CN109777833A

CN109777833A - The method of the special adaptor protein SLP-76 ubiquitin-like of T cell and corresponding external efficiently identification

Info

Publication number: CN109777833A
Application number: CN201910109404.7A
Authority: CN
Inventors: 刘合宾; 熊伊韦
Original assignee: Xian Jiaotong Liverpool University
Current assignee: Xian Jiaotong Liverpool University
Priority date: 2019-02-10
Filing date: 2019-02-10
Publication date: 2019-05-21
Anticipated expiration: 2039-02-10
Also published as: CN109777833B

Abstract

The invention discloses a kind of methods of the special adaptor protein SLP-76 ubiquitin-like of T cell, comprising the following steps: building SLP-76-UBC9 fusion expression plasmid；SLP-76 c-terminus is provided, plasmid is transformed；Transformation plasmid is co-expressed with SUMO1 expression plasmid in HEK 293T into the cell.The present invention goes back while providing a kind of detection method of special adaptor protein SLP-76 ubiquitin-like of T cell, comprising the following steps: takes cell to be measured that lysis buffer is added；It is centrifuged after placing on ice；With albumen polyacrylamide gel electrophoresis protein isolate, transferring film is incubated for SUMO1 specifically antibody and label protein/SLP-76 protein antibodies；Protein band position is matched, determines whether SLP-76 has occurred ubiquitin-likeization modification.Present invention ensure that specificity, high efficiency and the correctness of the modification identification of SLP-76 ubiquitin-likeization, favorable repeatability.

Description

The method of the special adaptor protein SLP-76 ubiquitin-like of T cell and corresponding external height Effect identification

Technical field

The present invention relates to molecular immunology fields, and in particular to a kind of external efficiently identification special adaptor protein of T cell The method of SLP-76 ubiquitin-like.

Background technique

T cell is the core of infectiousness and immunity disease research, in the anti-intra-cellular pathogens infection immunity of host and endogenous Venereal disease becomes such as tumour immunity, and dispatches in different immune cell functions and play extremely important effect.

SLP-76 is the special immune adaptor protein (immune adaptors) of T cell, non-enzymatic activity itself, but is being tied Often include various structures domain-functionalities area (domain) on structure, mediates SLP-76 and other protein signal molecules by these functional areas Interaction, realizes a series of adjusting function of TCR signal transductions.Its primary structure major function area includes an acid N End region, the proline at middle part and Arginine-rich area and the relatively conservative SH2 structural domain of C-terminal.N-terminal area includes one The functional areas SAM and three tyrosine phosphorylation (activation) sites (Tyr-113, Tyr-128 and Tyr-145), can be respectively in connection with The area SH2 of Nck, Vav and Itk；And the functional areas SAM can mediate the polymerization of SLP-76 itself to form dimer or polymer and regulate and control The formation of the micro- aggressiveness of SLP-76.Contain proline-rich region and Arginine-rich area in the middle part of SLP-76, the former and PLC γ 1 are formed Property combine, the latter downstream tap Protein G ADs relevant to GRB2 is associated with.The SH2 structural domain of C-terminal mediates SLP-76 and under The tyrosine for swimming ADAP combines, and to the TCR integrin activation mediated and plays an important role sticking for cell.SLP-76 is TCR letter " node " hinge molecule of number conductive core signal shaft (TCRp56LckZAP-70LATGADsSLP-76) key, can not only integrate The proximal end TCR (proximal) signal and distal end (distal) signal, and play important regulation in TCR signal transduction and make With.The TCR near end signal event that SLP-76 is mediated includes tyrosine phosphorylation, interaction and the activation of signal of interest molecule； And distal end (distal) signal then include the signal of interest such as ERK, NF-B path activation, cytoskeleton rearrangement, immune adherence and Cell factor IL-2 secretion increase etc..The reaction of these TCR signal cascades eventually leads to T cell differentiation, proliferation, activation and effect and exempts from The acquisition of epidemic disease reaction.In addition to this, SLP-76 also plays an important role to the development of T cell, SLP-76 depleted mice thymocyte It is arrested in double-negative (CD4-CD8-) stage of development completely.

Ubiquitination (Ubiquitination) and extensive (the Small ubiquitin-like modifier (SUMO) of class It ylation) is the important way realized in various kinds of cell to two kinds of protein post-translational modifications of signal transduction finely regulating, Wide participation regulatory protein matter function and cell activities links.SUMO molecule and Ubiquitin are in structure Much like protein micromolecular.And the action target spot of the two and substrate is all lysine (Lysine), at present in eucaryote Middle discovery is there are four types of SUMO molecule, that is, SUMO1-4, and modification is ubiquitin-like SUMOization after the protein translation mediated.Although ubiquitination It is very similar with SUMOization the two modification chemical reaction process, and the target spot acted on is all lysine (Lys), but they are right The regulation for being modified protein function is completely different.In most cases, ubiquitination and SUMOization are regulated and controled in a manner of Antagonism The function of substrate protein.Moreover, ubiquitination and ubiquitin-like can be used as a pair of regulation mutually restricted in many cells Mechanism exists simultaneously, and it is residual to modify the same bad ammonia element that the same target proteins even compete on the same albumen of sex modification The site K21 of base such as IB, to realize the balance regulation of the signal transduction path a positive and a negative mediated to target proteins.Currently, The research of regulating and controlling effect and its mechanism of the ubiquitination access in T cell signal transduction is fully aware of: mainly by c-Cbl, Degradation caused by the ubiquitination that the ubiquitin ligases such as Cbl-b and Itch mediate.These ubiquitin ligases are in T cell Target molecules include including Lck, Fyn, ZAP-70 and SLP-76 etc. these play an important role in t cell activation signal transduction Signaling molecule.These molecules are degraded after ubiquitination, so that it is immune to lower TCR signal transduction intensity and T cell Reaction level.

Although ubiquitin-like modification and ubiquitination have many common ground, up to the present, important target in T cell How mark molecule is still known little about it by ubiquitin-likeization modification, especially crucial adaptor protein SLP-76, there is no at present about The report that SLP-76 is modified by ubiquitin-like.And currently lacks a kind of can directly detect and determine SLP-76 ubiquitin-likeization level Whether analysis method is modified by ubiquitin-like with conventional method identification SLP-76, and is unable to get positive findings.Technically divide Analysis, possible reason: first is that ubiquitin-like is reversible process, and ubiquitin-like molecule can by cracking removal, by Senp1 enzymatic mediates, and the abundance modified into the cell by ubiquitin-like is generally relatively low, the susceptibility requirement to detection method It is high；Second is that the effect of SLP-76 intramolecular itself restrains the level for influencing ubiquitin-like.

The method of traditional identification ubiquitin-likeization modification mainly includes that detected by Western blot, recombinant protein react in vitro Method and protein Spectrum Analysis method:

1) detected by Western blot is generally combined with protein co-precipitate method, with resisting for the specificity for needing certified albumen Body is enriched with the target protein, recycles detected by Western blot, the target protein band that analysis detection arrives, if than target egg The big regional observation of white molecular weight then may be the albumen of ubiquitin-likeization modification to the band that can be arrived by this antibody test.Albumen Western blot is directly easy, but technique influence factor is more, requires operator high, repeated bad, protein immunoblot Method need to be generally combined with other methods, increase the accuracy of identification.

2) the external reaction method of recombinant protein relies on detected by Western blot, has albumen (enzyme) activity using recombinant protein The characteristics of, the various enzymes and target protein of participation ubiquitin-likeization modification process are mixed, external modification reaction is in vitro carried out, Western blot is recycled, binding analysis protein band molecular size range determines whether the albumen is modified.Recombinant protein is external Reaction method is at high cost, and the requirement to reaction condition and albumen sample is high (pH, buffer components, temperature, ionic strength etc.), with egg White Western blot is similar, and the possibility for obtaining false positive is bigger.

