CN113321741A

CN113321741A - Biological probe for detecting stress transfer between cell membrane and skeleton of living cell

Info

Publication number: CN113321741A
Application number: CN202110583124.7A
Authority: CN
Inventors: 刘波; 韩金鑫; 张航与; 李娜; 张郑瑶
Original assignee: Dalian University of Technology
Current assignee: Dalian University of Technology
Priority date: 2021-05-27
Filing date: 2021-05-27
Publication date: 2021-08-31
Anticipated expiration: 2041-05-27
Also published as: CN113321741B

Abstract

The invention discloses a biological probe for detecting stress transfer between a cell membrane and a skeleton of a living cell, which comprises five parts of a FRET fluorescent protein pair, an SH1 structural domain of spidroin, JTK8 protein and beta-actin. The probe enters a living cell and is expressed, and the change of the stress between the cell membrane and the skeleton in the living cell is quantitatively detected through the change of the FRET efficiency between the stress detection units. The biological probe realizes the visual detection of the stress transfer between the cell membrane and the skeleton in the living cell, and has the characteristics of dynamic detection, high sensitivity, high time resolution, low cost and the like.

Description

Biological probe for detecting stress transfer between cell membrane and skeleton of living cell

Technical Field

The invention belongs to the technical field of cell biology and molecular biology, and particularly relates to a biological probe for detecting stress transfer between a cell membrane and a skeleton of a living cell.

Background

Stress transmission between cell membrane and cytoskeleton may be the first step of the stress transmission mechanism, and stress signals are transmitted to the inside of cells through the cytoskeleton to activate the mechanisms related to intracellular migration and adhesion. Stress signals may regulate disease pathological processes through this pathway. Stress transmission between cell membrane and skeleton is an important link of stress transmission mechanism, but at present, related research tools are still lacked. In view of this, the present invention provides a biological probe capable of detecting stress transfer between a cell membrane and a scaffold in a living cell based on a Fluorescence Resonance Energy Transfer (FRET) technique. The probe has the advantages of dynamic detection, high sensitivity, high time resolution and the like.

Disclosure of Invention

The invention provides a novel biological probe capable of detecting stress transfer between a cell membrane and a framework in a living cell, which is prepared by using a subcloning technology based on FRET technology. The probe is expressed in a living cell and positioned at a target position, and the magnitude of stress between a cell membrane and a skeleton is quantitatively detected through the change of energy transfer efficiency.

The visible probe for stress transfer between cell membrane and skeleton includes five parts of FRET fluorescent protein pair, Spiderfibroin, SH1 structure domain of recombinant human tyrosine protein kinase (JTK 8) and beta-actin, and the DNA sequences of the five parts are digested and connected by means of subcloning technology to obtain new DNA sequence and pcDNA3.1(+) to constitute the target plasmid. The SH1 domain of the JTK8 protein anchors it to the lipid raft domain, which is the junction of the lipid raft and the JTK8 protein. In addition, the domain is selected to exclude the interference of the function change of JTK8 protein on the operation of the probe. The purpose of selecting β -actin as the carboxy terminus is to ensure that the probe is able to bind to the cytoskeletal system and anchor to the microfilament with precision.

The technical scheme of the invention is as follows:

a biological probe for detecting stress transfer between cell membranes and skeletons of living cells comprises a stress detection unit, and SH1 structural domains of JTK8 protein and beta-actin protein which are positioned at two ends of the stress detection unit; the stress detection unit comprises a fluorescent protein pair connected by spider silk protein; wherein the content of the first and second substances,

the amino acid sequence of the spidroin protein is shown as SEQ ID NO. 7;

the amino acid sequence of SH1 structural domain of JTK8 protein is shown in SEQ ID NO. 3;

the amino acid sequence of the beta-actin protein is shown as SEQ ID NO. 5.

Further, the fluorescent protein pair is selected from Blue Fluorescent Protein (BFP) and Green Fluorescent Protein (GFP), GFP and its variants (EGFP, mClover3, meneon green, mCerulean and mVenus) and Red Fluorescent Protein (RFP) and its variants (mCherry, mrube 3, mrube 2 and mrube), Cyan Fluorescent Protein (CFP) and its variants (mturcuose 2, mCerulean3, mTFP1, Aquamarine and ECFP) and yellow fluorescent protein (yellow fluorescent protein, YFP) and its variants (EYFP, mfep, vmucine, eype and YFP).

In a preferred embodiment, the fluorescent protein pair is enhanced green fluorescent protein (ECFP) and energy transfer yellow fluorescent protein (Ypet).

