CN113318222B - Application of superoxide dismutase in preparing medicine for treating psoriasis and method thereof - Google Patents
Application of superoxide dismutase in preparing medicine for treating psoriasis and method thereof Download PDFInfo
- Publication number
- CN113318222B CN113318222B CN202110798462.2A CN202110798462A CN113318222B CN 113318222 B CN113318222 B CN 113318222B CN 202110798462 A CN202110798462 A CN 202110798462A CN 113318222 B CN113318222 B CN 113318222B
- Authority
- CN
- China
- Prior art keywords
- superoxide dismutase
- psoriasis
- medicament
- treatment
- deionized water
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/44—Oxidoreductases (1)
- A61K38/446—Superoxide dismutase (1.15)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
- A61K47/10—Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
- A61K47/36—Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
- A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0014—Skin, i.e. galenical aspects of topical compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/08—Solutions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y115/00—Oxidoreductases acting on superoxide as acceptor (1.15)
- C12Y115/01—Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
- C12Y115/01001—Superoxide dismutase (1.15.1.1)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Inorganic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Dermatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to the technical field of application of enzyme preparations, and particularly relates to application of superoxide dismutase in preparing a medicament for treating psoriasis and an application method thereof. The superoxide dismutase is a protein amino acid sequence of the superoxide dismutase cloned from Geobacillus stearothermophilus, wherein aspartic acid at the 20 th position is mutated into glycine, and leucine at the 141 th position is mutated into asparagine; coupling and expressing a CPP sequence YGRKKRRQRRR on the HIV-1 peptide segment and superoxide dismutase, and endowing the HIV-1 peptide segment with membrane crossing capability; the CPP sequence is a Trans-activating transforming activator sequence. The invention has the beneficial effects that: (1) the key raw material superoxide dismutase adopted by the invention is essentially protein, has high safety and no side effect on human bodies; (2) the product of the invention has excellent use effect, and can cure intractable psoriasis after being sprayed for about half a month; (3) compared with expensive medicaments for treating psoriasis, the product of the invention has low cost.
Description
Technical Field
The invention belongs to the technical field of application of enzyme preparations, and particularly relates to application of superoxide dismutase in preparing a medicine for treating psoriasis, and an application method thereof.
Background
Psoriasis (psoriasis) is a chronic, refractory and easily relapsed immunological skin disease, has certain inheritance, is mainly characterized by erythema and plaques on the skin, is covered with silvery white scales, and can affect the skin of the whole body, and commonly comprises trunk, limbs, stretching surfaces and scalps. At present, no medicine capable of radically treating the diseases exists, and the disease condition can be relieved only by effectively controlling the disease condition development.
Clinically, the most used drugs are:
pyrooils, anthralin, corticosteroid hormones; onychomycosis, hydroxyurea, ethylimine and ethyldimorpholine;
in recent years, the abamectin A widely applied to psoriasis patients has larger side effects. In addition to the most common dry lips, the medicine also has influence on the liver, is easy to cause the increase of blood fat and cholesterol, can influence the growth and development of bones when taken by children, and has teratogenic effect when taken by pregnant women.
Among the above drugs, either the effect is not ideal or the side effect is large.
The inventor searches that most of the traditional Chinese medicines and western medicines disclosed in patent documents are used as the medicines for treating psoriasis.
CN111643669A discloses the use of glutaminase inhibitors for the preparation of a medicament for the treatment of psoriasis; CN111265529A discloses the application of protein tyrosine phosphatase SHP2 inhibitor in the preparation of psoriasis treating medicine; use of CN110787162A methylprednisolone as JNK2 kinase inhibitor and for treating psoriasis; the above documents are all enzyme inhibitors for use in the treatment of psoriasis; CN108653736A discloses an application of M2 pyruvate kinase as a drug target in preparing drugs for preventing and treating psoriasis.
There is no disclosure in the relevant literature regarding the use of superoxide dismutase in the treatment of psoriasis. Superoxide dismutase, a protein with antioxidant effect, is difficult to apply to the treatment of psoriasis according to the prediction of a person skilled in the art, and the inventor finds that common superoxide dismutase has no remarkable effect in the treatment of psoriasis through experiments.