3) protein spectrometry is enriched with target protein first with precipitation of protein, is divided using polyacrylamide gel electrophoresis From cutting glue for proteopepsis into small molecule peptide fragment, carry out database retrieval to peptide phase library, the peptide fragment matter lotus detected is compared in matching Than the difference with theoretical value, therefore, it is determined that the peptide fragment whether there is modification, and the peptide fragment abundance modified judges purpose egg White a possibility that being modified by ubiquitin-likeization, method high sensitivity also can detect that extremely low-abundance modification.It removes at high cost High, technical barrier is seriously outer, and this method is modified maximum technological deficiency for ubiquitin-likeization and is, ubiquitin-likeization modification betides The lysine residue of target protein, and one of trypsase its restriction enzyme site for being used to digest is also lysine, therefore this method The pancreatin digestion that must be used can specifically scale off SUMO albumen from lysine sites, be also easy to produce false negative result.

Summary of the invention

The technical problem to be solved in the present invention is to provide a kind of methods of the special adaptor protein SLP-76 ubiquitin-like of T cell And corresponding external efficient identification method.

In order to solve the above technical problem, the present invention provides a kind of special adaptor protein SLP-76 ubiquitin-likes of T cell Method, comprising the following steps:

1) SLP-76-UBC9 fusion protein expression plasmid, is constructed:

The sequence for encoding SLP-76 albumen is inserted into the multiple cloning sites of pcDNA3-MCS-Ubc9 plasmid, to construct SLP-76-UBC9 fusion expression plasmid (the fusion protein molecule amount of generation is in 100KD or so)；

Encode the sequence of SLP-76-UBC9 fusion protein are as follows:

ATGGCACTGAGGAATGTGCCCTTTCGCTCAGAGGTCCTGGGCTGGGACCCCGACAGCCTTGCTGACTA TTTCAAGAAGCTCAACTATAAGGACTGTGAGAAGGCAGTGAAGAAGTACCACATCGATGGGGCTCGCTTCTTGAAC CTGACAGAAAATGACATCCAGAAGTTCCCCAAGCTCCGGGTGCCGATTCTCAGTAAGTTAAGTCAGGAAATCAACA AGAACGAAGAGAGGAGGAGCATCTTCACACGCAAACCCCAAGTCCCGCGGTTTCCTGAAGAGACAGAAAGCCACGA AGAGGACAATGGGGGCTGGTCGTCCTTTGAAGAAGACGATTATGAAAGTCCCAATGATGACCAGGATGGGGAGGAT GATGGAGACTATGAGTCCCCCAATGAGGAGGAAGAGGCACCCGTGGAAGATGACGCGGATTATGAGCCGCCACCCT CCAATGACGAGGAAGCTCTGCAGAACTCCATCCTGCCTGCCAAGCCTTTCCCCAACTCCAACTCCATGTACATCGA CCGGCCCCCCTCTGGGAAAACCCCCCAGCAGCCTCCTGTGCCCCCCCAGAGACCGATGGCCGCCCTCCCGCCCCCA CCAGCCGGCCGGAATCACTCGCCACTGCCCCCACCCCAGACCAACCACGAAGAACCCAGCAGAAGCAGAAACCACA AAACGGCAAAGCTCCCTGCTCCTTCAATAGACAGAAGCACGAAACCTCCCCTAGATCGTTCATTAGCTCCGTTTGA TAGAGAACCCTTCACACTAGGAAAGAAACCACCATTTTCTGACAAGCCCTCGATTCCAGCGGGAAGGTCACTCGGG GAGCATTTACCCAAGATTCAAAAGCCTCCTTTACCACCGACCACGGAAAGACATGAAAGGAGCAGCCCCCTGCCAG GGAAGAAGCCACCTGTGCCAAAGCATGGATGGGGACCAGACAGAAGAGAGAATGATGAAGATGATGTGCATCAGAG ACCTTTGCCCCAGCCAGCACTACTTCCTATGAGCTCCAACACTTTCCCTTCAAGATCTACTAAGCCAAGTCCCATG AACCCTCTCCCATCCTCTCACATGCCTGGAGCATTCTCAGAAAGTAACAGCAGTTTTCCACAGAGTGCCTCCCTGC CACCATACTTCTCTCAAGGCCCTAGCAACAGACCACCTATCAGAGCCGAAGGCAGAAACTTCCCCTTGCCACTTCC AAACAAACCTCGGCCCCCATCCCCCGCGGAGGAAGAGAATTCATTAAATGAAGAGTGGTACGTTTCTTATATTACC CGACCAGAGGCAGAAGCTGCTCTTAGAAAGATAAACCAGGATGGCACATTTCTGGTCAGAGACAGCTCTAAAAAAA CAACAACCAATCCATATGTCCTCATGGTGTTGTACAAAGATAAAGTTTACAACATCCAGATCCGTTATCAGAAGGA AAGTCAAGTTTACTTGTTGGGAACTGGACTCCGAGGGAAAGAGGACTTTCTGTCTGTGTCAGATATTATTGACTAC TTCAGGAAAATGCCACTTCTGCTCATTGATGGGAAAAACCGAGGTTCCAGATACCAGTGCACATTAACGCATGCTG CAGGGTACCCACGAGGAGGATCGGGGATCGCCCTCAGCCGCCTTGCGCAGGAAAGGAAAGCCTGGAGGAAGGACCA CCCTTTTGGCTTTGTAGCTGTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATC CCTGGAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCCT CACCACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCCTGTCCAT CCTGGAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACAAGAACTTCTAAAT GAACCAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAACAGAGTGGAATATGAGAAAA GGGTCCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAA；

2), providing SLP-76 c-terminus transformation plasmid (by releasing the effect of SLP-76 intramolecular itself, reduces to ubiquitin-like The horizontal influence of change)；

3), the resulting transformation plasmid of step 2) and SUMO1 expression plasmid are co-expressed into the cell in HEK 293T；It obtains SLP-76 ubiquitin-likeization modification albumen (the SLP-76 ubiquitin-likeization modification albumen that can be detected).

That is, realizing the special adaptor protein SLP-76 ubiquitin-like of T cell by the abundance for improving the modification of SLP-76 ubiquitin-likeization The identification and detection of change.

The improvement of method as the special adaptor protein SLP-76 ubiquitin-like of T cell of the invention:

In the step 1), in the 3 ' coded sequences (preferably) of end continued access UBC9, to construct SLP- of SLP-76 sequence 76-UBC9 fusion expression plasmid.

Further improvements in methods as the special adaptor protein SLP-76 ubiquitin-like of T cell of the invention:

In the step 2), it is the UBC9 that 438-516 amino acids are rejected on SLP-76 that plasmid, which is transformed, in SLP-76 c-terminus Fusion protein expression plasmid.

Note: the 438-516 amino acids being removed are that step 1) encodes in the sequence of SLP-76-UBC9 fusion protein Sequence described in underscore.

The construction method of SLP-76 438-516 amino acids truncate are as follows: with the fusion of SLP-76-UBC9 obtained by step 1) Protein expressing plasmid is template, and the special primer that design 438-516 amino acids are rejected uses quikchange^TMRite-directed mutagenesis Kit (Agilent, #200524)；

Special primer are as follows:

Delete538-516 forward primer 5 ' -3 ': GCTGCTCTTAGAAACCGAGGTTCCAGATACCAGTGCA

Delete538-516 reverse primer 5 ' -3 ': CCTCGGTTTCTAAGAGCAGCTTCTGCCTCTGGTCG.

Note: operating referring to kit specification, and plasmid sequence is after mutation with the verifying of mulberry lattice PCR sequencing PCR.

The present invention goes back while providing a kind of detection method of special adaptor protein SLP-76 ubiquitin-like of T cell, special Sign be the following steps are included:

One, prepare protein lysis buffer:

Prepare 1%triton-x-100 lysis buffer: 20mM Tris-HCl pH 8.0,50mM NaCl, 1% Triton-x-100,1%protease inhibitor, 20mM iodoacetamide；

Take cell to be measured (HEK293T or Jurkat T) 6x10⁶The 1%triton-x-100 of 1 ± 0.1ml is added in cells Lysis buffer；It places 30 ± 5 minutes, is centrifuged (20000xg 15 minutes) on ice, collect supernatant protein liquid；

Two, with albumen polyacrylamide gel electrophoresis protein isolate, transferring film, being incubated for (successively incubation), SUMO1 is specifically Antibody and label protein/SLP-76 protein antibodies；Protein band position is matched, it is general to determine whether (observation) SLP-76 has occurred class Elementization modification.

