is kept at the same 1000RPM for continuous stirring and emulsification for 1h, after the completion, the pH value is adjusted to pH 7.0, the suspension is solidified to form regenerated cellulose microspheres, the regenerated cellulose microspheres are obtained by standing, the lower aqueous phase is rinsed with distilled water for three times and then washed with acetone for three times.

According to the invention, in the step I, the regenerated cellulose microspheres are added into the cell disruption solution in the step g, and the recombinant cellulose binding protein spycatcher-CBM is subjected to solid recovery by mixing and stirring at 50-300RPM for 10-60nim under the condition that the pH of the cell disruption solution is 5.0-7.0 and the temperature is 10-60 ℃.

More preferably, the recombinant cellulose binding protein spyCatcherg-CBM is recovered as a solid by mixing and stirring at 100RPM and 30nim at 25 ℃ in a cell disruption solution having a pH of 5.5.

Preferably, according to the invention, the crosslinking agent in step II is glutaraldehyde.

Preferably, the spyCatcher-CBM protein of the recombinant cellulose binding domain protein recovered in the step I is slowly stirred and reacted for 1 to 10 hours at 10 to 100RPM in glutaraldehyde with the mass concentration of 10 to 30 percent, the spyCatcher-CBM protein of the recombinant cellulose binding domain protein is fixed on regenerated cellulose microspheres, and the spyCatcher-CBM mediated regenerated cellulose microsphere immobilized carrier is obtained.

More preferably, the mixture is stirred and reacted for 1h at 50RPM in glutaraldehyde with the mass concentration of 25 percent, the recombinant cellulose binding domain protein spyCatcher-CBM protein is fixed on regenerated cellulose microspheres, and the spyCatcher-CBM mediated regenerated cellulose microsphere fixed carrier is obtained.

According to the invention, preferably: p in the step (1)₄₃The nucleotide sequence of the PCR amplification primer of the promoter gene fragment is as follows:

P₄₃-spyTag-F：

CGGCCAGTGAATTCGAGCTCAGCTTCGTGCATGCAGGC SEQ ID NO.9；

P₄₃-spyTag-R：TATATGCATCAACCATAACAATATGTGCCATGTGTACATTCCTCTCTTA SEQ ID NO.10。

according to the invention, preferably: the nucleotide sequence of the PCR amplification primer of the maltooligosyl trehalose synthetase spyTag-MTSase gene fragment in the step (2) is as follows:

MTSase-spyTag-F：

TGTTATGGTTGATGCATATAAACCGACAAAAATATCAGCAACCTACAG SEQ ID NO.11；

MTSase-spyTag-R：TTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCT SEQ ID NO.12。

according to the invention, the nucleotide sequence of the PCR amplification primer of the maltooligosyl trehalose hydrolase spyTag-MTHase gene fragment in the step (2) is as follows:

spyTag-MTHase-F：

TGTTATGGTTGATGCATATAAACCGACAAAATTTTCGTTCGGTGGAAAT SEQ ID NO.13；

spyTag-MTHase-R：

TTAGTGGTGGTGGTGGTGGTGTTCTAATTGATATACCCC SEQ ID NO.14。

preferably, the PCR amplification system in steps (1) and (2) is as follows:

the amplification procedure was as follows:

The extension at 72 ℃ of 30ec/kb means that the amplification rate of DNA polymerase at 72 ℃ is 30sec/kb, the amplification is performed for 30 cycles because the length of the gene to be amplified is different, and the extension time at 72 ℃ is different.

Preferably, according to the invention, the P obtained in step (1) is cloned seamlessly₄₃Respectively connecting the promoter gene fragment and the gene fragment of the maltooligosyl trehalose synthetase spyTag-MTSase and the gene fragment of the maltooligosyl trehalose hydrolase spyTag-MTHase obtained in the step (2) to the linearized pHT vector obtained in the step (d) to respectively obtain an expression plasmid pHT-P₄₃-spyTag-MTSase、pHT-P₄₃-spyTag-MTHase, said P₄₃The nucleotide sequence of the-spyTag-MTSase is shown as SEQ ID NO.16, and the P is₄₃The nucleotide sequence of the-spyTag-MHSase is shown as SEQ ID NO. 17.

Preference according to the inventionThe recombinant strain screening in the step (4): coating the transformant on an LB plate containing 33ug/mL chloramphenicol resistance, culturing at 37 ℃ for 12h, picking the transformant on the LB plate containing 33ug/mL chloramphenicol resistance with a toothpick, inoculating the transformant to an LB liquid culture medium containing 33ug/mL chloramphenicol resistance, culturing at 37 ℃ for 12h, respectively performing PCR amplification verification by using the bacterial liquid as a template, and performing agarose gel electrophoresis to obtain a corresponding target band to obtain an integrated recombinant strain, namely a recombinant strain WB800n/pHT-P₄₃-spyTag-MTSase、B.subtilis WB800n/pHT-P₄₃-spyTag-MTHase。

According to the preferable method, according to the step 4, after the recombinant bacteria in the step 5 are fermented, the cells are crushed, the spyCatcher-CBM mediated regenerated cellulose microsphere immobilized carriers obtained in the step 2 are respectively added, the incubation is carried out for 30min under the conditions of the temperature of 25 ℃, the pH value of 5.5 and the rotating speed of 100RPM, the regenerated cellulose microsphere immobilized carriers are intercepted and recovered by a filtering mode, and the regenerated cellulose microsphere immobilized carriers containing the target protein, namely the MTSase immobilized enzyme and the MTHase immobilized enzyme are obtained.

The MTSase immobilized enzyme and the MTHase immobilized enzyme are applied to the production of trehalose.

Advantageous effects

1. The invention takes the interaction polypeptide pair spyTag/spyCatcher as a mediation, utilizes the characteristic that the spyTag/spyCatcher can form interactive short peptide of covalent bond through in vitro specificity self-assembly, further recovers and immobilizes the maltooligosyl trehalose synthetase MTSase and the maltooligosyl trehalose hydrolase MTHase, and carries out double-enzyme conversion to produce trehalose experiment, and the experiment shows that the interaction polypeptide pair spyCatcher-CBM is taken as an immobilized carrier for mediating to immobilize the recombinant enzyme in a cell disruption solution, and the recovery rate of the recombinant enzyme by immobilization reaches 80.3 percent.

2. The immobilized enzyme of the invention improves the temperature stability, the activity and the repeated utilization rate of the enzyme.

Drawings

FIG. 1 is P₄₃-spyCatcher-CBM electrophoretogram.

FIG. 2 is P₄₃-spyTag-MTSase electrophoretogram.

FIG. 3 is P₄₃-spyTag-MTHase electrophoretogram.

FIG. 4 is a protein electrophoretogram;

in the figure: lane 1 is protein Marker, Lane 2 is SpyCatcher-CBM, Lane 3 is SpyTag-MTHase, and Lane 4 is SpyTag-MTSase.

FIG. 5 is a spyCatcher-CBM mediated regenerated cellulose microsphere immobilization carrier.

FIG. 6 is an electron microscope image of a regenerated cellulose microsphere immobilized carrier containing MTSase and MTHase;

in the figure, 6-1 and 6-2 are electron micrographs of the regenerated cellulose microsphere immobilized carrier containing MTSase and MTHase, respectively.

FIG. 7 is a bar graph of the immobilization rates of recombinases in examples and comparative examples 1 and 2.

FIG. 8 is the enzyme activity diagrams of the immobilized recombinase of the example and the comparative examples 1 and 2.

FIG. 9 is a graph showing the stability of the temperature of the immobilized recombinase in example and comparative examples 1 and 2.