In a specific embodiment, the core part of the stress transfer visualization probe for detecting stress transfer between the cell membrane and the scaffold of the biological probe for detecting stress transfer between the cell membrane and the scaffold of a living cell is a stress detection unit (ECFP-spacer-Ypet) comprising a fluorescent protein pair (ECFP/Ypet) and a Spider silk protein (spacer-spacer), the amino terminal of the stress detection unit is anchored with an SH1 domain of JTK8 protein, and the carboxyl terminal of the stress detection unit is connected with a beta-actin protein to form a JTK 8-ECFP-spacer-Ypet-beta-actin structure.

The FRET fluorescent protein pair in the probe is enhanced green fluorescent protein (ECFP) and yellow fluorescent protein for energy transfer (Ypet).

The amino acid sequence and the nucleotide sequence of the FRET-based biological probe for detecting stress transmission between cell membranes and skeletons in living cells are shown as follows:

the complete amino acid sequence of the FRET-based biological probe for detecting stress transfer between cell membranes and skeletons in living cells is (SEQ ID NO. 1):

AAATMGCIKSKRKDNLNDDGVDMKTMVSKGEELFTGVVPILVELDGDVNGHRFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTWGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYISHNVYITADKQKNGIKAHFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAELGPGGAGPGGAGPGGAGPGGAGPGGAGPGGAGPGGAGPGGAMSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKLLCTTGKLPVPWPTLVTTLGYGVQCFARYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYITADKQKNGIKANFKIRHNIEDGGVQLADHYQQNTPIGDGPVLLPDNHYLSYQSALFKDPNEKRDHMVLLEFLTAAGITEGMNELYKGSMDDDIAALVVDNGSGMCKAGFAGDDAPRAVFPSIVGRPRHQGVMVGMGQKDSYVGDEAQSKRGILTLKYPIEHGIVTNWDDMEKIWHHTFYNELRVAPEEHPVLLTEAPLNPKANREKMTQIMFETFNTPAMYVAIQAVLSLYASGRTTGIVMDSGDGVTHTVPIYEGYALPHAILRLDLAGRDLTDYLMKILTERGYSFTTTAEREIVRDIKEKLCYVALDFEQEMATAASSSSLEKSYELPDGQVITIGNERFRCPEALFQPSFLGMESCGIHETTFNSIMKCDVDIRKDLYANTVLSGGTTMYPGIADRMQKEITALAPSTMKIKIIAPPERKYSVWIGGSILASLSTFQQMWISKQEYDESGPSIVHRKCF

the complete nucleotide sequence of the FRET-based biological probe for detecting stress transfer between cell membranes and skeletons in living cells is (SEQ ID NO. 2):

GCGGCCGCCACCATGGGCTGCATCAAGAGCAAGCGCAAGGACAACCTGAACGACGACGGCGTGGACATGAAGACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAGGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTGGGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGTACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACATCAGCCACAACGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCCACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGAGCTCGGTCCAGGAGGCGCAGGACCTGGCGGGGCTGGACCGGGTGGCGCGGGACCCGGCGGAGCCGGCCCAGGTGGGGCGGGCCCTGGTGGTGCTGGTCCGGGAGGGGCAGGGCCCGGAGGTGCCATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACGTACGGTAAATTGACCTTAAAATTACTCTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTAGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCACTGCTGACAAACAAAAGAATGGTATCAAAGCTAACTTCAAAATTAGACACAACATTGAAGATGGTGGTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCTATCAATCTGCCTTATTCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTTTGACTGCTGCTGGTATTACCGAGGGTATGAATGAATTGTACAAAGGATCCATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAG

JTK8 has the amino acid sequence (SEQ ID NO. 3):

AAATMGCIKSKRKDNLNDDGVDMKT

the corresponding nucleotide sequence is (SEQ ID NO. 4):

GCGGCCGCCACCATGGGCTGCATCAAGAGCAAGCGCAAGGACAACCTGAACGACGACGGCGTGGACATGAAGACC

the amino acid sequence of the beta-actin protein is (SEQ ID NO. 5):