The improvement of detection method as the special adaptor protein SLP-76 ubiquitin-like of T cell of the invention, the step In two:

(be greater than 75kd) above SLP-76 protein band and occur and move up band, and the band can simultaneously by SUMO1 antibody and Label protein/SLP-76 protein antibodies identification；Determine into SLP-76 and ubiquitin-likeization modification occurs；

Conversely, having no SLP-76 protein band above SLP-76 band；Or SUMO1 band not with SLP-76 band weight It closes, then determines that there is no ubiquitin-likeization modifications at SLP-76.

Note: plasmid generates albumen after expressing in the cell, can also be on expression plasmid skeleton in addition to SLP-76 albumen itself Label protein, therefore SLP-76 albumen can be detected with label protein antibody and SLP-76 protein antibodies；Similar works as expression FLAG-SUMO1 plasmid can recognize SUMO1 albumen with FLAG label protein antibody.

The further improvement of detection method as the special adaptor protein SLP-76 ubiquitin-like of T cell of the invention:

After with the incubation of SUMO1 specific antibody, in high molecular weight region, (100KD or more) observes SUMO1 albumen one Band, and SLP-76 protein antibodies are incubated for after same film erasing, above SLP-76 band (generally 100kd-180kd), There is SLP-76 protein band, and the band be overlapped with SUMO1 protein band condition when, at SLP-76 class has had occurred in judgement Ubiquitination；

Conversely, (100kd-180kd) has no SLP-76 protein band above SLP-76 band；Or 100kd-180kd it Between SUMO1 band be not overlapped with SLP-76 band, then determine at SLP-76, there is no ubiquitin-likeization modifications.

After being incubated for FLAG antibody (FLAG is label protein on SUMO1 plasmid, indicates SUMO1 albumen), in macromolecule Amount region (100KD or more) observes SUMO1 protein band, and is incubated for UBC9 protein antibodies (UBC9 after same film erasing Albumen is shared for SLP-76-UBC9 fusion plasmid, can be used as label protein instruction SLP-76 fusion protein), in SLP-76 band There is SLP-76 protein band, and the condition that the band is overlapped with SUMO1 protein band in top (generally 100kd-180kd) When, determine that ubiquitin-likeization modification has had occurred at SLP-76；

That is, label protein is FLAG and UBC9, what is indicated respectively is SUMO1 albumen and SLP-76-UBC9 fusion protein.

The present invention solves the problems, such as following 2 of the existing technology: one, the protein abundance of ubiquitin-likeization modification is generally inclined Low, conventional method can not detect that SLP-76 ubiquitin-likeization is modified, therefore be badly in need of improving the abundance of SLP-76 ubiquitin-likeization modification, To achieve the purpose that can be detected using conventional biochemical method；Two, it is general to restrain influence class for the effect of SLP-76 intramolecular itself The level of elementization.That is, the present invention provides the methods of the external efficiently identification special adaptor protein SLP-76 ubiquitin-like of T cell； This method ensures specificity, high efficiency and the correctness of SLP-76 ubiquitin-likeization modification identification, and simple and fast, low in cost, Favorable repeatability.

The specific steps of the present invention are as follows:

(1) protein expressing plasmid is constructed；Wherein, the protein expressing plasmid includes SLP-76 expression plasmid, SLP-76 function It can domain truncate, SLP-76-UBC9 fusion protein expression plasmid, enzyme and molecule crucial in several ubiquitin-like modification reactions Expression plasmid.These plasmids are inserted into the coded sequence of the albumen, and have code tag albumen in aminoterminal or c-terminus Sequence.UBC9 is unique E2 ligase in the ubiquitin-like modification reaction being currently known, it passes through covalent effect for SUMO Albumen is connected on the lysine residue of destination protein.It is general that UBC9 albumen by significant is improved with destination protein amalgamation and expression to class The protein abundance of elementization modification.The present invention provides a kind of SLP-76-UBC9 fusion protein expression plasmid, insetion sequence SLP- 76 coded sequence, and the 3 ' coded sequences of end continued access UBC9 in SLP-76 sequence.

Preferably, the destination protein expression plasmid is SLP-76-UBC9 fusion protein expression plasmid.

(2) it provides SLP-76 c-terminus and plasmid is transformed, by releasing the effect of SLP-76 intramolecular itself, reduce to ubiquitin-like The horizontal influence of change.

Preferably, the SLP-76 c-terminus transformation plasmid is that the UBC9 that 438-516 amino acids are rejected on SLP-76 melts Hop protein expression plasmid.

(3) SLP-76-UBC9 fusion protein expression plasmid and transformation plasmid and SUMO1 expression plasmid are total to table in the cell It reaches；

(4) prepare protein lysis buffer, which is added suitable hydrolase on common detergent base SENP inhibitor iodoacetamide stagnates reversible ubiquitin-like modification reaction before hydrolysis, can be reserved for and gather ubiquitin-like The albumen for changing modification prevents it hydrolyzed.Protein lysate is collected, on anti-SLP-76-UBC9 fusion protein expression plasmid The antibody combination albumen agarose G globule of label protein is enriched with SLP-76-UBC9 fusion protein, collects protein eluate；

Preferably, the final concentration of 20mmol/L of SENP inhibitor iodoacetamide.

With albumen polyacrylamide gel electrophoresis protein isolate, transferring film is successively incubated for SUMO1 specifically antibody and label Protein antibodies.Protein band position is matched, whether observation SLP-76 has occurred ubiquitin-likeization modification.

The invention has the following beneficial effects:

(1) identification method of protein s LP-76 ubiquitin-likeization modification provided by the invention, by melting SLP-76-UBC9 Hop protein expression plasmid is co-expressed with SUMO1 expression plasmid in HEK 293T into the cell, and hydrolase is added in protein lysate SENP inhibitor improves the abundance of ubiquitin-likeization modification albumen.

(2) building truncates body expression vector, 438 to 516 amino acids of c-terminus on SLP-76 albumen is deleted, in conjunction with (1) It is middle to propose improvement, detectable SLP-76 ubiquitin-like modification level is significantly improved, realizes the modification of SLP-76 ubiquitin-likeization.

That is, being directed to existing technical problem, the present invention utilizes simplicity by the region of transformation SLP-76 c-terminus Protein immunization precipitating-blotting optimizes proteolysis conditions, significantly improves the SUMOization modification level of SLP-76, real for the first time The now external special adaptor protein SLP-76 ubiquitin-likeization modification of efficiently identification T cell.

To sum up, the identification method of SLP-76 ubiquitin-likeization modification provided by the invention is easy to operate, by easy tradition Protein immunization precipitating-Western blot improves protein expression mode and cleavage method, and SLP-76 protein structure is transformed, referring now to The prior art, the present invention quickly identification SLP-76 ubiquitin-likeization modification in vitro, at low cost, result is reliable, favorable repeatability.

Detailed description of the invention

Specific embodiments of the present invention will be described in further detail with reference to the accompanying drawing.

Fig. 1 is that traditional protein lysis buffer ingredient modifies identification SLP-76 ubiquitin-likeization in Jurkat T cell system Influence.

Fig. 2 is that improvement protein lysis buffer ingredient modifies identification SLP-76 ubiquitin-likeization in Jurkat T cell system Influence.

In Fig. 2, left figure is with the result figure of SUMO1 antibody incubation, and right figure is the result figure of SLP-76 antibody incubation.

Fig. 3 is general to Jurkat T cell system SLP-76 class using improvement protein lysis buffer detection anti-CD3 stimulation The influence of elementization modification.

Fig. 4 is to identify that SLP-76 can be modified by ubiquitin-like using SLP-76-UBC9 expressing fusion protein system.