FIG. 10 is a graph showing the pH stability of the immobilized recombinase in example and comparative examples 1 and 2.

FIG. 11 shows the trehalose conversion rates of the immobilized recombinases of examples and comparative examples 1 and 2.

FIG. 12 is a schematic diagram of enzyme recovery by spyTag/spyCatcher-mediated immobilization on an immobilization carrier.

Detailed Description

The invention will be further illustrated with reference to specific examples, without however restricting the scope of the invention thereto.

The details not described in the examples are according to the state of the art.

Example 1

Construction of recombinant plasmids

1、pHT-P₄₃Construction of-spyCatcher-CBM plasmid

(1) Cloning to obtain P₄₃Promoter gene fragment

Designing a primer to perform PCR amplification on P by taking B.subtilis 168 genome as a template₄₃Promoter groupDue to the fragment.

The P is₄₃PCR amplification of promoter gene fragment, primer nucleotide sequence as follows:

P₄₃-spyCatcher-F：

CGGCCAGTGAATTCGAGCTCAGCTTCGTGCATGCAGGC SEQ ID NO.1；

P₄₃-spyCatcher-R：

ACCATGGCCATGTGTACATTCCTCTCTTA SEQ ID NO.2。

the PCR reaction system is as follows:

10 mu mol/L upstream primer P₄₃2.5. mu.L of spyCatcher-F, 10. mu. mol/L of downstream primer P₄₃-spyCatcher-R2.5. mu.L, gene template 2.5. mu.L, 2X PhantaMax Master Mix 25. mu.L, plus ddH₂O to 50. mu.l;

the above PCR reaction was performed according to the following procedure:

pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, extension at 72 ℃ for 15sec, 30 cycles; extension at 72 ℃ for 5 min.

(2) Cloning to obtain spyCatcher gene fragment

A primer was designed to amplify a spyCatcher gene fragment by PCR using pUC57-spyCatcher as a template.

The nucleotide sequence of the PCR amplification primer of the spyCatcher gene fragment is as follows:

spyCatcher-CBM-F：

TGTACACATGGCCATGGTTGACACACTTA SEQ ID NO.3；

spyCatcher-CBM-R：

TCGGTGTCGGATCGATATGGGCATCTCCT SEQ ID NO.4。

the PCR reaction system is as follows:

2.5 μ L of 10 μmol/L upstream primer spyCatcher-CBM-F, 2.5 μ L of 10 μmol/L downstream primer spyCatcher-CBM-R, 2.5 μ L of gene template, 2 × Phanta Max Master Mix 25 μ L, plus ddH2O to 50 μ L;

the above PCR reaction was performed according to the following procedure:

(3) Cloning to obtain the cellulose binding domain protein CBM gene segment

CBM-spyCatcher-F：

CCATATCGATCCGACACCGACACCGACAACACCG SEQ ID NO.5；

CBM-spyCatcher-R：

TTAGTGGTGGTGGTGGTGGTGTTCCAGCGGTTCTTTGC SEQ ID NO.6。

The PCR reaction system is as follows:

10 u mol/L upstream primer CBM-spyCatcher-F2.5 u L, 10 u mol/L downstream primer CBM-spyCatcher-R2.5 u L, template 2.5 u L, 2 x Phanta Max Master Mix 25 u L, add ddH2O to 50 u L;

the above PCR reaction was performed according to the following procedure:

(4) Cloning to obtain linearized pHT vector gene segment

The pHT01 plasmid is used as a template, and a reverse primer is designed to carry out PCR amplification on a linearized pHT vector gene fragment.

The reverse PCR amplification of the linearized pHT vector gene segment comprises the following primer nucleotide sequences:

pHT-F：

TTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCT SEQ ID NO.7；

pHT-R：

GAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGA SEQ ID NO.8。

the PCR reaction system is as follows:

2.5. mu.L of 10. mu. mol/L forward primer pHT-F, 2.5. mu.L of 10. mu. mol/L reverse primer pHT-R, 2.5. mu.L of template, 2X Phanta Max Master Mix 25. mu.L, plus ddH2O to 50. mu.L;

the above PCR reaction was performed according to the following procedure:

pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, extension at 72 ℃ for 3min for 20sec, 30 cycles; extension at 72 ℃ for 5 min.

(5) And (3) analyzing the length of the fragment by agarose gel electrophoresis with the mass percentage concentration of 1% after the PCR is finished, cutting a target strip according to the size of the fragment, and recovering a gel cutting product by using a Shanghai crude gel recovery kit.

(6) Utilizing a multi-segment seamless cloning kit of Novozam company to carry out the P obtained in the step (1)₄₃And (3) respectively connecting the promoter gene fragment, the spyCatcher gene fragment obtained in the step (2) and the cellulose binding domain protein CBM obtained in the step (3) to the linearized pHT vector obtained in the step (2).

The multi-fragment seamless cloning connector system is as follows:

linearized pHT vector 130 ng; 10ng of P43 gene fragment; 10ng of spyCatcher gene fragment; 10ng of CBM gene fragment; ExnaseII 2. mu.L; 5 × CE buffer 4 μ L; add ddH2O to 20 μ L;

reaction conditions are as follows: the reaction was carried out at 37 ℃ for 30 min.

Respectively transforming and introducing the seamless cloning ligation products into escherichia coli DH5 alpha competent cells to obtain pHT-P₄₃-spyCatcher-CBM. Detecting the P by Shanghai engineering sequencing₄₃The nucleotide sequence of the spyCatcher-CBM is shown in SEQ ID NO. 15.

2、pHT-P₄₃-spyTag-MTSase and pHT-P₄₃Construction of-spyTag-MTHase plasmid

(1) Cloning to obtain P₄₃Promoter gene fragment

Designing a primer to perform PCR amplification on P by taking B.subtilis 168 genome as a template₄₃A promoter gene fragment.

P₄₃-spyTag-F：

CGGCCAGTGAATTCGAGCTCAGCTTCGTGCATGCAGGC SEQ ID NO.9；

the PCR reaction system is as follows:

10 mu mol/L upstream primer P₄₃2.5. mu.L of spyTag-F, 10. mu. mol/L of downstream primer P₄₃-spyTag-R2.5. mu.L, template 2.5. mu.L, 2X Phanta Max Master Mix 25. mu.L, plus ddH2O to 50. mu.l;

the above PCR reaction was performed according to the following procedure:

(2) Cloning to obtain the maltooligosyl trehalose synthetase spyTag-MTSase gene segment

A primer is designed by taking the genome of Sulfolobus acidocaldarius ATCC 33909 of Sulfolobus acidocaldarius as a template to carry out PCR amplification on a maltooligosyl trehalose synthetase spyTag-MTSase gene fragment.

The primer nucleotide sequence of the PCR amplification of the maltooligosyl trehalose synthetase spyTag-MTSase gene segment is as follows:

MTSase-spyTag-F：

TGTTATGGTTGATGCATATAAACCGACAAAAATATCAGCAACCTACAG SEQ ID NO.11；

MTSase-spyTag-R：

TTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCT SEQ ID NO.12。

the PCR reaction system is as follows:

2.5 μ L of 10 μmol/L upstream primer MTSase-spyTag-F, 2.5 μ L of 10 μmol/L downstream primer MTSase-spyTag-R, 2.5 μ L of template, 2 × Phanta Max Master Mix 25 μ L, plus ddH2O to 50 μ L;

the above PCR reaction was performed according to the following procedure:

pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, extension at 72 ℃ for 1min for 10sec, 30 cycles; extension at 72 ℃ for 5 min.