Therefore, there is a need for the development of a drug having high safety and good therapeutic effects against the above-mentioned diseases.
Disclosure of Invention
In view of the psoriasis mentioned in the background art, no specific medicine exists at present, and although symptoms are temporarily relieved within a certain period of time after the use of hormone medicines, the side effect is large, so that the development of a specific medicine which is non-hormonal, non-toxic and can quickly relieve the symptoms is urgently needed. The superoxide dismutase provided by the invention is combined with other pharmaceutic adjuvants, so that the formed medicament has an ideal treatment effect and can effectively avoid side effects of hormone medicaments on a human body.
The superoxide dismutase mentioned in the invention is not a common superoxide dismutase, but a modified specific superoxide dismutase, and the method for obtaining the specific superoxide dismutase is specifically seen in the invention patent application with the application number of '2021107192568' filed by the applicant, namely a preparation method of the high-stability superoxide dismutase with the capability of crossing membranes;
the invention aims to provide an application of superoxide dismutase in preparing a medicament for treating psoriasis, which is an unexpected effect that the superoxide dismutase can achieve and cannot be achieved by common superoxide dismutase.
The superoxide dismutase provided by the invention is characterized in that: the superoxide dismutase is a protein amino acid sequence of the superoxide dismutase cloned from Geobacillus stearothermophilus, wherein the aspartic acid at the 20 th position is mutated into glycine, and the leucine at the 141 th position is mutated into asparagine; coupling and expressing a CPP sequence YGRKKRRQRRR with membrane crossing capability on the HIV-1 peptide segment and superoxide dismutase, and endowing the HIV-1 peptide segment with membrane crossing capability; the CPP sequence is a Trans-activating transforming activator sequence.
The medicine for treating psoriasis containing the superoxide dismutase is also within the protection scope of the invention. Namely, all medicaments which contain the superoxide dismutase and can be used for treating psoriasis are also within the protection scope of the invention.
The superoxide dismutase is matched with auxiliary materials and is jointly applied to the medicine for treating psoriasis, the auxiliary materials are at least one of a stabilizer, a preservative and a humectant, and other conventional medicinal auxiliary materials can be used, and the auxiliary materials are not limited to the above.
In the medicine for treating psoriasis, the mixture ratio of the raw materials is as follows:
superoxide dismutase solution 20000U/ml 60-300U/ml
0.5-2% of glycerin
0.2 to 1.0 percent of propylene glycol
0.05 to 1.0 percent of sodium hyaluronate
Trehalose 0.1-1.0%
2-20 mu g/ml of myristoyl hexapeptide
0.06% -0.2% of potassium sorbate
The balance being sterile deionized water.
Preferably, in the medicine for treating psoriasis, the mixture ratio of the raw materials is as follows:
superoxide dismutase solution 20000U/ml 60-300U/ml
1% of glycerol
0.5 percent of propylene glycol
0.25 percent of sodium hyaluronate
Trehalose 0.3%
Myristoyl hexapeptide 7.5. mu.g/ml
0.1 percent of potassium sorbate
The balance being sterile deionized water.
The preparation method of the medicine for treating psoriasis comprises the following steps:
(1) preparing 2 × aqueous phase matrix component: adding glycerol and propylene glycol into deionized water sterilized at 115-125 deg.C for 12-20 min to make their concentrations respectively be 2.0% and 1.0%, and recording as "A";
(2) preparing 10 multiplied sodium hyaluronate components: dissolving sodium hyaluronate in deionized water sterilized at 115-125 ℃ for 12-20 minutes to make the concentration of sodium hyaluronate be 2.5%, filtering with 0.45uM microporous filter membrane, and recording as 'B';
(3) preparing 100 times of potassium sorbate component: dissolving potassium sorbate in deionized water sterilized at 115-125 ℃ for 12-20 minutes to a final concentration of 10%, and filtering with 0.45uM microporous membrane, denoted as "C";
(4) preparation of 200 × myristoyl hexapeptide fraction: dissolving myristoyl hexapeptide in deionized water sterilized at 115-125 deg.C for 12-20 min to a final concentration of 1mg/ml, and recording as "D";
(5) 10000U/ml of high-stability superoxide dismutase solution mother liquor after being filtered by a 0.22 uM microporous membrane, and the component is marked as a component E;
(6) in a sterile environment, taking formulation 1L as an example, the components were mixed according to the following volumes:
A 500 ml
C 10 ml
D 7.5 ml
E 10 ml
372.5 ml of sterile deionized water;
and (3) fully mixing the mixed liquid in an ATS high-pressure homogenizer at the pressure of 200-500 ba, and performing aseptic filling and normal-temperature storage.