MDDDIAALVVDNGSGMCKAGFAGDDAPRAVFPSIVGRPRHQGVMVGMGQKDSYVGDEAQSKRGILTLKYPIEHGIVTNWDDMEKIWHHTFYNELRVAPEEHPVLLTEAPLNPKANREKMTQIMFETFNTPAMYVAIQAVLSLYASGRTTGIVMDSGDGVTHTVPIYEGYALPHAILRLDLAGRDLTDYLMKILTERGYSFTTTAEREIVRDIKEKLCYVALDFEQEMATAASSSSLEKSYELPDGQVITIGNERFRCPEALFQPSFLGMESCGIHETTFNSIMKCDVDIRKDLYANTVLSGGTTMYPGIADRMQKEITALAPSTMKIKIIAPPERKYSVWIGGSILASLSTFQQMWISKQEYDESGPSIVHRKCF

the corresponding nucleotide sequence is (SEQ ID NO. 6):

ATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTC

the amino acid sequence of the Spider fibriin is (SEQ ID NO. 7):

GPGGAGPGGAGPGGAGPGGAGPGGAGPGGAGPGGAGPGGA is represented by the following DNA sequence (SEQ ID NO. 8):

GGTCCAGGAGGCGCAGGACCTGGCGGGGCTGGACCGGGTGGCGCGGGACCCGGCGGAGCCGGCCCAGGTGGGGCGGGCCCTGGTGGTGCTGGTCCGGGAGGGGCAGGGCCCGGAGGTGCC

in another aspect, the present invention provides a recombinant plasmid, wherein the recombinant plasmid comprises the nucleotide sequence of the above biological probe for detecting stress transmission between a living cell membrane and a scaffold, and the vector of the recombinant plasmid is selected from pcDNA3.1(+) vector, pcDNA^TM3.3 vector, pCMVp-NEO-BAN vector and CMV4 expression vector.

Further, the vector of the recombinant plasmid is pcDNA3.1(+) vector. That is, the vector of the recombinant plasmid selected in the probe was pcDNA3.1(+) vector.

The biological probe for detecting stress transfer between cell membrane and skeleton in living cell is applied, and the probe is wrapped by liposome and enters into cell in endocytosis mode, and is transcribed and translated to express the protein structure of the recombinant probe and anchored between the cell membrane and the cell skeleton. Changes in the distance between the fluorescent proteins are observed by calculating the FRET efficiency between the stress detection units using a FRET fluorescence microscope, thereby detecting changes in stress transmission between the cell membrane and the scaffold in living cells.

The invention has the beneficial effects that:

the FRET technology-based stress transfer biological probe between the cell membrane and the skeleton is constructed, the invisible force in the cell is converted into observable fluorescence, the visible detection of the stress transfer between the cell membrane and the skeleton in the living cell is realized, and the biological probe has the characteristics of dynamic detection, high sensitivity, high time resolution, low cost and the like, provides a powerful tool for the cytodynamics biological research, and increases intervention means for the treatment of diseases such as cancer and the like.

Drawings

FIG. 1 is a flow chart of the preparation of the FRET-based biological probe for detecting stress transmission between cell membrane and skeleton in living cell.

FIG. 2 is a diagram showing the structure of a biological probe for detecting stress transfer between cell membrane and scaffold in a FRET-based living cell.

FIG. 3 is a diagram showing the operation principle of a biological probe for detecting stress transfer between cell membrane and scaffold in FRET-based living cells.

FIG. 4 is a fluorescence image of cells transfected with FRET-based in vivo detection of stress transfer between cell membrane and backbone bioprobes and their control probes.

FIG. 5(a) is an image of cell ratio analysis for FRET-based detection of stress transfer between cell membrane and scaffold in living cells for bioprobe verification.

FIGS. 5(b) and 5(c) are statistical graphs of validation data of FRET-based stress transfer bioprobes for detecting stress between cell membranes and scaffolds in living cells (FIG. 5(b) number of hypotonic experiment set n-7/9/10; FIG. 5(c) number of hypertonic experiment set n-5/6/6; and Errorbar selection SEM).

Fig. 5(d) and 5(e) are linear fitting graphs for FRET-based in vivo cell assay for cell membrane-to-scaffold stress transfer bioprobe verification (fig. 5(d) number of hypotonic panels n-7/9/10; fig. 5(e) number of hypertonic panels n-5/6/6).

In the figure: 2-1JTK 8; 2-2 ECFP; 2-3Spider fibrin; 2-4 Ypet; 2-5 beta-actin

Detailed Description

The following further describes a specific embodiment of the present invention with reference to the drawings and technical solutions.

The method comprises the steps of obtaining a target fragment by a conventional PCR means, carrying out enzyme digestion, connecting the target fragment with a vector plasmid to obtain a recombinant plasmid, transforming the recombinant plasmid into competent bacteria for experiments such as amplification and the like to obtain a target probe; the specific experimental protocol for probe preparation is shown in FIG. 1.