(3) Cloning to obtain the gene fragment of the maltooligosyl trehalose hydrolase spyTag-MTHase

A primer is designed to carry out PCR amplification on a maltooligosyl trehalose hydrolase spyTag-MTHase gene fragment by using a Sulfolobus acidocaldarius ATCC 33909 genome of Sulfolobus acidocaldarius as a template.

The primer nucleotide sequence of the PCR amplification of the maltooligosyl trehalose hydrolase spyTag-MTHase gene segment is as follows:

spyTag-MTHase-F：

TGTTATGGTTGATGCATATAAACCGACAAAATTTTCGTTCGGTGGAAAT SEQ ID NO.13；

spyTag-MTHase-R：

TTAGTGGTGGTGGTGGTGGTGTTCTAATTGATATACCCC SEQ ID NO.14。

the PCR reaction system is as follows:

2.5 mu L of 10 mu mol/L upstream primer spyTag-MTHase-F, 2.5 mu L of 10 mu mol/L downstream primer spyTag-MTHase-R, 2.5 mu L of template, 2 x Phanta Max Master Mix 25 mu L, and ddH2O to 50 mu L;

the above PCR reaction was performed according to the following procedure:

(4) And (3) analyzing the length of the fragment by agarose gel electrophoresis with the mass percentage concentration of 1% after the PCR is finished, cutting a target strip according to the size of the fragment, and recovering a gel cutting product by using a Shanghai crude gel recovery kit.

(5) Utilizing a multi-segment seamless cloning kit of Novozam company to carry out the P obtained in the step (1)₄₃And (3) respectively connecting the promoter gene fragment, the maltooligosyl trehalose synthetase spyTag-MTSase gene fragment obtained in the step (2) and the maltooligosyl trehalose hydrolase spyTag-MTHase gene fragment obtained in the step (3) to a linearized pHT vector.

The multi-fragment seamless cloning connector system is as follows:

linearized pHT vector 130 ng; 10ng of P43 gene fragment; 92ng of spyTag-MTSase gene fragment; ExnaseII 2. mu.L; 5 × CE buffer 4 μ L; add ddH2O to 20 μ L;

linearized pHT vector 130 ng; 10ng of P43 gene fragment; 90ng of spyTag-MTHase gene fragment; ExnaseII 2. mu.L; 5 × CE buffer 4 μ L; add ddH2O to 20 μ L;

Respectively transforming and introducing the seamless cloning ligation products into escherichia coli DH5 alpha competent cells to obtain pHT-P₄₃-spyTag-MTSase and pHT-P₄₃-spyTag-MHSase plasmid. Detecting the P by Shanghai engineering sequencing₄₃The nucleotide sequence of the-spyTag-MTSase is shown as SEQ ID NO.16, P₄₃The nucleotide sequence of the-spyTag-MTHase is shown as SEQ ID NO. 17.

Example 2

Preparation of subtilis WB800n electroporation competent cells

Selecting a B.subtilis WB800n single colony on the surface of a fresh LB solid culture medium to be cultured in 5mL of LB liquid culture medium for 12 hours; 1mL of the culture after 12 hours of culture was inoculated into 50mL of GM medium (GM medium: LB +0.5M sorbitol), and shake-cultured at 37 ℃ to OD₆₀₀Is 1.0. Carrying out ice water bath on the bacterial liquid for 10min, centrifuging at 5000RPM and 4 ℃ for 8min, and collecting thalli; resuspending the cells in 20mL of precooled ETM medium (ETM medium: 0.5M sorbitol +0.5M mannitol + 10% by mass glycerol), centrifuging at 4 ℃ for 8min at 5000RPM, removing the supernatant, and washing 3 times; the washed bacteria were suspended in 500. mu.L of ETM medium and aliquoted into EP tubes, each containing 60. mu.L.

Example 3

The recombinant plasmid prepared in example 1 was transferred into B.subtilis WB800n prepared in example 2

Separately, 6. mu.L of pHT-P₄₃-spyCatcher-CBM、6μL pHT-P₄₃-spyTag-MTSase plasmid and 6. mu.L pHT-P₄₃Adding the-spyTag-MTHase plasmid into 60 mu L B.subtilis WB800n competent cells respectively, incubating on ice for 5min, adding into a precooled electric rotating cup (2mm), performing electric transformation under the conditions of 2500V and 5ms, immediately adding 1mL of RM culture medium (LB +0.5M sorbitol +0.38M glycerol) preheated at 37 ℃ into the electric rotating cup after electric shock is finished, performing shaking recovery culture at 37 ℃ for 3h, coating on an LB plate containing 33ug/mL chloramphenicol, performing inversion culture at 3 ℃, screening a strain containing 33ug/mL chloramphenicol as a positive recombinant B.subtilis WB 35800/pHT-P₄₃-spyCatcher-CBM、 B.subtilis WB800n/pHT-P₄₃spyTag-MTSase and B.subtilis WB800n/pHT-P₄₃-spyTag-MTHase。

Example 4

Identification of the Positive recombinant bacterium prepared in example 3

Inoculating the above-mentioned positive recombinant colony into LB liquid culture medium, culturing overnight, and extracting genome DNA by using kit provided by Shanghai bioengineering Co., Ltd to obtainThe obtained genomic DNA was used as a template, and P's were respectively assigned to the genomic DNA₄₃-spyCatcher-F/ CBM-spyCatcher-R、P₄₃-spyTag-F/MTSase-spyTag-R and P₄₃And (3) performing PCR amplification by using-spyTag-F/spyTag-MTHase-R as a primer.

The colony PCR amplification system is 20 mu L:

10 mu mol/L upstream primer 1 mu L; 1 mu L of 10 mu mol/L downstream primer; 1 mu L of gene template; 2 × Phanta Max Master Mix 10 μ L; by ddH₂O is complemented to 20 mu L;

the colony PCR amplification procedure was as follows:

pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, extension at 72 ℃ for 1min for 30sec, 30 cycles; extension at 72 ℃ for 5 min.

Agarose gel electrophoresis proves that the foreign plasmid pHT-P₄₃spyCatcher-CBM (shown in FIG. 1), pHT-P₄₃-spyTag-MTSase (shown in FIG. 2) and pHT-P₄₃The spyTag-MTHase (shown in FIG. 3) was transferred into B.subtilis WB800n, and the recombinant strain was named B.subtilis WB800n/pHT-P₄₃-spyCatcher-CBM、B.subtilis WB800n/pHT-P₄₃spyTag-MTSase and B.subtilis WB800n/pHT-P₄₃-spyTag-MTHase。

Example 5

Fermentation of the positive recombinant bacteria verified in example 4 above

a. Inoculating the recombinant bacteria into an LB solid culture medium, and carrying out shake culture at the constant temperature of 37 ℃ for 12 h;

b. inoculating the recombinant bacteria in the LB solid culture medium into an LB liquid culture medium, and performing shake culture at the constant temperature of 37 ℃ and 200r/min for 12h to prepare an initial seed solution;

c. b, transferring the seed liquid prepared in the step b into a TB liquid culture medium according to the volume percentage of 1%, and carrying out constant temperature shaking culture at 37 ℃ and 200r/min for 10h to prepare an inoculated seed liquid;

d. and c, transferring the inoculated seed liquid prepared in the step c into a 50L fermentation culture medium according to the volume percentage of 10%, and fermenting for 48 hours at the rotating speed of 500RPM and the temperature of 37 ℃.

Culture medium

LB solid medium: 1g/L of peptone, 0.5g/L of yeast extract powder, 1g/L of NaCl, 2g/L of agar powder and the balance of water;

LB liquid medium: peptone 1g/L, yeast extract 0.5g/L, NaCl 1g/L, and water in balance, pH 7.0;

TB fermentation medium: tryptone 12g/L, yeast extract 24g/L, glycerin 4ml/L, KH₂PO₄2.4 g/L，K₂HPO₄16.5g/L, balance water;

fermentation medium: tryptone 12g/L, yeast extract 24g/L, sucrose 12g/L, KH₂PO₄0.6 g/L，K₂HPO₄4g/L, and the balance of water.