Upper figure is UBC9 antibody incubation as a result, the following figure is FLAG antibody incubation result.

Fig. 5 is that SLP-76 ubiquitin-likeization modifies coomassie brilliant blue staining figure after Protein Separation.

Fig. 6 be high molecular weight SLP-76 ubiquitin-likeization modify albumen protein Spectrum Analysis result figure (lysine is repaired Adorn site 1).

Fig. 7 be high molecular weight SLP-76 ubiquitin-likeization modify albumen protein Spectrum Analysis result figure (lysine is repaired Adorn site 2).

Fig. 8 is that HEK 293T cell co-expresses HA-SLP-76 plasmid and FLAG-SUMO1, UBC9 plasmid pair identify SLP-76 The influence of ubiquitin-likeization modification.

Specific embodiment

The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in This:

Method as used in the following examples is conventional method unless otherwise instructed, such as specific steps can be found in: 《Molecular Cloning:A Laboratory Manual》(Sambrook,J.,Russell,David W., Molecular Cloning:A Laboratory Manual,3rd edition,2001,NY,Cold Spring Harbor).The primer is synthesized by Shanghai Sheng Gong Co., Ltd.Expression vector pcDNA 3.1 is purchased from invitrogen company, matter Grain pSRa-UBC9, pSRa-SUMO1 and pSRa-SLP-76 and jurkat T cell, HEK293T cell are being published in " the The Immune Adaptor SLP-76 Binds to SUMO-RANGAP1 at Nuclear of " Molecular cell " Pore Complex Filaments to Regulate Nuclear Import of Transcription Factors in Have in a T Cells " text and clearly refer to, and title is consistent.

Embodiment 1, under the proteolysis conditions of improvement, SLP-76 ubiquitin-likeization modifies mirror in jurkat T cell It is fixed；The following steps are included:

1), T cell system Jurkat is suspended in 2%FCS-RPMI1640 culture solution (cell concentration 6x10⁶/ ml), first Adding CD 3-resisting monoclonal antibody (OKT3 is used for humanized's t cell activation) or homotype IgG to make negative control, (CD 3-resisting monoclonal is anti- The final concentration of body or homotype IgG are 2 μ g/ml) it is incubated for 30 minutes at 4 DEG C, then plus the secondary antibody (anti-T-cell antibody) of 1 μ g/ml Under the conditions of 37 DEG C crosslinked action 60 minutes to activate T cell.Then it is washed with PBS (PBS buffer solution) secondary unbonded to remove Antibody (mode that protein immunoblot can be used is detected, so that it is determined that antibody has been removed), it is spare after cell precipitation.

The 2%FCS-RPMI1640 is the RPMI-1640 culture medium for containing 2% fetal calf serum.

Note: negative control is the cell stimulated through IgG negative control, i.e., inactive T cell.

2) 1%triton-x-100 lysis buffer, is prepared:

The ingredient of 1%triton-x-100 lysis buffer are as follows: 20mM Tris-HCl pH 8.0,50mM NaCl, 1% Triton-x-100 (v/v), 1%protease inhibitor (v/v), 20mM iodoacetamide.

That is, the preparation method of the 1%triton-x-100 lysis buffer are as follows: in 1L 20mM Tris-HCl pH 8.0 In, 50mmol NaCl, 10ml triton-x-100,10ml protease inhibitor cocktail (EDTA- is added Free, 100X, Roche, article No. 0469313200120), 20mmol iodoacetamide.

Take the resulting cell 6x10 of step 1⁶The above-mentioned 1%triton-x-100 lysis buffer of 1ml is added in cells；In It places 30 minutes on ice, 20000xg is centrifuged 15 minutes, collects supernatant protein liquid.

3), with monoclonal antibody anti-SLP-76 immunoprecipitation holoprotein:

2ug anti-SLP-76 monoclonal antibody or 2ug cognate pair are added in the resulting supernatant protein liquid of step 2) According to IgG (i.e. rabbit IgG), 4 DEG C are slowly rocked incubation 2 hours, then add 25ul Protein-A Sepharose beads, and 4 DEG C are incubated for 45 points Clock keeps antibody (monoclonal antibody anti-SLP-76) and Protein-A Sepharose beads coupled.At 4 DEG C with 6,000rpm speed centrifugation 30 Second, sepharose 4B is centrifuged to tube bottom；Supernatant is carefully sucked, with lysis buffer, (1%triton-x-100 is split sepharose 4B Solution buffer) it washes 3 times (each dosage is 1ml)；It is eventually adding 3 × SDS sample-loading buffer of 15 μ l, boiling water boiling 5 minutes；Make For protein sample；

Note: ubiquitin-likeization modification is because abundance is extremely low in the cell, it is therefore desirable to be enriched with background with the method for immunoprecipitation Protein S LP-76, then detect the ubiquitin-likeization modification on the albumen.

Take 20 μ g protein samples, 4-12% gradient glue SDS-PAGE electrophoresis.Then it is thin to nitric acid fibril element to shift 1h by 50mA Film is put into 37 DEG C of closing 1h in confining liquid；After primary antibody SLP-76 antibody or 4 DEG C of anti-SUMO1 antibody wash film repeatedly overnight, by film with The anti-igg secondary antibody of far infrared fluorophor label is incubated for (incubation conditions are room temperature jog 45 minutes), is washed using PBST buffer After film, the imaging in Oddyssey far infrared imagery instrument (setup parameter of the far infrared imagery instrument is default initial parameter).

Confining liquid are as follows: 5g bovine serum albumin(BSA) is dissolved in 100ml PBST buffer；PBST buffer is 1ml Tween- 20 are dissolved in 1L 1x PBS.

As shown in Fig. 2,

Duct 1-3 is respectively using rabbit IgG as immunoprecipitation control antibodies sample, and homotype IgG makees negative control stimulation The sample of jurkat T cell, CD 3-resisting monoclonal antibody stimulate the sample of jurkat T cell, are incubated for the result of SUMO1 antibody；

That is, specifically:

Duct 1 are as follows: use homotype IgG in step 1), use rabbit IgG to do immunoprecipitation in step 3), primary antibody is anti- SUMO1 antibody；

Duct 2 are as follows: use homotype IgG in step 1), use anti-SLP-76 monoclonal antibody in step 3), primary antibody is Anti- SUMO1 antibody；

Duct 3 are as follows: using anti-using anti-SLP-76 monoclonal in CD 3-resisting monoclonal antibody, step 3) in step 1) Body, primary antibody are anti-SUMO1 antibody；

Duct 4-6 is respectively using rabbit IgG as immunoprecipitation control antibodies sample, and homotype IgG makees negative control stimulation The sample of jurkat T cell, CD 3-resisting monoclonal antibody stimulate the sample of jurkat T cell, are incubated for the knot of SLP-76 antibody Fruit.

In the embodiment 1,

Observe SUMO1 protein band in 3 high molecular weight region of duct (generally 100KD or more) --- for two upper shipper poles (about 110KD or so), duct 6 in addition to there is SLP-76 protein band (about 75KD), also above SLP-76 band occur with Therefore 2 bands that SUMO1 protein band coincides determine that ubiquitin-likeization modification has had occurred at SLP-76.

That is, SLP-76 molecular weight of albumen about 75KD, above 75KD, with primary antibody SLP-76 antibody incubation, in 110KD or so Position there are two upper shipper poles, and this two band can be identified by anti-SLP-76 antibody or anti-SUMO1 antibody simultaneously, be shown SLP-76 can be modified by ubiquitin-like under this condition.

And duct 1, duct 4 are without there is any band, therefore explanation: using rabbit IgG as immunoprecipitation control antibodies Sample can not generate similar band；

Duct 2-3 is in addition to there are two SUMO1 protein bands above 100KD, and (about 125KD) has one below 130KD Weak SUMO1 band, and duct 5-6 is in addition to there is SLP-76 protein band (about 75KD), also above SLP-76 band There are 2 bands in (100KD or so), and (about 125KD) does not have band to be overlapped with SUMO1 protein band below 130KD, therefore says Bright: 100KD or so band is the special ubiquitin-like Decorative strip band of SLP-76, and the lower section 130KD position (about 125KD) is not For the ubiquitin-like Decorative strip band of SLP-76.