Test example 1:

control probes were designed to verify the specificity of the probes. Control probes RESY (JTK 8-ECFP-spraying-repeat) and ESYB (ECFP-spraying-repeat-beta-actin) were constructed by removing the beta-actin portion and JTK8 portion, respectively. The probes of interest and the control probes were transfected into osteosarcoma cells, and the probes were normally expressed and the fluorescence was in the expected condition, as shown in FIG. 5 (a).

Test example 2:

the functional characteristics of the probe are verified by carrying out an experiment for changing the osmotic pressure of the cells. The probe has linearity. And applying a hypotonic solution or a hypertonic solution to change the osmotic pressure outside the cell so as to change the stress between the cell membrane and the skeleton, wherein the distance between the fluorescent proteins ECFP 2-1 and Ypet2-5 in the stress detection unit of the probe is changed along with the change of the osmotic pressure, so that the FRET efficiency is changed. After transfection, cells were given excitation light at 436nm, fluorescence images of ECFP (485nm) and FRET (535nm) channels were collected and FRET ratio of Ypet/ECFP was calculated, respectively. Upon hypotonic stimulation, FRET ratio of the cells decreases; under hypertonic stimulation, the FRET ratio of the cells rises. The FRET ratio changes linearly with changes in osmotic pressure. FRET ratio profiles As shown in FIGS. 5(b) and 5(c), the cells were stimulated at the fourth clock, observed for 7min, and normalized and line-fitted for the cell's FRET ratio at the eleventh minute. The time profiles of the cell FRET ratio normalized data with the addition of hypotonic or hypertonic stimulation are shown in fig. 5(d) and fig. 5 (e).

The probe is combined with a transfection reagent to enter a living cell, the protein structure of the probe is expressed after transcription and translation, and JTK8(1-1) and beta-actin (1-5) proteins at two ends are respectively connected with a lipid raft and a cytoskeleton, so that the probe is automatically positioned between a cell membrane and the cytoskeleton. When external stress is applied, the cell senses the force and transmits mechanical signals through the cytoskeleton to the interior of the cell. During stress transfer, the Spider fibriin (1-3) protein in the probe is compressed or stretched, causing a change in the distance between the pair of FRET proteins, resulting in a change in FRET efficiency. Using a confocal laser microscope, the transfected cells were excited with excitation light having a wavelength of 405nm, and fluorescence images of ECFP (485nm) and FRET (535nm) channels were simultaneously collected and the FRET ratios of Ypet/ECFP were calculated, respectively. The change of stress between the cell membrane and the skeleton is observed by analyzing the energy transfer efficiency.

Sequence listing

<110> university of Large Community

<120> a bioprobe for detecting stress transfer between cell membrane and skeleton of living cell