After the fermentation is finished, protein purification is carried out, and the protein electrophoresis pattern is shown in figure 4, wherein: lane 1 is protein Marker, Lane 2 is SpyCatcher-CBM, Lane 3 is SpyTag-MTHase, and Lane 4 is SpyTag-MTSase.

Example 6

Preparation of regenerated cellulose microsphere immobilized carrier

Under the condition of 25 ℃, 4g of cotton linter pulp (cellulose is more than or equal to 95%) is added into 100mL of NaOH/urea/water solution (mass ratio is 7/2/81) treated at the temperature of-15 ℃, then the mixture is stirred for 5min at 200RPM, and then the mixture is centrifuged at 6000RPM for 10min to obtain transparent cellulose solution after deaeration.

After 4g of Span80 were dissolved in 160mL of liquid paraffin and stirred at 1000RPM for 1h, 30mL of the above cellulose solution was added. The resulting suspension was kept at the same speed of 1000RPM and emulsification was continued for 1 h. After the completion of the reaction, the pH was adjusted to 7.0 and the suspension was solidified to form regenerated cellulose microspheres. And standing, rinsing the lower-layer water phase with distilled water for multiple times, and washing with acetone for three times to obtain the regenerated cellulose microspheres.

Example 7

And (3) preparing a spyCatcher-CBM mediated regenerated cellulose microsphere immobilized carrier.

The B.subtilis WB800n/pHT-P after fermentation in example 5₄₃The fermentation broth of-spyCatcher-CBM was subjected to cell disruption using a high pressure homogenizer, the pH of the disruption solution was adjusted to 5.5 after disruption, the regenerated cellulose microspheres prepared in example 6 were added, and the mixture was mixed and stirred at 100RPM at 25 ℃ for 30nim to bind to the recombinant celluloseAnd (3) carrying out solid recovery on the protein spyCatcher-CBM, and eluting with ultrapure water to remove unbound protein to obtain the spyCatcher-CBM-mediated regenerated cellulose microsphere immobilized carrier.

Example 8

Since the spyCatcher-CBM-mediated regenerated cellulose microsphere immobilization carrier prepared in example 7 is unstable, i.e. binding of the cellulose binding domain protein CBM to the regenerated cellulose is reversible, in order to obtain a stable immobilization carrier, the spyCatcher-CBM-mediated regenerated cellulose microsphere immobilization carrier prepared in example 7 is added with 25% glutaraldehyde 50RPM to stir for 1h, the recombinant cellulose binding domain protein spyCatcher-CBM is immobilized on the regenerated cellulose microsphere carrier through a glutaraldehyde crosslinking agent, and then is eluted with phosphate buffer solution with pH 5.5 for 3 times to remove unbound protein, and is stored for later use at 4 ℃ after vacuum drying, and the spyCatcher-CBM-mediated regenerated cellulose microsphere immobilization carrier is shown in FIG. 5; FIG. 5 is a spyCatcher-CBM mediated regenerated cellulose microsphere immobilization carrier.

Example 9

5mg of spyCatcher-CBM-mediated regenerated cellulose microsphere immobilization carrier prepared in example 8 was added to 100mL of B.subtilis WB800n/pHT-P crushed by a high-pressure homogenizer after fermentation in example 5, respectively₄₃spyTag-MTSase and B.subtilis WB800n/pHT-P₄₃Incubating in a spyTag-MTHase bacterial solution for 30min under the stirring conditions of 25 ℃, pH 5.5 and 100RPM, carrying out one-step recovery and immobilization on recombinase spyTag-MTSase and spyTag-MTHase in a fermentation broth, eluting for 3 times by using phosphate buffer solution with pH 5.5 to remove foreign proteins, intercepting and recovering a regenerated cellulose microsphere immobilized carrier by using a filtration mode, and obtaining the regenerated cellulose microsphere immobilized carrier containing target proteins, namely MTSase immobilized enzyme and MTHase immobilized enzyme, wherein electron micrographs are shown in figures 6-1 and 6-2 in figure 6.

Comparative example 1

pHT-P is subjected to₄₃MTSase plasmid and pHT-P₄₃MTHase plasmids are respectively transferred into B.subtilis WB800n bacteria to obtain positive recombinant bacteria, which are named as B.subtilis WB800n/pHT-P₄₃MTSase and B.subtilis WB800n/pHT-P₄₃- MTHase；

The positive recombinant bacterium is fermented by adopting the fermentation method in the embodiment 5, the maltooligosyl trehalose synthase MTSase and the maltooligosyl trehalose hydrolase MTHase are purified respectively, the MTSase and the MTHase are respectively fixed on a regenerated cellulose microsphere carrier under the condition that the purified MTSase and MTHase are stirred and react for 1h at 50RPM in glutaraldehyde with the mass concentration of 25%, and a control experiment is carried out on the regenerated cellulose microsphere carrier mediated by spyTag/spyCatcher by interacting polypeptide.

Comparative example 2

pHT-P is subjected to₄₃-MTSase-CBM plasmid and pHT-P₄₃Transferring MTHase-CBM plasmids into B.subtilis WB800n bacteria respectively to obtain positive recombinant bacteria named as B.subtilis WB800n/pHT-P₄₃MTSase-CBM and B.subtilis WB800n/pHT-P₄₃-MTHase-CBM；

The positive recombinant bacteria are fermented by adopting the fermentation method in the embodiment 5, the maltooligosyl trehalose synthase MTSase-CBM and the maltooligosyl trehalose hydrolase MTHase-CBM are respectively purified, the MTSase-CBM and the MTHase-CBM are respectively fixed on a regenerated cellulose microsphere carrier under the condition that the MTSase-CBM and the MTHase-CBM are stirred and react for 1h at 50RPM in 25% glutaraldehyde by mass concentration, and a control experiment is carried out on the regenerated cellulose microsphere carrier mediated by spyTag/spyCatcher by the interactive polypeptide.

Effect example 1

The efficiency of recombinant enzyme immobilization of example 9, comparative example 1 and comparative example 2 was examined

The recombinant enzymes of example 7, comparative example 1 and comparative example 2 were added to a total concentration of 2mg/mL, respectively, and the recombinant enzymes were immobilized according to the methods of example 9, comparative example 1 and comparative example 2, and the effect of immobilization by the respective methods was examined, and the results are shown in FIG. 7.

The detection method comprises the following steps: example 9 and comparative examples 1 and 2 were immobilized by the respective methods, and then centrifuged at 6000RPM for 10min, and the supernatant was extracted, and the protein content was measured by the Bradford method using bovine serum albumin (BAS) as a standard protein.

The formula of the immobilization rate of the recombinase is as follows:

wherein 2 is the protein concentration at the start of immobilization (mg/mL); c_{On the upper part}The protein concentration (mg/mL) in the supernatant after the immobilization was completed.

The recovery rate of the recombinant enzyme by the immobilization method reaches 80.3 percent.

Effect example 2

The influence of the immobilization method carriers of example 9 and comparative examples 1 and 2 on the enzyme activity of the recombinant enzyme was examined

The detection method comprises the following steps: recombinant malto-oligosyl seaweed prepared in example 9 and comparative examples 1 and 2, respectively, were used in a concentration of 0.1mM

The results of enzyme activity assays of sugar synthase and maltooligosyl trehalose hydrolase at 55 ℃ and pH 5.5 are shown in FIG. 8, and FIG. 8 shows the enzyme activities of the immobilized recombinant enzymes of examples, comparative example 1 and comparative example 2.