Traditional immunoprecipitation-Western blot (iodoacetamide is not added) is selected in control 1, that is, relative to above-described embodiment For 1, protein lysate ingredient is changed, iodoacetamide is not added and (cancels " 20mM in 1%triton-x-100 lysis buffer The use of iodoacetamide ", remaining preparation with the protein lysis buffer of embodiment 1), acquired results are as follows:

As shown in Figure 1, duct 1-3 is respectively using rabbit IgG as immunoprecipitation control antibodies sample, homotype IgG makees negative The sample of control stimulation jurkat T cell, CD 3-resisting monoclonal antibody stimulate the sample of jurkat T cell, and it is anti-to be incubated for SLP-76 The result of body；Duct 4-6 is respectively using rabbit IgG as immunoprecipitation control antibodies sample, and homotype IgG makees negative control stimulation The sample of jurkat T cell, CD 3-resisting monoclonal antibody stimulate the sample of jurkat T cell, are incubated for the result of SUMO1 antibody.

In duct 3, above 75KD, antibody incubation, and have no that moving up band appears in above SLP-76, shows tradition side The condition of method can not be such that the ubiquitin-likeization modification of SLP-76 is detected.

Embodiment 2, under the proteolysis conditions of improvement, the modification of SLP-76 ubiquitin-likeization is horizontal in jurkat T cell Increase with CD 3-resisting monoclonal antibody stimulation time and increase:

For embodiment 1, make following change:

By in step 1) " and then add 1 μ g/ml secondary antibody (anti-T-cell antibody) under the conditions of 37 DEG C crosslinked action 60 divide Clock is to activate T cell " it is changed to the following contents: and then the secondary antibody (anti-T-cell antibody) of 1 μ g/ml is added to be crosslinked under the conditions of 37 DEG C Effect, the time is respectively to differ for 2 minutes, 5 minutes, 15 minutes, 30 minutes, 60 minutes, to activate T cell.

Cancel " 2ug homologous reference IgG (i.e. rabbit IgG) " in step 3), that is, in the resulting supernatant protein liquid of step 2) Middle addition 2ug anti-SLP-76 monoclonal antibody；

Remaining is equal to embodiment 1.

Acquired results such as Fig. 3 shows that duct 1-6 is respectively the sample that homotype IgG makees negative control stimulation jurkat T cell This, CD 3-resisting monoclonal antibody stimulation jurkat T cell 2 minutes, 5 minutes, 15 minutes, 30 minutes, 60 minutes samples.

In Fig. 3,

Duct 1 is the sample that homotype IgG makees negative control stimulation jurkat T cell, i.e., the T cell not stimulated, with implementation Duct 2 and 5 in example 1.Above 75KD, with primary antibody SLP-76 antibody incubation, occurs two in the position of 110KD or so and move up Band, and this two band can be identified by anti-SLP-76 antibody or anti-SUMO1 antibody simultaneously.Therefore illustrate: with embodiment 1, SLP-76 can be modified by ubiquitin-like in the Jurkat T cell not stimulated；

Duct 2~6 is CD 3-resisting monoclonal antibody stimulation jurkat T cell, and SLP-76 is modified by ubiquitin-likeization It can detect, but duct 6 (for 60 minutes jurkat T cells of stimulation), SLP-76 is shown by ubiquitin-likeization modification band intensity It writes and increases；Therefore illustrate: that is, crosslinked action 60 minutes under the conditions of 37 DEG C are preferred embodiment.

According to this embodiment 2, it can be seen that: with primary antibody SUMO1 antibody incubation, occur on two in the position of 110KD or so Shipper pole, intensity of shipper pole extends with stimulation time and is increased on this, shows that the ubiquitin-likeization modification of SLP-76 under this condition can quilt It repeats, and modifies by the time extension that CD 3-resisting monoclonal antibody stimulates and horizontal up-regulation, embody the dynamic change of ubiquitin-likeization modification Change.That is, modification level extends with stimulation time and is increased.

Note: tubulin is only consistent internal reference albumen, tubulin band intensity as each duct albumen applied sample amount of display It is similar, show that each duct albumen applied sample amount is consistent, the variation of SLP-76 ubiquitin-like level is not caused by applied sample amount difference.

Embodiment 3, the SLP-76-UBC9 fusion protein system of improvement identify its ubiquitination in vitro；Including following Step:

1), construction of fusion protein expression plasmid:

According to " nature methods " " Ubc9 fusion-directed SUMOylation (UFDS): a method Record in analyze function of protein SUMOylation " will encode the sequence of SLP-76 albumen (NCBI gene database, number NM_005565.5) is inserted into the multiple cloning sites of pcDNA3-MCS-Ubc9 plasmid, i.e., preferably Ground SLP-76 sequence 3 ' end continued access UBC9 coded sequence, successfully construct SLP-76-UBC9 fusion expression plasmid, generation Fusion protein molecule amount is in 100KD or so.

Encode the sequence of SLP-76 albumen are as follows:

ATGGCACTGAGGAATGTGCCCTTTCGCTCAGAGGTCCTGGGCTGGGACCCCGACAGCCTTGCTGACTA TTTCAAGAAGCTCAACTATAAGGACTGTGAGAAGGCAGTGAAGAAGTACCACATCGATGGGGCTCGCTTCTTGAAC CTGACAGAAAATGACATCCAGAAGTTCCCCAAGCTCCGGGTGCCGATTCTCAGTAAGTTAAGTCAGGAAATCAACA AGAACGAAGAGAGGAGGAGCATCTTCACACGCAAACCCCAAGTCCCGCGGTTTCCTGAAGAGACAGAAAGCCACGA AGAGGACAATGGGGGCTGGTCGTCCTTTGAAGAAGACGATTATGAAAGTCCCAATGATGACCAGGATGGGGAGGAT GATGGAGACTATGAGTCCCCCAATGAGGAGGAAGAGGCACCCGTGGAAGATGACGCGGATTATGAGCCGCCACCCT CCAATGACGAGGAAGCTCTGCAGAACTCCATCCTGCCTGCCAAGCCTTTCCCCAACTCCAACTCCATGTACATCGA CCGGCCCCCCTCTGGGAAAACCCCCCAGCAGCCTCCTGTGCCCCCCCAGAGACCGATGGCCGCCCTCCCGCCCCCA CCAGCCGGCCGGAATCACTCGCCACTGCCCCCACCCCAGACCAACCACGAAGAACCCAGCAGAAGCAGAAACCACA AAACGGCAAAGCTCCCTGCTCCTTCAATAGACAGAAGCACGAAACCTCCCCTAGATCGTTCATTAGCTCCGTTTGA TAGAGAACCCTTCACACTAGGAAAGAAACCACCATTTTCTGACAAGCCCTCGATTCCAGCGGGAAGGTCACTCGGG GAGCATTTACCCAAGATTCAAAAGCCTCCTTTACCACCGACCACGGAAAGACATGAAAGGAGCAGCCCCCTGCCAG GGAAGAAGCCACCTGTGCCAAAGCATGGATGGGGACCAGACAGAAGAGAGAATGATGAAGATGATGTGCATCAGAG ACCTTTGCCCCAGCCAGCACTACTTCCTATGAGCTCCAACACTTTCCCTTCAAGATCTACTAAGCCAAGTCCCATG AACCCTCTCCCATCCTCTCACATGCCTGGAGCATTCTCAGAAAGTAACAGCAGTTTTCCACAGAGTGCCTCCCTGC CACCATACTTCTCTCAAGGCCCTAGCAACAGACCACCTATCAGAGCCGAAGGCAGAAACTTCCCCTTGCCACTTCC AAACAAACCTCGGCCCCCATCCCCCGCGGAGGAAGAGAATTCATTAAATGAAGAGTGGTACGTTTCTTATATTACC CGACCAGAGGCAGAAGCTGCTCTTAGAAAGATAAACCAGGATGGCACATTTCTGGTCAGAGACAGCTCTAAAAAAA CAACAACCAATCCATATGTCCTCATGGTGTTGTACAAAGATAAAGTTTACAACATCCAGATCCGTTATCAGAAGGA AAGTCAAGTTTACTTGTTGGGAACTGGACTCCGAGGGAAAGAGGACTTTCTGTCTGTGTCAGATATTATTGACTAC TTCAGGAAAATGCCACTTCTGCTCATTGATGGGAAAAACCGAGGTTCCAGATACCAGTGCACATTAACGCATGCTG CAGGGTACCCACGAGGAGGATCGGGGATCGCCCTCAGCCGCCTTGCGCAGGAAAGGAAAGCCTGGAGGAAGGACCA CCCTTTTGGCTTTGTAGCTGTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATC CCTGGAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCCT CACCACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCCTGTCCAT CCTGGAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACAAGAACTTCTAAAT GAACCAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAACAGAGTGGAATATGAGAAAA GGGTCCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAA。