<130> 2021

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 910

<212> PRT

<213> Artificial sequence

<220>

<223> biological probe amino acid sequence

<400> 1

Ala Ala Ala Thr Met Gly Cys Ile Lys Ser Lys Arg Lys Asp Asn Leu

1 5 10 15

Asn Asp Asp Gly Val Asp Met Lys Thr Met Val Ser Lys Gly Glu Glu

20 25 30

Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val

35 40 45

Asn Gly His Arg Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr

50 55 60

Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro

65 70 75 80

Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Trp Gly Val Gln Cys

85 90 95

Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser

100 105 110

Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp

115 120 125

Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr

130 135 140

Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly

145 150 155 160

Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Ile Ser His Asn Val

165 170 175

Tyr Ile Thr Ala Asp Lys Gln Lys Asn Gly Ile Lys Ala His Phe Lys

180 185 190

Ile Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr

195 200 205

Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn

210 215 220

His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys

225 230 235 240

Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala Ala Glu Leu Gly

245 250 255

Pro Gly Gly Ala Gly Pro Gly Gly Ala Gly Pro Gly Gly Ala Gly Pro

260 265 270

Gly Gly Ala Gly Pro Gly Gly Ala Gly Pro Gly Gly Ala Gly Pro Gly

275 280 285

Gly Ala Gly Pro Gly Gly Ala Met Ser Lys Gly Glu Glu Leu Phe Thr

290 295 300

Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His

305 310 315 320

Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys

325 330 335

Leu Thr Leu Lys Leu Leu Cys Thr Thr Gly Lys Leu Pro Val Pro Trp

340 345 350

Pro Thr Leu Val Thr Thr Leu Gly Tyr Gly Val Gln Cys Phe Ala Arg

355 360 365

Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro

370 375 380

Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn

385 390 395 400

Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn

405 410 415

Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu

420 425 430

Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Thr

435 440 445

Ala Asp Lys Gln Lys Asn Gly Ile Lys Ala Asn Phe Lys Ile Arg His

450 455 460

Asn Ile Glu Asp Gly Gly Val Gln Leu Ala Asp His Tyr Gln Gln Asn

465 470 475 480

Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu

485 490 495

Ser Tyr Gln Ser Ala Leu Phe Lys Asp Pro Asn Glu Lys Arg Asp His

500 505 510

Met Val Leu Leu Glu Phe Leu Thr Ala Ala Gly Ile Thr Glu Gly Met

515 520 525

Asn Glu Leu Tyr Lys Gly Ser Met Asp Asp Asp Ile Ala Ala Leu Val

530 535 540

Val Asp Asn Gly Ser Gly Met Cys Lys Ala Gly Phe Ala Gly Asp Asp

545 550 555 560

Ala Pro Arg Ala Val Phe Pro Ser Ile Val Gly Arg Pro Arg His Gln

565 570 575

Gly Val Met Val Gly Met Gly Gln Lys Asp Ser Tyr Val Gly Asp Glu

580 585 590

Ala Gln Ser Lys Arg Gly Ile Leu Thr Leu Lys Tyr Pro Ile Glu His

595 600 605

Gly Ile Val Thr Asn Trp Asp Asp Met Glu Lys Ile Trp His His Thr

610 615 620

Phe Tyr Asn Glu Leu Arg Val Ala Pro Glu Glu His Pro Val Leu Leu

625 630 635 640

Thr Glu Ala Pro Leu Asn Pro Lys Ala Asn Arg Glu Lys Met Thr Gln

645 650 655

Ile Met Phe Glu Thr Phe Asn Thr Pro Ala Met Tyr Val Ala Ile Gln

660 665 670

Ala Val Leu Ser Leu Tyr Ala Ser Gly Arg Thr Thr Gly Ile Val Met

675 680 685

Asp Ser Gly Asp Gly Val Thr His Thr Val Pro Ile Tyr Glu Gly Tyr

690 695 700

Ala Leu Pro His Ala Ile Leu Arg Leu Asp Leu Ala Gly Arg Asp Leu

705 710 715 720

Thr Asp Tyr Leu Met Lys Ile Leu Thr Glu Arg Gly Tyr Ser Phe Thr

725 730 735