Determination of enzyme activity of recombinant maltooligosyl trehalose synthase:

and (3) standard curve determination: 20 mmol.L for measuring malt hexaose concentration standard curve^-1A10 g/L maltohexaose solution is prepared from a phosphate buffer solution with the pH of 5.5, and an absorbance value at OD540 is measured and recorded by a DNS colorimetry, so that a maltohexaose standard curve is drawn.

Determination of enzyme activity of recombinant maltooligosyl trehalose synthase: using 20 mmol. L^-1phosphate buffer solution with pH 5.5, preparing 10g/L solution of malt hexaose, preheating 200 mu L of malt hexaose solution in a water bath kettle at 60 ℃, respectively adding the MTSase immobilized enzyme with the molar concentration of 0.1mM in the embodiment 9, the MTSase immobilized on the regenerated cellulose microsphere carrier in the comparative example 1 and the MTSase-CBM recombinase immobilized on the regenerated cellulose microsphere carrier in the comparative example 2, accurately reacting for 10min, and boiling to inactivate the enzyme. Adding 100 μ L reaction solution into a test tube with a plug, adding 900 μ L water and 1mLDNS, boiling in boiling water for 7min, cooling, and collecting the filtrate8mL of deionized water was added and mixed well. Absorbance was measured at 540 nm.

The enzyme activity unit of the recombinant maltooligosyl trehalose synthase is defined as the amount of all enzymes consuming 1. mu. mol of maltohexaose per minute.

The enzyme activity formula is as follows:

where Δ a ═ Δ 540 (blank) - Δ 540 (sample); 990.85 is the relative molecular mass of maltohexaose; 1.0548 is the slope of the DNS measured maltose standard curve; n is the dilution factor.

Determination of enzyme activity of recombinant maltooligosyl trehalose hydrolase:

and (3) standard curve determination: 20 mmol.L for determination of maltotetraose concentration standard curve^-1A10 g/L maltotetraose solution was prepared in a phosphate buffer solution of pH 5.5, and the absorbance at OD540 was measured and recorded by DNS colorimetry, and a maltotetraose standard curve was plotted.

Determination of the activity of the recombinant maltooligosyl trehalose hydrolase: adding 10 mu of LMTSase concentrated enzyme solution to 490 mu L of 10 g.L^-1In the solution of maltotetraose (20 mmol. multidot.L)^-1p H5.5.5 in phosphate buffer), reacting at 60 deg.C for 2h, and boiling at 100 deg.C for 10min to terminate the reaction. After the solution is cooled, the MTHase immobilized enzyme with the molar concentration of 0.1mM in the embodiment 9, the MTHase immobilized on the regenerated cellulose microsphere carrier in the comparative example 1 and the MTHase-CB recombinase immobilized on the regenerated cellulose microsphere carrier in the comparative example 2 are respectively added, the reaction is carried out for 10min at 60 ℃, the reaction is stopped by boiling in a boiling water bath for 10min, 100 mu L of reaction solution is taken, 900 mu L of water and 1mLDNS solution are added, the reaction solution is boiled in boiling water for 7min, water is added to supplement the solution to 10mL, and finally, the A540 value is measured.

The enzyme activity unit of the recombinant maltooligosyl trehalose hydrolase is defined as: the amount of enzyme required for the conversion to form 1. mu. mol maltotetraose per minute.

The enzyme activity formula is as follows:

wherein Δ A₅₄₀Is the absorbance of the sample at OD 540; 666.58 is the relative molecular mass of maltotetraose; 1.1024 slope of the standard curve for DNS determination for maltotetraose; n is the dilution factor.

Effect example 3

Testing the stability of the immobilized recombinases of example 9 and comparative examples 1 and 2

(1) Example 9 and comparative examples 1 and 2 temperature stability of recombinant enzyme

The immobilized recombinant enzymes of example 9 and comparative examples 1 and 2 were incubated at 60 ℃ under pH 5.5, and samples were taken at 1d, 2d, 3d, 4d, 5d, 7d and 8d to determine the residual enzyme activity, defining 0h enzyme activity as 100%, and the results are shown in FIG. 9.

The method for measuring the enzyme activity of the recombinant maltooligosyl trehalose synthase and recombinant maltooligosyl trehalose hydrolase is the same as that in effect example 2.

(2) Example 9 and comparative examples 1 and 2 pH stability of recombinant enzymes

The immobilized recombinant enzymes of example 9 and comparative examples 1 and 2 were incubated at 4 ℃ under the conditions of pH 3.0, pH 4.0, pH 5.0, pH 6.0, pH 7.0, pH 8.0, pH 9.0, pH 10.0 and pH 11.0, and after 24 hours, a sample was taken to determine the residual enzyme activity, defining the 0 hour enzyme activity as 100%, and the results are shown in FIG. 10.

Effect example 4

Detection of trehalose conversion rates of the immobilized recombinases of example 9 and comparative examples 1 and 2

The immobilized recombinant enzymes of example 9 and comparative examples 1 and 2 were combined in accordance with maltooligosyl trehalose synthase 90 U.g^-1Maltodextrin and maltooligosyl trehalose hydrolase 30U g^-1Maltodextrin is reacted at pH 5.5, 60 deg.C, 100RPM, and maltodextrin mass concentration of 20%, and cyclodextrin glucosyltransferase with mass concentration of 5% is added to transferAfter 2h of conversion, the immobilized enzyme was removed by filtration and added to a new reaction system, the filtrate was treated at 100 ℃ for 10min to inactivate the enzyme, the content of trehalose in the reaction solution (saccharified solution) was measured, and 5 consecutive conversions were carried out in total, and the results are shown in FIG. 11.

The trehalose content detection method comprises the following steps:

measuring the concentration of trehalose generated in the reaction solution (saccharified solution) by high performance liquid chromatography, wherein an amino column is adopted in the measuring process; the column temperature was 40 ℃; the mobile phase adopts a mixed solution of acetonitrile and water, and the volume ratio of the acetonitrile to the water is 3: 1; the flow rate is 1 mL/min; the detector is a differential detector; the detection time is 20 min.

Analysis of results

Through the comparative experiments of the example 9 and the comparative examples 1 and 2, the result shows that the example 9 can effectively reduce the loss of enzyme activity caused by immobilization, and is obviously superior to the enzyme immobilization by the traditional method, because the waste of enzyme and the loss of enzyme activity in the recombinase purification process are avoided, and meanwhile, the recombinase is prevented from contacting with a cross-linking agent in the immobilization process, and the loss of enzyme activity is reduced. Although the immobilization rate of the enzyme in example 9 is lower than the efficiency of the conventional glutaraldehyde immobilized enzyme, the glutaraldehyde-immobilized enzyme needs to be purified and cannot be directly recovered from the cell disruption solution and immobilized.

Although the immobilization method related by the invention has little influence on the pH stability of the enzyme, the temperature stability of the enzyme is improved, the enzyme activity is improved, and the determination of the conversion rate of converting trehalose by 5 times of cycle conversion shows that the method can effectively improve the recovery rate of the enzyme by immobilizing cellulose binding domain protein on regenerated cellulose microspheres through glutaraldehyde, thereby being beneficial to improving the service life of the enzyme; the spyTag/spyCatcher mediated immobilization vector can be used as a universal immobilization vector, and the recombinant enzyme can be specifically recovered and immobilized from fermentation liquor or cell disruption solution only by modifying the recombinant enzyme and fusion expressing 39 basic group (namely 13 amino acids) interaction polypeptide spyTag at the C-end or N-end, so that the recovery and immobilization of other recombinant enzymes can be widely utilized, and the reutilization efficiency of the recombinant enzyme can be improved.