The density of the medicine for treating psoriasis is about 1.02g/ml through detection.
The application method of the medicine for treating psoriasis is as follows: the medicine for treating psoriasis is sprayed on the affected part, and is lightly smeared to be absorbed, 2-3 times daily.
The invention has the beneficial effects that:
(1) the superoxide dismutase provided by the invention is essentially a protein, has high safety and no side effect on human bodies;
(2) the product of the invention has excellent use effect, and can cure intractable psoriasis after being sprayed for about half a month; the inventor verifies the mechanism of acting on psoriasis and verifies the effectiveness of the superoxide dismutase through experiments of inhibiting the hyperproliferation of skin keratinocyte Hacat, inhibiting the cell cycle of the keratinocyte, reducing the degree of skin keratinization and the like;
(3) the product of the invention has low cost compared with expensive medicaments for treating psoriasis.
Drawings
Figure 1 is a state diagram of a leg psoriasis affected area taken the day before patient treatment in a clinical application;
FIG. 2 is a state diagram of the psoriasis affected area of the legs taken on the first day of treatment (12 hours after spraying) of the patient of FIG. 1;
FIG. 3 is a state diagram of the psoriasis affected area of the leg taken on the sixth day of treatment of the patient of FIG. 1;
fig. 4 is a state diagram of leg psoriasis affected areas taken on the sixteenth day of treatment;
FIG. 5 is a comparative graph of the present invention for inhibiting the hyperproliferation of skin keratinocytes Hacat;
FIG. 6 is a comparative graph of the cell cycle of the present invention for inhibiting Hacat of skin keratinocytes;
FIG. 7 is a comparative graph of the present invention for reducing skin keratinization;
fig. 8 is a picture of the effect of common superoxide dismutase on psoriasis treatment.
Detailed Description
In order to further illustrate the present invention, the present invention will be described in detail by way of specific examples, which are not intended to limit the present invention thereto.
Example 1
The preparation method of the medicine for treating psoriasis comprises the following specific steps:
(1) preparing 2 × aqueous phase matrix component: adding glycerol and propylene glycol to deionized water sterilized at 121 deg.C for 15 min to make their concentrations respectively 2.0% and 1.0%, and recording as "A";
(2) preparing 10 multiplied sodium hyaluronate components: dissolving sodium hyaluronate in deionized water sterilized at 121 deg.C for 15 min to make its concentration be 2.5%, filtering with 0.45uM microporous membrane, and recording as "B";
(3) preparing 100 times of potassium sorbate component: dissolving potassium sorbate in deionized water sterilized at 121 deg.C for 15 min to a final concentration of 10%, and filtering with 0.45uM microporous membrane, denoted as "C";
(4) preparation of 200 × myristoyl hexapeptide fraction: myristoyl hexapeptide was dissolved in deionized water sterilized at 121 ℃ for 15 minutes to a final concentration of 1mg/ml, designated "D";
(5) 10000U/ml of a high-stability superoxide dismutase solution mother liquor which is obtained after filtration by using a 0.22 uM microporous membrane and is marked as 'E';
(6) in a sterile environment, taking formulation 1L as an example, the components were mixed according to the following volumes:
A 500 ml
C 10 ml
D 7.5 ml
E 10 ml
372.5 ml of sterile deionized water;
and (3) fully mixing the mixed liquid in an ATS high-pressure homogenizer at the pressure of 200-500 ba, and carrying out sterile filling, and storing and using at normal temperature.