Thr Thr Ala Glu Arg Glu Ile Val Arg Asp Ile Lys Glu Lys Leu Cys

740 745 750

Tyr Val Ala Leu Asp Phe Glu Gln Glu Met Ala Thr Ala Ala Ser Ser

755 760 765

Ser Ser Leu Glu Lys Ser Tyr Glu Leu Pro Asp Gly Gln Val Ile Thr

770 775 780

Ile Gly Asn Glu Arg Phe Arg Cys Pro Glu Ala Leu Phe Gln Pro Ser

785 790 795 800

Phe Leu Gly Met Glu Ser Cys Gly Ile His Glu Thr Thr Phe Asn Ser

805 810 815

Ile Met Lys Cys Asp Val Asp Ile Arg Lys Asp Leu Tyr Ala Asn Thr

820 825 830

Val Leu Ser Gly Gly Thr Thr Met Tyr Pro Gly Ile Ala Asp Arg Met

835 840 845

Gln Lys Glu Ile Thr Ala Leu Ala Pro Ser Thr Met Lys Ile Lys Ile

850 855 860

Ile Ala Pro Pro Glu Arg Lys Tyr Ser Val Trp Ile Gly Gly Ser Ile

865 870 875 880

Leu Ala Ser Leu Ser Thr Phe Gln Gln Met Trp Ile Ser Lys Gln Glu

885 890 895

Tyr Asp Glu Ser Gly Pro Ser Ile Val His Arg Lys Cys Phe

900 905 910

<210> 2

<211> 2733

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of biological probe

<400> 2

gcggccgcca ccatgggctg catcaagagc aagcgcaagg acaacctgaa cgacgacggc 60

gtggacatga agaccatggt gagcaagggc gaggagctgt tcaccggggt ggtgcccatc 120

ctggtcgagc tggacggcga cgtaaacggc cacaggttca gcgtgtccgg cgagggcgag 180

ggcgatgcca cctacggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc 240

gtgccctggc ccaccctcgt gaccaccctg acctggggcg tgcagtgctt cagccgctac 300

cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacgtccag 360

gagcgtacca tcttcttcaa ggacgacggc aactacaaga cccgcgccga ggtgaagttc 420

gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc 480

aacatcctgg ggcacaagct ggagtacaac tacatcagcc acaacgtcta tatcaccgcc 540

gacaagcaga agaacggcat caaggcccac ttcaagatcc gccacaacat cgaggacggc 600

agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg ccccgtgctg 660

ctgcccgaca accactacct gagcacccag tccgccctga gcaaagaccc caacgagaag 720

cgcgatcaca tggtcctgct ggagttcgtg accgccgccg agctcggtcc aggaggcgca 780

ggacctggcg gggctggacc gggtggcgcg ggacccggcg gagccggccc aggtggggcg 840

ggccctggtg gtgctggtcc gggaggggca gggcccggag gtgccatgtc taaaggtgaa 900

gaattattca ctggtgttgt cccaattttg gttgaattag atggtgatgt taatggtcac 960

aaattttctg tctccggtga aggtgaaggt gatgctacgt acggtaaatt gaccttaaaa 1020

ttactctgta ctactggtaa attgccagtt ccatggccaa ccttagtcac tactttaggt 1080

tatggtgttc aatgttttgc tagataccca gatcatatga aacaacatga ctttttcaag 1140

tctgccatgc cagaaggtta tgttcaagaa agaactattt ttttcaaaga tgacggtaac 1200

tacaagacca gagctgaagt caagtttgaa ggtgatacct tagttaatag aatcgaatta 1260

aaaggtattg attttaaaga agatggtaac attttaggtc acaaattgga atacaactat 1320

aactctcaca atgtttacat cactgctgac aaacaaaaga atggtatcaa agctaacttc 1380

aaaattagac acaacattga agatggtggt gttcaattag ctgaccatta tcaacaaaat 1440

actccaattg gtgatggtcc agtcttgtta ccagacaacc attacttatc ctatcaatct 1500

gccttattca aagatccaaa cgaaaagaga gaccacatgg tcttgttaga atttttgact 1560

gctgctggta ttaccgaggg tatgaatgaa ttgtacaaag gatccatgga tgatgatatc 1620

gccgcgctcg tcgtcgacaa cggctccggc atgtgcaagg ccggcttcgc gggcgacgat 1680

gccccccggg ccgtcttccc ctccatcgtg gggcgcccca ggcaccaggg cgtgatggtg 1740

ggcatgggtc agaaggattc ctatgtgggc gacgaggccc agagcaagag aggcatcctc 1800

accctgaagt accccatcga gcacggcatc gtcaccaact gggacgacat ggagaaaatc 1860

tggcaccaca ccttctacaa tgagctgcgt gtggctcccg aggagcaccc cgtgctgctg 1920

accgaggccc ccctgaaccc caaggccaac cgcgagaaga tgacccagat catgtttgag 1980

accttcaaca ccccagccat gtacgttgct atccaggctg tgctatccct gtacgcctct 2040

ggccgtacca ctggcatcgt gatggactcc ggtgacgggg tcacccacac tgtgcccatc 2100

tacgaggggt atgccctccc ccatgccatc ctgcgtctgg acctggctgg ccgggacctg 2160

actgactacc tcatgaagat cctcaccgag cgcggctaca gcttcaccac cacggccgag 2220

cgggaaatcg tgcgtgacat taaggagaag ctgtgctacg tcgccctgga cttcgagcaa 2280