SEQUENCE LISTING

<110> university of Qilu Industrial science

<120> preparation methods of MTSase immobilized enzyme and MTHase immobilized enzyme and application thereof in trehalose production

By using

<160> 17

<170> PatentIn version 3.5

<210> 1

<211> 38

<212> DNA

<213> Artificial sequence

<400> 1

cggccagtga attcgagctc agcttcgtgc atgcaggc 38

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence

<400> 2

accatggcca tgtgtacatt cctctctta 29

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence

<400> 3

tgtacacatg gccatggttg acacactta 29

<210> 4

<211> 29

<212> DNA

<213> Artificial sequence

<400> 4

tcggtgtcgg atcgatatgg gcatctcct 29

<210> 5

<211> 34

<212> DNA

<213> Artificial sequence

<400> 5

ccatatcgat ccgacaccga caccgacaac accg 34

<210> 6

<211> 38

<212> DNA

<213> Artificial sequence

<400> 6

ttagtggtgg tggtggtggt gttccagcgg ttctttgc 38

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence

<400> 7

ttagtggtgg tggtggtggt gcattctaac tagtatcct 39

<210> 8

<211> 39

<212> DNA

<213> Artificial sequence

<400> 8

gagctcgaat tcactggccg tcgttttaca acgtcgtga 39

<210> 9

<211> 38

<212> DNA

<213> Artificial sequence

<400> 9

cggccagtga attcgagctc agcttcgtgc atgcaggc 38

<210> 10

<211> 49

<212> DNA

<213> Artificial sequence

<400> 10

tatatgcatc aaccataaca atatgtgcca tgtgtacatt cctctctta 49

<210> 11

<211> 48

<212> DNA

<213> Artificial sequence

<400> 11

tgttatggtt gatgcatata aaccgacaaa aatatcagca acctacag 48

<210> 12

<211> 39

<212> DNA

<213> Artificial sequence

<400> 12

ttagtggtgg tggtggtggt gcattctaac tagtatcct 39

<210> 13

<211> 49

<212> DNA

<213> Artificial sequence

<400> 13

tgttatggtt gatgcatata aaccgacaaa attttcgttc ggtggaaat 49

<210> 14

<211> 39

<212> DNA

<213> Artificial sequence

<400> 14

ttagtggtgg tggtggtggt gttctaattg atatacccc 39

<210> 15

<211> 1351

<212> DNA

<213> Artificial sequence

<400> 15

agcttcgtgc atgcaggccg gggcatatgg gaaacagcgc ggacggagcg gaatttccaa 60

tttcatgccg cagccgcctg cgctgttctc atttgcggct tccttgtaga gctcagcatt 120

attgagtgga tgattatatt ccttttgata ggtggtatgt tttcgcttga acttttaaat 180

acagccattg aacatacggt tgatttaata actgacaaac atcaccctct tgctaaagcg 240

gccaaggacg ctgccgccgg ggctgtttgc gtttttgccg tgatttcgtg tatcattggt 300

ttacttattt ttttgccaaa gctgtaatgg ctgaaaattc ttacatttat tttacatttt 360

tagaaatggg cgtgaaaaaa agcgcgcgat tatgtaaaat ataaagtgat agcggtacca 420

ttataggtaa gagaggaatg tacacatggc catggttgac acacttagcg gccttagctc 480

cgaacaaggc cagagcggcg atatgacgat cgaagaagac tccgccacgc acatcaagtt 540

cagcaaacgc gacgaggatg gcaaggaact ggccggcgcc acaatggaac ttcgcgacag 600

cagcggcaaa acgatcagca catggatcag cgatggccaa gttaaggact tctatcttta 660

tccgggcaag tacacgttcg tcgaaacagc cgccccagat ggctatgagg ttgccacagc 720

catcacgttt acggtcaacg aacaaggcca agttacggtt aatggcaagg ccacgaaagg 780

agatgcccat atcgatccga caccgacacc gacaacaccg acgccgacgc cgacaacacc 840

gacaccgacg ccgacaagca atctgaaagt tgaattttat aatagcaatc cgagcgatac 900

aacaaattca attaatccgc aatttaaagt tacaaataca ggcagcagcg caattgatct 960

gagcaaactg acacttagat attattatac agttgatggc caaaaagatc aaacattctg 1020

gtgcgatcat gcagcaatta ttggcagcaa tggctcatat aatggcatta caagcaatgt 1080

taaaggcaca tttgttaaaa tgtcatcatc aacaaataat gccgatacat atctggaaat 1140

ttcatttaca ggcggaacac tggaaccggg cgcacacgtt caaattcaag gcagatttgc 1200

aaaaaatgat tggtcaaatt atacacaaag caatgattat agctttaaaa gcgcgtcaca 1260

atttgttgaa tgggatcagg tgacggcgta tctgaacggc gtgctggttt ggggcaaaga 1320

accgctggaa caccaccacc accaccacta a 1351

<210> 16

<211> 2665

<212> DNA

<213> Artificial sequence

<400> 16

agcttcgtgc atgcaggccg gggcatatgg gaaacagcgc ggacggagcg gaatttccaa 60

tttcatgccg cagccgcctg cgctgttctc atttgcggct tccttgtaga gctcagcatt 120

attgagtgga tgattatatt ccttttgata ggtggtatgt tttcgcttga acttttaaat 180

acagccattg aacatacggt tgatttaata actgacaaac atcaccctct tgctaaagcg 240

gccaaggacg ctgccgccgg ggctgtttgc gtttttgccg tgatttcgtg tatcattggt 300

ttacttattt ttttgccaaa gctgtaatgg ctgaaaattc ttacatttat tttacatttt 360

tagaaatggg cgtgaaaaaa agcgcgcgat tatgtaaaat ataaagtgat agcggtacca 420

ttataggtaa gagaggaatg tacacatggc acatattgtt atggttgatg catataaacc 480

gacaaaaata tcagcaacct acagattaca gttaaataag aattttaatt ttggtgacgt 540

aatcgataac ctatggtatt ttaaggattt aggagtttcc catctctacc tctctcctgt 600

cttaatggct tcgccaggaa gtaaccatgg gtacgatgta atagatcatt caaggataaa 660

cgatgaactt ggaggagaga aagaatacag gagattaata gagacagctc atactattgg 720

attaggtatt atacaggaca tagtaccaaa tcacatggct gtaaattctc taaattggcg 780

actaatggat gtattaaaaa tgggtaaaaa gagtaaatat tatacgtact ttgacttttt 840

cccagaagat gataagatac gattacccat attaggagaa gatttagata cagtgataag 900

taaaggttta ttaaagatag taaaagatgg agatgaatat ttcctagaat atttcaaatg 960

gaaacttcct ctaacagagg ttggaaatga tatatacgac actttacaaa aacagaatta 1020

taccctaatg tcttggaaaa atcctcctag ctatagacga ttcttcgatg ttaatacttt 1080

aataggagta aatgtcgaaa aagatcacgt atttcaagag tcccattcaa agatcttaga 1140

tttagatgtt gatggctata gaattgatca tattgatgga ttatatgatc ctgagaaata 1200

tattaatgac ctgaggtcaa taattaaaaa taaaataatt attgtagaaa aaattctggg 1260

atttcaggag gaattaaaat taaattcaga tggaactaca ggatatgact tcttaaatta 1320

ctccaactta ctgtttaatt ttaatcaaga gataatggac agtatatatg agaatttcac 1380

agcggagaaa atatctataa gtgaaagtat aaagaaaata aaagcgcaaa taattgatga 1440

gctatttagt tatgaagtta aaagattagc atcacaacta ggaattagct acgatatatt 1500

gagagattac ctttcttgta tagatgtgta cagaacttat gctaatcaga ttgtaaaaga 1560

gtgtgataag accaatgaga tagaggaagc aaccaaaaga aatccagagg cttatactaa 1620

attacaacaa tatatgccag cagtatacgc taaagcttat gaagatactt tcctctttag 1680

atacaataga ttaatatcca taaatgaggt tggaagcgat ttacgatatt ataagatatc 1740

gcctgatcag tttcatgtat ttaatcaaaa acgaagagga aaaatcacac taaatgccac 1800