Through detection, the density of the medicine for treating psoriasis prepared by the method is as follows: about 1.02 g/ml.
The method for obtaining the high-stability superoxide dismutase in example 1 is specifically described in the patent application filed by the applicant under the name of '2021107192568' entitled 'method for preparing high-stability superoxide dismutase with membrane crossing ability';
the method comprises the following steps:
(1) the RNA of Geobacillus stearothermophilus is extracted by an RNA extraction kit (purchased from Tiangen biochemistry), then cDNA of the microorganism is synthesized by a reverse transcription kit (purchased from Tiangen biochemistry), and then specific primers (the primer sequences are as follows) are designed and optimized according to restriction endonuclease sites, and the sequence of the specific primers for coding superoxide dismutase is obtained.
An upstream primer sequence for the superoxide dismutase fishing:
5’-CATATGCCCTTTGAACTACCAGCAT-3’
the downstream primer sequence of superoxide dismutase fishing:
5’- AAGCTTCTTCGCTTTCGCCTCGCTG -3’；
(2) selecting a pET30a vector (purchased from Youbao organisms) as an expression vector, carrying out double enzyme digestion on an amplified sequence and the vector by HindIII and NdeI (purchased from ABClonal), recovering an enzyme digestion product by using a DNA gel recovery kit (purchased from Tiangen biochemistry), and recovering the double enzyme digestion product according to DNA fragments: plasmid =2:1 (molar ratio) optimized, ligated with DNA ligase at 16 ℃ for 12 hours (optimized ligation conditions), the ligated linker was transformed into competent E.coli engineering bacterium E.coli BL21(DE3) by a 42 ℃ heat shock method, the transformed engineering bacterium was spread on LB resistant plates containing 50ug/ml kanamycin, and cultured at 37 ℃ for 18-26 hours. After the monoclone is formed, a colony PCR mode (colony PCR primer is shown as the following sequence) is adopted to verify the clone;
(3) selecting a monoclonal with correct verification, and carrying out expression verification under the following expression conditions: the monoclonal colonies were inoculated into 5ml of LB liquid medium (medium containing 50ug/ml kanamycin), and when the OD600 value reached 0.7, IPTG was added to a final concentration of 0.5mM, and induction was carried out at various temperatures (16 ℃ C., 37 ℃ C., preferred representative). After induction, the cells were collected and subjected to ultrasonic lysis (ultrasonic volume 1mL, ultrasonic conditions of 2 seconds for 3 seconds, total ultrasonic time 10 minutes).
(4) Improving the stability of superoxide dismutase
The 20 th aspartic acid is mutated into glycine, and the 141 th leucine is mutated into asparagine, so as to improve the thermal stability of the enzyme.
Example 2
The preparation method of the medicine for treating psoriasis comprises the following steps:
(1) preparing 2 × aqueous phase matrix component: adding glycerol and propylene glycol to deionized water sterilized at 115 deg.C for 20 min to make their concentrations respectively 2.0% and 1.0%, and recording as "A";
(2) preparing 10 multiplied sodium hyaluronate components: dissolving sodium hyaluronate in deionized water sterilized at 115 deg.C for 20 min to make its concentration be 2.5%, filtering with 0.45uM microporous membrane, and recording as "B";
(3) preparing 100 × potassium sorbate component: dissolving potassium sorbate in deionized water sterilized at 115 deg.C for 20 min to a final concentration of 10%, and filtering with 0.45uM microporous membrane, denoted as "C";
(4) preparation of 200 × myristoyl hexapeptide fraction: the myristoyl hexapeptide was dissolved in deionized water sterilized at 115 ℃ for 20 minutes to a final concentration of 1mg/ml, designated "D";
(5) 10000U/ml of a high-stability superoxide dismutase solution mother liquor which is obtained after filtration by using a 0.22 uM microporous membrane and is marked as 'E';
(6) in a sterile environment, taking formulation 1L as an example, the components were mixed according to the following volumes:
A 500 ml
C 10 ml
D 7.5 ml
E 10 ml
372.5 ml of sterile deionized water;
and (3) fully mixing the mixed liquid in an ATS high-pressure homogenizer at the pressure of 200-500 ba, carrying out sterile filling, and storing and using at normal temperature.