gagatggcca cggctgcttc cagctcctcc ctggagaaga gctacgagct gcctgacggc 2340

caggtcatca ccattggcaa tgagcggttc cgctgccctg aggcactctt ccagccttcc 2400

ttcctgggca tggagtcctg tggcatccac gaaactacct tcaactccat catgaagtgt 2460

gacgtggaca tccgcaaaga cctgtacgcc aacacagtgc tgtctggcgg caccaccatg 2520

taccctggca ttgccgacag gatgcagaag gagatcactg ccctggcacc cagcacaatg 2580

aagatcaaga tcattgctcc tcctgagcgc aagtactccg tgtggatcgg cggctccatc 2640

ctggcctcgc tgtccacctt ccagcagatg tggatcagca agcaggagta tgacgagtcc 2700

ggcccctcca tcgtccaccg caaatgcttc tag 2733

<210> 3

<211> 25

<212> PRT

<213> Artificial sequence

<220>

<223> JTK8 amino acid sequence

<400> 3

Ala Ala Ala Thr Met Gly Cys Ile Lys Ser Lys Arg Lys Asp Asn Leu

1 5 10 15

Asn Asp Asp Gly Val Asp Met Lys Thr

20 25

<210> 4

<211> 75

<212> DNA

<213> Artificial sequence

<220>

<223> JTK8 nucleotide sequence

<400> 4

gcggccgcca ccatgggctg catcaagagc aagcgcaagg acaacctgaa cgacgacggc 60

gtggacatga agacc 75

<210> 5

<211> 375

<212> PRT

<213> Artificial sequence

<220>

<223> beta-actin protein amino acid sequence

<400> 5

Met Asp Asp Asp Ile Ala Ala Leu Val Val Asp Asn Gly Ser Gly Met

1 5 10 15

Cys Lys Ala Gly Phe Ala Gly Asp Asp Ala Pro Arg Ala Val Phe Pro

20 25 30

Ser Ile Val Gly Arg Pro Arg His Gln Gly Val Met Val Gly Met Gly

35 40 45

Gln Lys Asp Ser Tyr Val Gly Asp Glu Ala Gln Ser Lys Arg Gly Ile

50 55 60

Leu Thr Leu Lys Tyr Pro Ile Glu His Gly Ile Val Thr Asn Trp Asp

65 70 75 80

Asp Met Glu Lys Ile Trp His His Thr Phe Tyr Asn Glu Leu Arg Val

85 90 95

Ala Pro Glu Glu His Pro Val Leu Leu Thr Glu Ala Pro Leu Asn Pro

100 105 110

Lys Ala Asn Arg Glu Lys Met Thr Gln Ile Met Phe Glu Thr Phe Asn

115 120 125

Thr Pro Ala Met Tyr Val Ala Ile Gln Ala Val Leu Ser Leu Tyr Ala

130 135 140

Ser Gly Arg Thr Thr Gly Ile Val Met Asp Ser Gly Asp Gly Val Thr

145 150 155 160

His Thr Val Pro Ile Tyr Glu Gly Tyr Ala Leu Pro His Ala Ile Leu

165 170 175

Arg Leu Asp Leu Ala Gly Arg Asp Leu Thr Asp Tyr Leu Met Lys Ile

180 185 190

Leu Thr Glu Arg Gly Tyr Ser Phe Thr Thr Thr Ala Glu Arg Glu Ile

195 200 205

Val Arg Asp Ile Lys Glu Lys Leu Cys Tyr Val Ala Leu Asp Phe Glu

210 215 220

Gln Glu Met Ala Thr Ala Ala Ser Ser Ser Ser Leu Glu Lys Ser Tyr

225 230 235 240

Glu Leu Pro Asp Gly Gln Val Ile Thr Ile Gly Asn Glu Arg Phe Arg

245 250 255

Cys Pro Glu Ala Leu Phe Gln Pro Ser Phe Leu Gly Met Glu Ser Cys

260 265 270

Gly Ile His Glu Thr Thr Phe Asn Ser Ile Met Lys Cys Asp Val Asp

275 280 285

Ile Arg Lys Asp Leu Tyr Ala Asn Thr Val Leu Ser Gly Gly Thr Thr

290 295 300

Met Tyr Pro Gly Ile Ala Asp Arg Met Gln Lys Glu Ile Thr Ala Leu

305 310 315 320

Ala Pro Ser Thr Met Lys Ile Lys Ile Ile Ala Pro Pro Glu Arg Lys

325 330 335

Tyr Ser Val Trp Ile Gly Gly Ser Ile Leu Ala Ser Leu Ser Thr Phe

340 345 350

Gln Gln Met Trp Ile Ser Lys Gln Glu Tyr Asp Glu Ser Gly Pro Ser

355 360 365

Ile Val His Arg Lys Cys Phe

370 375

<210> 6

<211> 1125

<212> DNA

<213> Artificial sequence

<220>

<223> beta-actin protein nucleotide sequence

<400> 6

atggatgatg atatcgccgc gctcgtcgtc gacaacggct ccggcatgtg caaggccggc 60

ttcgcgggcg acgatgcccc ccgggccgtc ttcccctcca tcgtggggcg ccccaggcac 120

cagggcgtga tggtgggcat gggtcagaag gattcctatg tgggcgacga ggcccagagc 180

aagagaggca tcctcaccct gaagtacccc atcgagcacg gcatcgtcac caactgggac 240

gacatggaga aaatctggca ccacaccttc tacaatgagc tgcgtgtggc tcccgaggag 300

caccccgtgc tgctgaccga ggcccccctg aaccccaagg ccaaccgcga gaagatgacc 360

cagatcatgt ttgagacctt caacacccca gccatgtacg ttgctatcca ggctgtgcta 420

tccctgtacg cctctggccg taccactggc atcgtgatgg actccggtga cggggtcacc 480

cacactgtgc ccatctacga ggggtatgcc ctcccccatg ccatcctgcg tctggacctg 540