tagcacacat gatactaagt ttagtgaaga tgtaaggatg aaaataagtg tattaagtga 1860

atttcctgaa gaatggaaaa ataaggtcga ggaatggcat agtatcataa atccaaaggt 1920

atcaagaaat gatgaatata gatattatca ggttttagtg ggaagttttt atgagggatt 1980

ctctaatgat tttaaggaga gaataaagca acatatgata aaaagtgtca gagaagctaa 2040

gataaatacc tcatggagaa atcaaataaa agaatatgaa aatagagtaa tggaattagt 2100

ggaagaaact tttaccaata aggatttcat taaaagtttc atgaaatttg aaagtaagat 2160

aagaaggata gggatgatta agagcttatc cttggtcgca ttaaaaatta tgtcagccgg 2220

tatacctgat ttttatcagg gaacagaaat atggcgatat ttacttacag atccagataa 2280

cagagtccca gtggatttta agaaattaca cgaaatatta gaaaaatcca aaaaatttga 2340

aaaaaatatg ttagagtcta tggacgatgg aagaattaag atgtatttaa catataagct 2400

tttatcccta agaaaacagt tggctgagga ttttttaaag ggcgagtata agggattaga 2460

tctagaagaa ggactatgtg ggtttattag gtttaacaaa attttggtaa taataaaaac 2520

caagggaagt gttaattaca aactgaaact tgaagaggga gcaatttaca cagatgtatt 2580

gacaggagaa gaaattaaaa aagaggtaca gattaatgag ctacctagga tactagttag 2640

aatgcaccac caccaccacc actaa 2665

<210> 17

<211> 2173

<212> DNA

<213> Artificial sequence

<400> 17

agcttcgtgc atgcaggccg gggcatatgg gaaacagcgc ggacggagcg gaatttccaa 60

tttcatgccg cagccgcctg cgctgttctc atttgcggct tccttgtaga gctcagcatt 120

attgagtgga tgattatatt ccttttgata ggtggtatgt tttcgcttga acttttaaat 180

acagccattg aacatacggt tgatttaata actgacaaac atcaccctct tgctaaagcg 240

gccaaggacg ctgccgccgg ggctgtttgc gtttttgccg tgatttcgtg tatcattggt 300

ttacttattt ttttgccaaa gctgtaatgg ctgaaaattc ttacatttat tttacatttt 360

tagaaatggg cgtgaaaaaa agcgcgcgat tatgtaaaat ataaagtgat agcggtacca 420

ttataggtaa gagaggaatg tacacatggc acatattgtt atggttgatg catataaacc 480

gacaaaattt tcgttcggtg gaaatattga aaaaaataaa ggtatcttta agttatgggc 540

accttatgtt aatagtgtta agctgaagtt aagcaaaaaa cttattccaa tggaaaaaaa 600

cgatgaggga tttttcgaag tagaaataga cgatatcgag gaaaatttaa cctattctta 660

tattatagaa gataagagag agatacctga tcccgcatca cgatatcaac ctttaggagt 720

tcatgacaaa tcacaactta taagaacaga ttatcagatt cttgaccttg gaaaagtaaa 780

aatagaagat ctaataatat atgaactcca cgttggtact ttttcccaag aaggaaattt 840

caaaggagta atagaaaagt tagattacct caaggatcta ggaatcacag gaattgaact 900

gatgcctgtg gcacaatttc cagggaatag agattgggga tacgatggtg tttttctata 960

cgcagttcaa aatacttatg gcggaccatg ggaattggct aagctagtaa acgaggcaca 1020

taaaagggga atagccgtaa ttttggatgt tgtatataat catataggtc ctgagggaaa 1080

ttacctttta ggattaggtc cttatttttc agacagatat aaaactccat ggggattaac 1140

atttaatttt gatgataggg gatgtgatca agttagaaaa ttcattttag aaaatgtcga 1200

gtattggttt aagaccttta aaatcgatgg tctgagactg gatgcagttc atgcaatttt 1260

tgataattcg cctaagcata tcctccaaga gatagctgaa aaagcccatc aattaggaaa 1320

atttgttatt gctgaaagtg atttaaatga tccaaaaata gtaaaagatg attgtggata 1380

taaaatagat gctcaatggg ttgacgattt ccaccacgca gttcatgcat tcataacaaa 1440

agaaaaagat tattattacc aggattttgg aaggatagaa gatatagaga aaacttttaa 1500

agatgttttt gtttatgatg gaaagtattc tagatacaga ggaagaactc atggtgctcc 1560

tgtaggtgat cttccaccac gtaaatttgt agtcttcata caaaatcacg atcaagtagg 1620

aaatagagga aatggggaaa gactttccat attaaccgat aaaacgacat accttatggc 1680

agccacacta tatatactct caccgtatat accgctaata tttatgggcg aggaatatta 1740

tgagacgaat ccttttttct tcttctctga tttctcagat cccgtattaa ttaagggtgt 1800

tagagaaggt agactaaagg aaaataatca aatgatagat ccacaatctg aggaagcgtt 1860

cttaaagagt aaactttcat ggaaaattga tgaggaagtt ttagattatt ataaacaact 1920

gataaatatc agaaagagat ataataattg taaaagggta aaggaagtta ggagagaagg 1980

gaactgtatt actttgatca tggaaaaaat aggaataatt gcatcgtttg atgatattgt 2040

aattaattct aaaattacag gtaatttact tataggcata ggatttccga aaaaattgaa 2100

aaaagatgaa ttaattaagg ttaacagagg tgttggggta tatcaattag aacaccacca 2160

ccaccaccac taa 2173

Claims

1. A preparation method of MTSase immobilized enzyme and MTHase immobilized enzyme is characterized by comprising the following steps:

g. Fermenting the recombinant bacteria in the step f, and crushing cells by using a high-pressure homogenizer to prepare a cell crushing liquid;

step 2, preparation of immobilization carrier

Adding the regenerated cellulose microspheres into the cell disruption solution obtained in the step g, and purifying and recovering the recombinant cellulose binding domain protein CBM-spyCatcher;

II, purifying and recovering the recombinant cellulose binding domain protein spyCatcher-CBM in the step I, and fixing the recombinant cellulose binding domain protein spyCatcher-CBM on regenerated cellulose microspheres by using a cross-linking agent to obtain a spyCatcher-CBM mediated regenerated cellulose microsphere immobilized carrier;

(4) the expression plasmid pHT-P obtained in the step (3)₄₃-spyTag-MTSase、pHT-P₄₃The spyTag-MTHase is respectively transformed into B.subtilis WB800n to respectively obtain recombinant bacteria B.subtilis WB800n/pHT-P₄₃-spyTag-MTSase、B.subtilis WB800n/pHT-P₄₃-spyTag-MTHase；

(5) Fermenting the recombinant bacteria in the step (4), and crushing cells by using a high-pressure homogenizer to prepare cell crushing liquid;

step 4, one-step recovery and immobilization of enzyme

2. The method of claim 1, wherein P in step a₄₃The nucleotide sequences of PCR amplification primers of the promoter gene fragment are SEQ ID NO.1 and SEQ ID NO. 2;

preferably: the nucleotide sequences of the PCR amplification primer of the spyCatcher gene fragment in the step b are SEQ ID NO.3 and SEQ ID NO. 4;

preferably, the nucleotide sequences of the PCR amplification primers of the cellulose binding domain protein CBM gene segments in the step c are SEQ ID NO.5 and SEQ ID NO. 6;

preferably, the reverse PCR amplification primer nucleotide sequences of the pHT vector gene segment linearized in the step d are SEQ ID NO.7 and SEQ ID NO. 8.