Example 3
The preparation method of the medicine for treating psoriasis comprises the following steps:
(1) preparing 2 × aqueous phase matrix component: adding glycerol and propylene glycol into deionized water sterilized at 125 deg.C for 12 min to make their concentrations respectively 2.0% and 1.0%, and recording the component as "component A";
(2) preparing 10 multiplied sodium hyaluronate components: dissolving sodium hyaluronate in deionized water sterilized at 125 deg.C for 12 min to make the concentration of sodium hyaluronate be 2.5%, and filtering with 0.45uM microporous membrane to obtain component B;
(3) preparing 100 times of potassium sorbate component: dissolving potassium sorbate in deionized water sterilized at 125 deg.C for 12 min to give a final concentration of 10%, and filtering with 0.45uM microporous membrane to give a filtrate, which is designated as "fraction C";
(4) preparation of 200 × myristoyl hexapeptide fraction: the myristoyl hexapeptide was dissolved in deionized water sterilized at 125 ℃ for 12 minutes to a final concentration of 1mg/ml, and this fraction was designated as "fraction D";
(5) 10000U/ml of high-stability superoxide dismutase solution mother liquor after being filtered by a 0.22 uM microporous membrane, and the component is marked as a component E;
(6) in a sterile environment, taking formulation 1L as an example, the components were mixed according to the following volumes:
A 500 ml
C 10 ml
D 7.5 ml
E 10 ml
372.5 ml of sterile deionized water;
and (3) fully mixing the mixed liquid in an ATS high-pressure homogenizer at the pressure of 200-500 ba, carrying out sterile filling, and storing and using at normal temperature.
Example 4
The using method comprises the following steps: the medicine for treating psoriasis in example 1 is sprayed on the affected part, and the medicine is lightly smeared to be absorbed 2-3 times daily.
Patients (Guangzhou) had psoriasis for 2 years, and various treatments were ineffective. Other drugs were stopped during use of the invention. The patient has obvious improvement 6 days after using the invention as stated, and the patient is almost cured after half a month. As shown in fig. 1-4, it can be seen from fig. 1 that prior to treatment, the patient had severe erythema in the leg;
after the medicine is taken for 12 hours, a scabbing phenomenon begins to occur on a part of the erythema, and the wound on the erythema is gradually healed.
After the medicine is taken for 6 days, the skin of the leg of a patient is obviously improved, the color of red spots becomes light, and the healing state is presented at a plurality of places;
after 16 days of administration, the leg skin erythema of the patient is lightened, and the skin is gradually transformed to normal skin. Can be regarded as a basic cure.
Example 5
FIG. 5 shows that the epidermal growth cells of psoriasis patients often show hyperproliferation. The present inventors investigated the effects of the drug of the present invention using skin keratinocytes as a cell model. As can be seen in fig. 5:
in cell experiments, the medicine provided by the invention can effectively inhibit the hyperproliferation of the skin keratinocyte Hacat.
The control group was a placebo with the same dose of purified water. To compare and judge the effects of the invention. In fig. 5, 6, and 7, the control group was the same dose of purified water as placebo.
The left image in FIG. 5 is a cell morphology of the cells treated for 72 hours in the present invention and control groups. The Hacat cell line was purchased from Wuhan Populoise. The right graph in FIG. 5 shows the relative cell viability values of the control and the present invention after 72 hours of treatment. Cell viability was quantified by the CCK8 method (CCk 8 kit from east Japanese Kernel).
As can be seen in fig. 6: in the cell model, the invention can inhibit the cell cycle of the skin keratinocyte Hacat. The right panel shows the results of cell cycle measurements after 72 hours of treatment of cells with the drug of the invention. Compared with a control group, the medicine disclosed by the invention can reduce the S phase and the G2 phase, and the effect of inhibiting the cell cycle of keratinocytes is shown, so that the medicine has an important effect on blocking the attack of psoriasis and preventing the psoriasis from further aggravating.