gctggccggg acctgactga ctacctcatg aagatcctca ccgagcgcgg ctacagcttc 600

accaccacgg ccgagcggga aatcgtgcgt gacattaagg agaagctgtg ctacgtcgcc 660

ctggacttcg agcaagagat ggccacggct gcttccagct cctccctgga gaagagctac 720

gagctgcctg acggccaggt catcaccatt ggcaatgagc ggttccgctg ccctgaggca 780

ctcttccagc cttccttcct gggcatggag tcctgtggca tccacgaaac taccttcaac 840

tccatcatga agtgtgacgt ggacatccgc aaagacctgt acgccaacac agtgctgtct 900

ggcggcacca ccatgtaccc tggcattgcc gacaggatgc agaaggagat cactgccctg 960

gcacccagca caatgaagat caagatcatt gctcctcctg agcgcaagta ctccgtgtgg 1020

atcggcggct ccatcctggc ctcgctgtcc accttccagc agatgtggat cagcaagcag 1080

gagtatgacg agtccggccc ctccatcgtc caccgcaaat gcttc 1125

<210> 7

<211> 40

<212> PRT

<213> Artificial sequence

<220>

<223> Spider fibriin amino acid sequence

<400> 7

Gly Pro Gly Gly Ala Gly Pro Gly Gly Ala Gly Pro Gly Gly Ala Gly

1 5 10 15

Pro Gly Gly Ala Gly Pro Gly Gly Ala Gly Pro Gly Gly Ala Gly Pro

20 25 30

Gly Gly Ala Gly Pro Gly Gly Ala

35 40

<210> 8

<211> 120

<212> DNA

<213> Artificial sequence

<220>

<223> Spider fibriin nucleotide sequence

<400> 8

ggtccaggag gcgcaggacc tggcggggct ggaccgggtg gcgcgggacc cggcggagcc 60

ggcccaggtg gggcgggccc tggtggtgct ggtccgggag gggcagggcc cggaggtgcc 120

Claims

1. A biological probe for detecting stress transfer between a cell membrane and a framework of a living cell is characterized by comprising a stress detection unit, and SH1 structural domains of JTK8 protein and beta-actin protein which are positioned at two ends of the stress detection unit; the stress detection unit comprises a fluorescent protein pair connected by spider silk protein; wherein the content of the first and second substances,

the amino acid sequence of the spidroin protein is shown as SEQ ID NO. 7;

the amino acid sequence of the beta-actin protein is shown as SEQ ID NO. 5.

2. The biological probe for detecting stress transfer between cell membrane and scaffold of living cell according to claim 1, wherein said fluorescent protein pair is selected from the group consisting of BFP and GFP, GFP and variants thereof and RFP and variants thereof, CFP and variants thereof and YFP and variants thereof.

3. The biological probe for detecting stress transmission between a cell membrane and a framework of a living cell according to claim 2, wherein the variant of GFP is selected from EGFP, mCLOVER3, mNeon Green, mCERULEAN and mVenus, and the variant of RFP is selected from mCherry, mRuby3, mRuby2 and mRuby; variants of CFP are selected from ECFP, mCErulean3, mTFP1, Aquamarine and mTurquoise2, and variants of YFP are selected from EYFP, mVenus, mCitrine, sEYFP and YPet.

4. The bioprobe for detecting stress transmission between cell membrane and scaffold of living cell according to claim 3, wherein the pair of fluorescent proteins is ECFP and YPet.

5. The biological probe for detecting stress transfer between a cell membrane of a living cell and a scaffold as claimed in any one of claims 1 to 4, wherein the amino acid sequence of the biological probe for detecting stress transfer between a cell membrane of a living cell and a scaffold is shown as SEQ ID No. 1.

6. A recombinant plasmid comprising the nucleotide sequence of the bioprobe for detecting stress transmission between a cell membrane and a backbone of a living cell according to any one of claims 1 to 5, wherein the vector of the recombinant plasmid is selected from the group consisting of pcDNA3.1(+) vector, pcDNA^TM3.3 vector, pCMVp-NEO-BAN vector and CMV4 expression vector.

7. The recombinant plasmid of claim 6, wherein the vector of the recombinant plasmid is pcDNA3.1(+) vector.