3. The method of claim 1, wherein the PCR amplification system in steps a, b, c, d is as follows:

the amplification procedure was as follows:

4. The method of claim 1, wherein P obtained in step a is cloned using seamless cloning₄₃Connecting the promoter gene fragment, the spyCatcher gene fragment in the step b and the cellulose binding domain protein CBM gene fragment obtained in the step c to the linearized pHT vector obtained in the step d to obtain an expression plasmid pHT-P₄₃-spycatcher-CBM, said P₄₃The nucleotide sequence of the Catcher-CBM is shown in SEQ ID NO. 15;

preferably, the expression plasmid pHT-P constructed in step e in step f₄₃After the spyCatchera-CBM is transferred into B.subtilis WB800n, a recombinant strain B.subtilis WB800n/pHT-P is obtained₄₃-spyCatcherag-CBM；

Preferably, the recombinant strain screening of the expression plasmid comprises: coating the transformant on an LB plate containing 33ug/mL chloramphenicol resistance, culturing at 37 ℃ for 12h, picking the transformant on the LB plate containing 33ug/mL chloramphenicol resistance with a toothpick, inoculating the transformant to an LB liquid culture medium containing 33ug/mL chloramphenicol resistance, culturing at 37 ℃ for 12h, respectively performing PCR amplification verification by using the bacterial liquid as a template, and performing agarose gel electrophoresis to obtain a corresponding target band to obtain an integrated recombinant strain, namely a recombinant strain WB800n/pHT-P₄₃-spyCatcherag-CBM。

5. The method as claimed in claim 1, wherein the regenerated cellulose microspheres are prepared by treating linter pulp with NaOH/urea/water solution mass ratio of 7/2/81 after treatment at-15 ℃ to obtain a transparent cellulose solution, emulsifying cellulose with Span80 and liquid paraffin to prepare regenerated cellulose microspheres;

preferably, 4g of linter pulp (cellulose is more than or equal to 95%) is added into 100mL of NaOH/urea/water solution (with the mass ratio of 7/2/81) treated at the temperature of-15 ℃ at the temperature of 25 ℃, then stirred at 200RPM for 5min, and then centrifuged at 6000RPM for 10min to defoam to obtain a transparent cellulose solution, 4g of Span80 is dissolved in 160mL of liquid paraffin and stirred at 1000RPM for 1h, 30mL of the cellulose solution is added, the obtained suspension is kept at the same 1000RPM for continuous stirring and emulsification for 1h, the pH value is adjusted to pH 7.0 after the completion, the suspension is solidified to form regenerated cellulose microspheres, the regenerated cellulose microspheres are obtained by standing, the lower aqueous phase is washed with distilled water for three times and then washed with acetone for three times.

6. The method of claim 1, wherein in step i, the regenerated cellulose microspheres are added to the cell disruption solution in step g, and the recombinant cellulose binding protein spycatchererg-CBM is subjected to solid recovery under the condition of 10-60 ℃ of the cell disruption solution with pH of 5.0-7.0 and mixing and stirring at 50-300RPM of 10-60 nim;

preferably, the recombinant cellulose binding protein spyCatcherg-CBM is recovered as a solid by mixing and stirring at 100RPM for 30nim at 25 ℃ in a cell disruption solution having a pH of 5.5.

7. The method of claim 1 wherein the cross-linking agent in step ii is glutaraldehyde;

preferably, the recombinant cellulose binding domain protein spyCatcher-CBM protein recovered in the step I reacts for 1-10h at 10-100RPM in glutaraldehyde with the mass concentration of 10-30%, the recombinant cellulose binding domain protein spyCatcher-CBM protein is fixed on regenerated cellulose microspheres, and the obtained spyCatcher-CBM mediated regenerated cellulose microsphere immobilization carrier;

preferably, the mixture is stirred and reacted for 1h at 50RPM in glutaraldehyde with the mass concentration of 25 percent, the recombinant cellulose binding domain protein spyCatcher-CBM protein is fixed on regenerated cellulose microspheres, and the spyCatcher-CBM mediated regenerated cellulose microsphere fixed carrier is obtained.

8. The method of claim 1, wherein P in step (1)₄₃The nucleotide sequences of PCR amplification primers of the promoter gene fragment are SEQ ID NO.9 and SEQ ID NO. 10;

preferably: the nucleotide sequences of the PCR amplification primers of the maltooligosyl trehalose synthetase spyTag-MTSase gene fragment in the step (2) are SEQ ID NO.11 and SEQ ID NO. 12;

preferably, the nucleotide sequences of the PCR amplification primers of the maltooligosyl trehalose hydrolase spyTag-MTHase gene fragment in the step (2) are SEQ ID NO.13 and SEQ ID NO. 14;

preferably, the PCR amplification system in steps (1) and (2) is as follows:

the amplification procedure was as follows:

9. The method of claim 1, wherein the P obtained in step (1) is cloned using seamless cloning₄₃Respectively connecting the promoter gene fragment and the gene fragment of the maltooligosyl trehalose synthetase spyTag-MTSase and the gene fragment of the maltooligosyl trehalose hydrolase spyTag-MTHase obtained in the step (2) to the linearized pHT vector obtained in the step (d) to respectively obtain an expression plasmid pHT-P₄₃-spyTag-MTSase、pHT-P₄₃-spyTag-MTHase, said P₄₃The nucleotide sequence of the-spyTag-MTSase is shown as SEQ ID NO.16, and the P is₄₃-spyTagThe nucleotide sequence of MHSase is shown in SEQ ID NO. 17;

preferably, the recombinant strain screening in step (4): coating the transformant on an LB plate containing 33ug/mL chloramphenicol resistance, culturing at 37 ℃ for 12h, picking the transformant on the LB plate containing 33ug/mL chloramphenicol resistance with a toothpick, inoculating the transformant to an LB liquid culture medium containing 33ug/mL chloramphenicol resistance, culturing at 37 ℃ for 12h, respectively performing PCR amplification verification by using the bacterial liquid as a template, and performing agarose gel electrophoresis to obtain a corresponding target band to obtain an integrated recombinant strain, namely a recombinant strain WB800n/pHT-P₄₃-spyTag-MTSase、B.subtilis WB800n/pHT-P₄₃-spyTag-MTHase；

Preferably, according to the step 4, after the recombinant bacteria in the step 5 are fermented, the cells are crushed, the spyCatcher-CBM mediated regenerated cellulose microsphere immobilized carriers obtained in the step 2 are respectively added, the incubation is carried out for 30min under the conditions of the temperature of 25 ℃, the pH value of 5.5 and the rotating speed of 100RPM, the regenerated cellulose microsphere immobilized carriers are intercepted and recovered by a filtering mode, and the regenerated cellulose microsphere immobilized carriers containing the target protein, namely the MTSase immobilized enzyme and the MTHase immobilized enzyme are obtained.

10. Use of the MTSase immobilized enzyme and MTHase immobilized enzyme prepared by the method of any one of claims 1 to 9 in trehalose production.