FIG. 7 shows the phenomenon of hyperkeratinization of epidermal forming cells in patients with psoriasis, wherein Keratin 6 is a Marker for skin keratinization. Fig. 7 shows that the drug of the present invention can significantly reduce the expression of Keratin 6 in skin keratinocytes, i.e., the present invention can reduce the degree of skin keratinization, thereby inhibiting psoriasis. The inventor analyzes that one of the reasons for psoriasis is the increase of the degree of skin keratinization, which leads to the aggravation and the prolongation of the course of disease.
FIG. 8 is a comparative experiment conducted by the present inventors, mainly comparing whether the common superoxide dismutase also has the effect of treating psoriasis;
after preparing the same formulation as in example 1, the common superoxide dismutase was frequently used 3 times a day in the same amount as in example 1.
The results show that: the effect of the product obtained by using the common superoxide dismutase as the main raw material on the psoriasis is far less than that of the product obtained by using the common superoxide dismutase as the main raw material, and the effect of the product obtained by using the common superoxide dismutase as the main raw material is more obvious after 6 days of use, so that the effect of the product obtained by using the common superoxide dismutase as the main raw material is not required to be compared for a longer time. This indicates that the drug of the present invention, since aspartic acid at position 20 is mutated into glycine and leucine at position 141 is mutated into asparagine; the CPP sequence YGRKKRRQRRR with membrane crossing ability on the HIV-1 peptide segment is coupled and expressed with superoxide dismutase, so that the psoriasis-treating effect is endowed, which cannot be achieved by common superoxide dismutase.
Through the comparison, the formula of the invention achieves unexpected technical effects, and provides a milder, safer and more effective mode for preventing and treating psoriasis when being applied to the medicine for treating psoriasis.
Claims (7)
1. The application of the superoxide dismutase in preparing the medicine for treating psoriasis is characterized in that the superoxide dismutase is obtained by mutating aspartic acid at the 20 th position of a protein amino acid sequence of the superoxide dismutase cloned from Geobacillus stearothermophilus into glycine, mutating leucine at the 141 th position into asparagine, and then carrying out coupling expression with a CPP sequence YGRKKRRQRRR on an HIV-1 peptide segment;
the method for obtaining the coding sequence of the superoxide dismutase cloned from the Geobacillus stearothermophilus comprises the following steps of extracting RNA of the Geobacillus stearothermophilus by using an RNA extraction kit, synthesizing cDNA by using a reverse transcription kit, optimizing a specific primer according to a restriction endonuclease site, and fishing a sequence of the coding superoxide dismutase, wherein a primer pair for fishing the sequence of the coding superoxide dismutase is as follows:
5’-CATATGCCCTTTGAACTACCAGCAT-3’
5’- AAGCTTCTTCGCTTTCGCCTCGCTG -3’。
2. a psoriasis treatment medicament comprising the superoxide dismutase of claim 1.
3. The application of the superoxide dismutase in preparing the medicine for treating psoriasis according to claim 1, wherein the superoxide dismutase is matched with an auxiliary material and is commonly applied in the medicine for treating psoriasis, and the auxiliary material is at least one of a stabilizer, a flavoring agent, a preservative, a humectant and an antibacterial agent.
4. The use of the superoxide dismutase in the preparation of a medicament for the treatment of psoriasis according to claim 1 wherein the ratio of the raw materials in the medicament for the treatment of psoriasis is as follows:
superoxide dismutase solution 20000U/ml 60-300U/ml
0.5-2% of glycerin
0.2 to 1.0 percent of propylene glycol
0.05 to 1.0 percent of sodium hyaluronate
Trehalose 0.1-1.0%
Myristicacylhexapeptide 2-20. mu.g/ml
0.06% -0.2% of potassium sorbate
The balance being sterile deionized water.