2) SLP-76 molecule domain truncate fusion protein expression plasmid, is constructed:

SLP-76-UBC9 fusion expression plasmid resulting to step 1) truncates and deletes 438 amino acids to 516 bit aminos Acid.

Specifically: using SLP-76-UBC9 fusion protein expression plasmid obtained by step 1) as template, design 438-516 ammonia The special primer (as described below) that base acid is rejected, uses quikchange^TMSite-directed mutagenesis kit (Agilent, #200524), It is operated referring to kit specification.Plasmid sequence is after mutation with the verifying of mulberry lattice PCR sequencing PCR.

Primer sequence are as follows:

Delete538-516 forward primer 5 ' -3 ': GCTGCTCTTAGAAACCGAGGTTCCAGATACCAGTGCA

Delete538-516 reverse primer 5 ' -3 ': CCTCGGTTTCTAAGAGCAGCTTCTGCCTCTGGTCG

Note: the 438-516 amino acids being removed correspond to the sequence with underscore in step 1).

Gains are the UBC9 fusion plasmid that SLP-76 438-516 amino acids are rejected；To realize SLP-76 albumen 438 amino acids to 516 amino acids are deleted.

3), in the resulting SLP-76 438-516 amino acids of the intracellular cotransfection fusion plasmid (step 2) of HEK 293T The UBC9 fusion plasmid of rejecting) and FLAG-SUMO1 plasmid (pCMV-flag-Sumo1), cell is collected after 24 hours, it is clear with pbs It washes 2 times；It is spare after cell precipitation.

Cotransfection mode is liposome transfection, referring to lipofectamine (Lipofectamine 2000, Thermo Fisher, #11668019) specification operation, the UBC9 fusion plasmid that 4ug SLP-76 438-516 amino acids are rejected, 4ug FLAG-SUMO1 plasmid (pCMV-flag-Sumo1) and 20ul transfection reagent are mixed and made into DNA- liposome complex, transfect 1 The HEK 293T cell of diameter 6cm culture dish.

4), prepare 1%triton-x-100 lysis buffer (with embodiment 1).Ingredient are as follows: 20mM Tris-HCl pH 8.0,50mM NaCl, 1%triton-x-100,1%protease inhibitor, 20mM iodoacetamide.

Take the resulting cell 6x10 of step 3)⁶The above-mentioned 1%triton-x-100 lysis buffer of 1ml is added in cells； It is placed 30 minutes on ice, 20000xg is centrifuged 15 minutes, collects supernatant protein liquid.

5), with monoclonal antibody anti-HA immunoprecipitation holoprotein:

2ug anti-HA (HA mouse resource monoclonal antibody) is added in the resulting supernatant protein liquid of step 4), 4 DEG C slowly Rock incubation 2 hours；Then 25ul Protein-A Sepharose beads are added, 4 DEG C of incubations make antibody and Protein-A Sepharose beads in 45 minutes It is coupled.At 4 DEG C with 6,000rpm speed centrifugation 30 seconds, sepharose 4B is centrifuged to tube bottom；Supernatant is carefully sucked, sepharose 4B It is washed 3 times (each dosage is 1ml) with lysis buffer；It is eventually adding 3 × SDS sample-loading buffer of 15 μ l, boiling water boiling 5 divides Clock.As protein sample.

Take 20 μ g protein samples, 4-12% gradient glue SDS-PAGE electrophoresis.Then it is thin to nitric acid fibril element to shift 1h by 50mA Film is put into 37 DEG C of closing 1h in confining liquid；After primary antibody UBC9 antibody or 4 DEG C of anti-FLAG antibody wash film repeatedly overnight, by film and remote The anti-igg secondary antibody of IR fluorescence group label is incubated for (incubation conditions are room temperature jog 45 minutes), washes film using PBST buffer Afterwards, the imaging in Oddyssey far infrared imagery instrument (setup parameter of the far infrared imagery instrument is default initial parameter).

Duct 1 are as follows: save step 2), using plasmid obtained by step 1) in step 3), not with FLAG-SUMO1 plasmid (pCMV-flag-Sumo1) it co-expresses；

Duct 2 are as follows: save step 2), use plasmid obtained by step 1) and FLAG-SUMO1 plasmid (pCMV- in step 3) Flag-Sumo1 it) co-expresses；

Duct 7 are as follows: merge matter using the UBC9 that SLP-76 438-516 amino acids obtained by step 2) are rejected in step 3) Grain is co-expressed with FLAG-SUMO1 plasmid (pCMV-flag-Sumo1)；

Acquired results are as described in Figure 4.

In Fig. 4,

There is not macromolecule band, and FLAG antibody incubation in the position of the 100KD or more after UBC9 antibody incubation of duct 1 Afterwards without band；

Duct 2 has appeared above a plurality of macromolecule band in 130KD after UBC9 antibody incubation, and with FLAG band weight It closes, determines that ubiquitin-likeization modification has had occurred at SLP-76；

Duct 7 has appeared above a plurality of macromolecule band in 130KD after UBC9 antibody incubation, and with FLAG band weight It closes, determines that ubiquitin-likeization modification has had occurred at SLP-76.And duct 2 is compared, bin number is more and intensity is high, therefore says Bright: coexpression SLP-76 fusion protein and SUMO1 albumen can significantly improve SLP-76 ubiquitin-like modification level, and SLP- It is horizontal that the rejecting of 76438-516 amino acids can be further improved the modification of SLP-76 ubiquitin-like.

That is, as the duct Fig. 4 1-2 is shown, SLP-76 fusion-UBC9 molecular weight of albumen about 100KD, above 100KD, with one Anti- UBC9 antibody incubation (above), the position of 130KD or so occur a plurality of upper shipper pole can simultaneously by the identification of anti-FLAG antibody (under Figure), show that the ubiquitin-likeization modification of fusion protein S LP-76-UBC9 can be repeated in HEK293T.

As shown in the duct Fig. 47, after 438 amino acids to 516 amino acids of SLP-76 albumen are deleted, class The quantity and intensity of ubiquitination band greatly improve (protein band between 7 100kd-180kd of duct).

Control 2,

By " truncating and deleting 438 bit aminos in the SLP-76-UBC9 fusion expression plasmid in the step 2) in embodiment 3 Acid is to 516 amino acids " it is changed to " truncate and delete 25 amino acids to 56 amino acids " respectively, " truncates and deletes 56 amino acids To 86 amino acids ", " truncate delete 226 amino acids to 267 amino acids ", " truncate and delete 279 amino acids to 309 Amino acid ", to obtain duct 3-6 as described in Figure 4 accordingly；That is, the truncation SLP-76 of building corresponding to the 3-6 of duct its The UBC9 fusion protein group of his structural domain.But the deletion of these structural domains can not enhance ubiquitin-like Decorative strip band The number and intensity of (protein band between 100kd-180kd).

The above results show preferred SLP-76 c-terminus transformation plasmid (i.e. 438 amino acids only of the present invention To 516 amino acids delete UBC9 fusion plasmid) can be further improved fusion protein S LP-76-UBC9 ubiquitin-likeization modification It is horizontal.