5. The use of the superoxide dismutase in the preparation of a medicament for the treatment of psoriasis according to claim 1 wherein the ratio of the raw materials in the medicament for the treatment of psoriasis is as follows:
superoxide dismutase solution 20000U/ml 60-300U/ml
1% of glycerol
0.5 percent of propylene glycol
0.25 percent of sodium hyaluronate
Trehalose 0.3%
Myristoyl hexapeptide 7.5. mu.g/ml
0.1 percent of potassium sorbate
The balance being sterile deionized water.
6. The use of superoxide dismutase in the manufacture of a medicament for the treatment of psoriasis as claimed in claim 1 wherein the medicament for the treatment of psoriasis is manufactured by the method comprising:
(1) preparing 2 × aqueous phase matrix component: adding glycerol and propylene glycol into deionized water sterilized at 115-125 deg.C for 12-20 min to make their concentrations respectively be 2.0% and 1.0%, and recording as "A";
(2) preparing 10 multiplied sodium hyaluronate components: dissolving sodium hyaluronate in deionized water sterilized at 115-125 ℃ for 12-20 minutes to make the concentration of sodium hyaluronate be 2.5%, filtering with 0.45uM microporous filter membrane, and recording as 'B';
(3) preparing 100 times of potassium sorbate component: dissolving potassium sorbate in deionized water sterilized at 115-125 ℃ for 12-20 minutes to a final concentration of 10%, and filtering with 0.45uM microporous membrane, denoted as "C";
(4) formulation of 200 × myristoyl hexapeptide component: dissolving myristoyl hexapeptide in deionized water sterilized at 115-125 deg.C for 12-20 min to a final concentration of 1mg/ml, and recording as "D";
(5) 10000U/ml of a high-stability superoxide dismutase solution mother liquor filtered by a 0.22 uM microporous filter membrane and is marked as 'E';
(6) in a sterile environment, taking formulation 1L as an example, the components were mixed according to the following volumes:
A 500 ml
B 100 ml
C 10 ml
D 7.5 ml
E 10 ml
372.5 ml of sterile deionized water;
and (3) fully mixing the mixed liquid in an ATS high-pressure homogenizer at the pressure of 200-500 ba, and performing aseptic filling and normal-temperature storage.
7. The use of superoxide dismutase in the manufacture of a medicament for the treatment of psoriasis as claimed in claim 6 wherein the psoriasis treatment medicament has a density of 1.02 g/ml.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110798462.2A CN113318222B (en) | 2021-07-15 | 2021-07-15 | Application of superoxide dismutase in preparing medicine for treating psoriasis and method thereof |
| AU2022204563A AU2022204563B2 (en) | 2021-07-15 | 2022-06-28 | Application and method of superoxide dismutase in preparing medicine for treating psoriasis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110798462.2A CN113318222B (en) | 2021-07-15 | 2021-07-15 | Application of superoxide dismutase in preparing medicine for treating psoriasis and method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113318222A CN113318222A (en) | 2021-08-31 |
| CN113318222B true CN113318222B (en) | 2022-05-06 |
Family
ID=77426534
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110798462.2A Active CN113318222B (en) | 2021-07-15 | 2021-07-15 | Application of superoxide dismutase in preparing medicine for treating psoriasis and method thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113318222B (en) |
| AU (1) | AU2022204563B2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117338823A (en) * | 2023-12-06 | 2024-01-05 | 山东百德生物科技有限公司 | Animal ferment fermentation broth and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6011067A (en) * | 1999-06-11 | 2000-01-04 | Thione International, Inc. | Antioxidant composition for the treatment of psoriasis and related diseases |
| WO2010004367A1 (en) * | 2008-07-10 | 2010-01-14 | Life Science Investments Ltd | Use of a mixture of superoxide dismutase and catalase for treating pruritus and alleviating its symptoms |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2585471A1 (en) * | 2004-11-01 | 2006-05-11 | Seo Hong Yoo | Methods and compositions for reducing neurodegeneration in amyotrophic lateral sclerosis |
-
2021
- 2021-07-15 CN CN202110798462.2A patent/CN113318222B/en active Active
-
2022
- 2022-06-28 AU AU2022204563A patent/AU2022204563B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6011067A (en) * | 1999-06-11 | 2000-01-04 | Thione International, Inc. | Antioxidant composition for the treatment of psoriasis and related diseases |
| WO2010004367A1 (en) * | 2008-07-10 | 2010-01-14 | Life Science Investments Ltd | Use of a mixture of superoxide dismutase and catalase for treating pruritus and alleviating its symptoms |
Non-Patent Citations (2)
| Title |
|---|
| 银屑病患者LPO MDA SOD GSH-Px及TNF水平测定;彭立义等;《中国皮肤性病学杂志》;19981220(第06期);第340-341页 * |
| 银屑病患者抗氧化酶、脂质过氧化物及肿瘤坏死因子测定的意义;彭立义等;《前卫医药杂志》;19971020(第05期);第287-288页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2022204563A1 (en) | 2023-02-02 |
| AU2022204563B2 (en) | 2024-03-14 |
| CN113318222A (en) | 2021-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2471867C2 (en) | Hyaluronidase and method for using it | |
| WO2012126344A1 (en) | Method for physical modification of cobra venom and application thereof in preparation of analgesic and immune suppressing drugs | |
| WO2019228307A1 (en) | New pharmaceutical use | |
| CN113318222B (en) | Application of superoxide dismutase in preparing medicine for treating psoriasis and method thereof | |
| US8956605B2 (en) | Prevention and/or treatment of multiple organ dysfunction syndrome with interleukin-22 | |
| WO2021047648A1 (en) | New peptides | |
| AU2021302188A1 (en) | Polypeptide for repairing mucosal damage or skin wound and use thereof | |
| TWI496579B (en) | Uses of zinc finger-like peptide, expression plasmid thereof, and pharmaceutical compositions containing the same | |
| CN102846666A (en) | Application of physically-modified Chinese cobra venom in preparation of medicament for treating acute and chronic nephrosis | |
| KR100302994B1 (en) | New application as a medicament for multipotent Parapox immunogenic factors from attenuated non-immunogenic Foxvirus or Parapoxvirus | |
| WO2017181978A1 (en) | Mussel adhesive protein product and use of same for inhibiting vascular inflammation | |
| JPH05320055A (en) | Allergy therapeutic agent | |
| JP2020531586A (en) | Methods and compositions for antiviral applications of synthetic lysine analogs and mimetics | |
| US10071137B2 (en) | Method for decreasing mortality associated with chronic liver disease by use of long-acting human recombinant soluble tumor necrosis factor α receptor | |
| EP0076818A1 (en) | Peptides with nerve-regenerating properties | |
| WO2020149282A1 (en) | Use of omiganan in the treatment of rosacea | |
| NL2027924B1 (en) | Antimicrobial peptide for prevention and treatment of virusinfections | |
| CN111494604A (en) | Application of blue algae antiviral protein N in preparation of anti-inflammatory drugs | |
| US20230277650A1 (en) | Use of a birnavirus for the treatment of a disease caused by varicella zoster virus (vzv) | |
| CN114621323B (en) | Polypeptide compound with skin repairing effect and preparation method and application thereof | |
| WO2017088177A1 (en) | Mussel adhesive protein product, and use thereof in preventing and suppressing neuronal inflammation | |
| JPS6111A (en) | Remedy for demyelinating disease | |
| KR101671484B1 (en) | Pharmaceutical composition containing oseltamivir for treating human papiloma virus | |
| CN117562980A (en) | Application of I-C-F-6 product in preventing and treating brain diseases | |
| CN111214649A (en) | Application of BM23 peptide in preparing medicine for treating ischemic cerebrovascular disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230110 Address after: 510168 No. 6, Chuangjia Road, Baiyun District, Guangzhou, Guangdong Province Patentee after: Guangzhou Yanzhan Technology Co.,Ltd. Address before: 272067 No. 133, Hehua Road, taibaihu new area, Rencheng District, Jining City, Shandong Province Patentee before: JINING MEDICAL University |
|
| TR01 | Transfer of patent right |