Embodiment 4, the SLP-76-UBC9 fusion protein system of protein spectrometry verifying improvement are identified reliable in vitro Property；The following steps are included:

The step 1)~step 4) of vector construction, protein expression and extraction with embodiment 3.

5), with monoclonal antibody anti-HA immunoprecipitation holoprotein:

2ug anti-HA is added in the resulting supernatant protein liquid of step 4), 4 DEG C are slowly rocked incubation 2 hours；Then again 25ul Protein-A Sepharose beads are added, 4 DEG C of incubations keep antibody coupled with Protein-A Sepharose beads in 45 minutes.At 4 DEG C with 6,000rpm Speed is centrifuged 30 seconds, and sepharose 4B is centrifuged to tube bottom；Supernatant is carefully sucked, sepharose 4B washes 3 times (often with lysis buffer Secondary dosage is 1ml)；It is eventually adding 3 × SDS sample-loading buffer of 15 μ l, boiling water boiling 5 minutes.As protein sample.

Take 20 μ g protein samples, 4-12% gradient glue SDS-PAGE electrophoresis.Then with coomassie brilliant blue staining protein adhesive.Such as Shown in Fig. 5, duct 1 is that empty plasmid compares (that is, with the FLAG-SUMO1 plasmid in pCMV skeleton plasmid alternative steps 3 (pCMV-flag-Sumo1) obtain), duct 2 and 3 is the SLP-76-UBC9 fusion protein plasmid and FLAG-SUMO1 of improvement The sample of coexpression.The blob of viscose of position and size shown in box is cut out, trypsin digestion carries out routine protein mass spectral analysis. Amino acid sequence and original spectrogram are matched, charge-mass ratio is analyzed, it is possible to identify goes out preferred SLP-76 c-terminus transformation fusion protein and exists On two sites (albumen peptide fragment map difference as shown in Figure 6 and Figure 7) there are ubiquitin-likeization modification, prompt simplicity of the invention and The result that method at low cost obtains can be repeated by protein spectrometry, as a result reliably.

The method of external Rapid identification SLP-76 ubiquitin-likeization modification provided by the invention, by improving ubiquitin-likeization modification SLP-76 protein abundance, simply and effectively, repeatably and reliably obtain qualification result.

The UBC9 fusion plasmid that SLP-76 438-516 amino acids in embodiment 3 are rejected is changed to as normal by control 3 Overall length SLP-76 single expression plasmid described in rule technology, and UBC9 albumen single expression；Remaining is equivalent, acquired results Fig. 8. As shown in figure 8, duct 1-5 is to co-express diagram plasmid into the cell in HEK293T, it is incubated for the result of HA antibody；Duct 6-10 is Diagram plasmid is co-expressed into the cell in HEK293T, is incubated for the result of SUMO1 antibody.Molecular weight is when SLP-76 single expression 75kd or so does not have found to move up band in 75kd or more, this says after being incubated for the result of HA antibody and SUMO1 antibody Bright single expression SLP-76 and UBC9 does not improve ubiquitin-like modification level, and the ubiquitin-likeization of SLP-76 is modified not under this condition It is detected.

The above list is only a few specific embodiments of the present invention for finally, it should also be noted that.Obviously, this hair Bright to be not limited to above embodiments, acceptable there are many deformations.Those skilled in the art can be from present disclosure All deformations for directly exporting or associating, are considered as protection scope of the present invention.

Sequence table

<110>Xi'an Jiaotong-Liverpool University

<120>method of the special adaptor protein SLP-76 ubiquitin-like of T cell and corresponding external efficiently identification

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2082

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

atggcactga ggaatgtgcc ctttcgctca gaggtcctgg gctgggaccc cgacagcctt 60

gctgactatt tcaagaagct caactataag gactgtgaga aggcagtgaa gaagtaccac 120

atcgatgggg ctcgcttctt gaacctgaca gaaaatgaca tccagaagtt ccccaagctc 180

cgggtgccga ttctcagtaa gttaagtcag gaaatcaaca agaacgaaga gaggaggagc 240

atcttcacac gcaaacccca agtcccgcgg tttcctgaag agacagaaag ccacgaagag 300

gacaatgggg gctggtcgtc ctttgaagaa gacgattatg aaagtcccaa tgatgaccag 360

gatggggagg atgatggaga ctatgagtcc cccaatgagg aggaagaggc acccgtggaa 420

gatgacgcgg attatgagcc gccaccctcc aatgacgagg aagctctgca gaactccatc 480

ctgcctgcca agcctttccc caactccaac tccatgtaca tcgaccggcc cccctctggg 540

aaaacccccc agcagcctcc tgtgcccccc cagagaccga tggccgccct cccgccccca 600

ccagccggcc ggaatcactc gccactgccc ccaccccaga ccaaccacga agaacccagc 660

agaagcagaa accacaaaac ggcaaagctc cctgctcctt caatagacag aagcacgaaa 720

cctcccctag atcgttcatt agctccgttt gatagagaac ccttcacact aggaaagaaa 780

ccaccatttt ctgacaagcc ctcgattcca gcgggaaggt cactcgggga gcatttaccc 840

aagattcaaa agcctccttt accaccgacc acggaaagac atgaaaggag cagccccctg 900

ccagggaaga agccacctgt gccaaagcat ggatggggac cagacagaag agagaatgat 960

gaagatgatg tgcatcagag acctttgccc cagccagcac tacttcctat gagctccaac 1020

actttccctt caagatctac taagccaagt cccatgaacc ctctcccatc ctctcacatg 1080

cctggagcat tctcagaaag taacagcagt tttccacaga gtgcctccct gccaccatac 1140

ttctctcaag gccctagcaa cagaccacct atcagagccg aaggcagaaa cttccccttg 1200

ccacttccaa acaaacctcg gcccccatcc cccgcggagg aagagaattc attaaatgaa 1260

gagtggtacg tttcttatat tacccgacca gaggcagaag ctgctcttag aaagataaac 1320

caggatggca catttctggt cagagacagc tctaaaaaaa caacaaccaa tccatatgtc 1380

ctcatggtgt tgtacaaaga taaagtttac aacatccaga tccgttatca gaaggaaagt 1440

caagtttact tgttgggaac tggactccga gggaaagagg actttctgtc tgtgtcagat 1500

attattgact acttcaggaa aatgccactt ctgctcattg atgggaaaaa ccgaggttcc 1560

agataccagt gcacattaac gcatgctgca gggtacccac gaggaggatc ggggatcgcc 1620

ctcagccgcc ttgcgcagga aaggaaagcc tggaggaagg accacccttt tggctttgta 1680

gctgtcccaa caaagaaccc tgatggcaca atgaacctga tgaactggga gtgcgctatc 1740

cctggaaaga aggggactcc atgggaagga ggcttgttca agctacggat gcttttcaaa 1800

gatgactatc cgtcctcacc accaaaatgt aaatttgagc ccccactgtt tcatccaaac 1860

gtgtatcctt ctggcacagt gtgcctgtcc atcctggagg aagacaagga ctggaggcca 1920

gctatcacca tcaaacagat cttattagga atacaagaac ttctaaatga accaaatatt 1980

caagacccag ctcaagcaga ggcctacaca atttactgcc aaaacagagt ggaatatgag 2040

aaaagggtcc gagcacaagc gaagaagttt gccccctcat aa 2082

Claims

The method of 1.T cell-specific adaptor protein SLP-76 ubiquitin-like, it is characterised in that the following steps are included:

1) SLP-76-UBC9 fusion protein expression plasmid, is constructed:

The sequence for encoding SLP-76 albumen is inserted into the multiple cloning sites of pcDNA3-MCS-Ubc9 plasmid, to construct SLP- 76-UBC9 fusion expression plasmid；

Encode the sequence of SLP-76-UBC9 fusion protein are as follows:

ATGGCACTGAGGAATGTGCCCTTTCGCTCAGAGGTCCTGGGCTGGGACCCCGACAGCCTTGCTGACTATTTC AAGAAGCTCAACTATAAGGACTGTGAGAAGGCAGTGAAGAAGTACCACATCGATGGGGCTCGCTTCTTGAACCTGA CAGAAAATGACATCCAGAAGTTCCCCAAGCTCCGGGTGCCGATTCTCAGTAAGTTAAGTCAGGAAATCAACAAGAA CGAAGAGAGGAGGAGCATCTTCACACGCAAACCCCAAGTCCCGCGGTTTCCTGAAGAGACAGAAAGCCACGAAGAG GACAATGGGGGCTGGTCGTCCTTTGAAGAAGACGATTATGAAAGTCCCAATGATGACCAGGATGGGGAGGATGATG GAGACTATGAGTCCCCCAATGAGGAGGAAGAGGCACCCGTGGAAGATGACGCGGATTATGAGCCGCCACCCTCCAA TGACGAGGAAGCTCTGCAGAACTCCATCCTGCCTGCCAAGCCTTTCCCCAACTCCAACTCCATGTACATCGACCGG CCCCCCTCTGGGAAAACCCCCCAGCAGCCTCCTGTGCCCCCCCAGAGACCGATGGCCGCCCTCCCGCCCCCACCAG CCGGCCGGAATCACTCGCCACTGCCCCCACCCCAGACCAACCACGAAGAACCCAGCAGAAGCAGAAACCACAAAAC GGCAAAGCTCCCTGCTCCTTCAATAGACAGAAGCACGAAACCTCCCCTAGATCGTTCATTAGCTCCGTTTGATAGA GAACCCTTCACACTAGGAAAGAAACCACCATTTTCTGACAAGCCCTCGATTCCAGCGGGAAGGTCACTCGGGGAGC ATTTACCCAAGATTCAAAAGCCTCCTTTACCACCGACCACGGAAAGACATGAAAGGAGCAGCCCCCTGCCAGGGAA GAAGCCACCTGTGCCAAAGCATGGATGGGGACCAGACAGAAGAGAGAATGATGAAGATGATGTGCATCAGAGACCT TTGCCCCAGCCAGCACTACTTCCTATGAGCTCCAACACTTTCCCTTCAAGATCTACTAAGCCAAGTCCCATGAACC CTCTCCCATCCTCTCACATGCCTGGAGCATTCTCAGAAAGTAACAGCAGTTTTCCACAGAGTGCCTCCCTGCCACC ATACTTCTCTCAAGGCCCTAGCAACAGACCACCTATCAGAGCCGAAGGCAGAAACTTCCCCTTGCCACTTCCAAAC AAACCTCGGCCCCCATCCCCCGCGGAGGAAGAGAATTCATTAAATGAAGAGTGGTACGTTTCTTATATTACCCGAC CAGAGGCAGAAGCTGCTCTTAGAAAGATAAACCAGGATGGCACATTTCTGGTCAGAGACAGCTCTAAAAAAACAAC AACCAATCCATATGTCCTCATGGTGTTGTACAAAGATAAAGTTTACAACATCCAGATCCGTTATCAGAAGGAAAGT CAAGTTTACTTGTTGGGAACTGGACTCCGAGGGAAAGAGGACTTTCTGTCTGTGTCAGATATTATTGACTACTTCA GGAAAATGCCACTTCTGCTCATTGATGGGAAAAACCGAGGTTCCAGATACCAGTGCACATTAACGCATGCTGCAGG GTACCCACGAGGAGGATCGGGGATCGCCCTCAGCCGCCTTGCGCAGGAAAGGAAAGCCTGGAGGAAGGACCACCCT TTTGGCTTTGTAGCTGTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCTG GAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCCTCACC ACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCCTGTCCATCCTG GAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACAAGAACTTCTAAATGAAC CAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAACAGAGTGGAATATGAGAAAAGGGT CCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAA；

2) it, provides SLP-76 c-terminus and plasmid is transformed；

3), the resulting transformation plasmid of step 2) and SUMO1 expression plasmid are co-expressed into the cell in HEK 293T；Obtain SLP-76 Ubiquitin-likeization modifies albumen.
2. the method for the special adaptor protein SLP-76 ubiquitin-like of T cell according to claim 1, it is characterised in that:

In the step 1), in the 3 ' coded sequences of end continued access UBC9, to construct SLP-76-UBC9 fusion of SLP-76 sequence Expression plasmid.
3. the method for the special adaptor protein SLP-76 ubiquitin-like of T cell according to claim 1 or 2, it is characterised in that:

In the step 2), it is the UBC9 fusion that 438-516 amino acids are rejected on SLP-76 that plasmid, which is transformed, in SLP-76 c-terminus Protein expressing plasmid.
4. the method for the special adaptor protein SLP-76 ubiquitin-like of T cell according to claim 3, it is characterised in that:

The construction method of SLP-76 438-516 amino acids truncate are as follows: with SLP-76-UBC9 fusion protein obtained by step 1) Expression plasmid is template, and the special primer that design 438-516 amino acids are rejected uses quikchange^TMRite-directed mutagenesis reagent Box；

Special primer are as follows:

Delete538-516 forward primer 5 ' -3 ': GCTGCTCTTAGAAACCGAGGTTCCAGATACCAGTGCA

Delete538-516 reverse primer 5 ' -3 ': CCTCGGTTTCTAAGAGCAGCTTCTGCCTCTGGTCG.
The detection method of 5.T cell-specific adaptor protein SLP-76 ubiquitin-like, it is characterised in that the following steps are included:

One, prepare protein lysis buffer:

Prepare 1%triton-x-100 lysis buffer: 20mM Tris-HCl pH 8.0,50mM NaCl, 1%triton-x- 100,1%protease inhibitor, 20mM iodoacetamide；

Take cell 6x10 to be measured⁶The 1%triton-x-100 lysis buffer of 1 ± 0.1ml is added in cells；In placing 30 on ice ± 5 minutes, supernatant protein liquid was collected in centrifugation；

Two, with albumen polyacrylamide gel electrophoresis protein isolate, transferring film, be incubated for SUMO1 specifically antibody and label protein/ SLP-76 protein antibodies；Protein band position is matched, determines whether SLP-76 has occurred ubiquitin-likeization modification.
6. the detection method of the special adaptor protein SLP-76 ubiquitin-like of T cell according to claim 5, it is characterised in that In the step 2:

Occur moving up band above SLP-76 protein band, and the band can be simultaneously by SUMO1 antibody and label protein/SLP-76 Protein antibodies identification；Determine into SLP-76 and ubiquitin-likeization modification occurs；

Conversely, having no SLP-76 protein band above SLP-76 band；Or SUMO1 band is not overlapped with SLP-76 band, then Determining into SLP-76, there is no ubiquitin-likeization modifications.
7. the detection method of the special adaptor protein SLP-76 ubiquitin-like of T cell according to claim 6, feature exist In:

After with the incubation of SUMO1 specific antibody, SUMO1 protein band, and same film are observed in high molecular weight region It is incubated for SLP-76 protein antibodies after erasing and SLP-76 protein band, and the band and SUMO1 occurs above SLP-76 band When the condition that protein band is overlapped, determine that ubiquitin-likeization modification has had occurred at SLP-76；

Conversely, having no SLP-76 protein band above SLP-76 band；Or between 100kd-180kd SUMO1 band not with SLP-76 band is overlapped, then determines that there is no ubiquitin-likeization modifications at SLP-76.
8. the detection method of the special adaptor protein SLP-76 ubiquitin-like of T cell according to claim 6, feature exist In:

After with FLAG antibody incubation, SUMO1 protein band is observed in high molecular weight region, and incubate after same film erasing UBC9 protein antibodies are educated, above SLP-76 band, SLP-76 protein band, and the band and SUMO1 protein band weight occur When the condition of conjunction, determine that ubiquitin-likeization modification has had occurred at SLP-76；

Conversely, having no SLP-76 protein band above SLP-76 band；Or between 100kd-180kd SUMO1 band not with SLP-76 band is overlapped, then determines that there is no ubiquitin-likeization modifications at SLP-76.