AU2022204563B2

AU2022204563B2 - Application and method of superoxide dismutase in preparing medicine for treating psoriasis

Info

Publication number: AU2022204563B2
Application number: AU2022204563A
Authority: AU
Inventors: Yong Xia
Original assignee: Univ Jining Medical
Current assignee: JINING MEDICAL UNIVERSITY
Priority date: 2021-07-15
Filing date: 2022-06-28
Publication date: 2024-03-14
Anticipated expiration: 2042-06-28
Also published as: CN113318222A; AU2022204563A1; CN113318222B

Abstract

The invention belongs to the technical field of application of enzyme preparations, in particular to the application and application method of superoxide dismutase in the preparation of medicines for treating psoriasis. The superoxide dismutase of the present appication is that in the protein amino acid sequence of superoxide dismutase cloned from Geobacillus stearothermophilus, the 20th Aspartic acid is mutated to Glycine, and the 141st Leucine is mutated to Asparagine; coupling and expressing the CPP sequence YGRKKRRQRRR on the HIV-1 peptide segment with superoxide dismutase, giving it the the transmembrane capacity; the CPP sequence is a trans-activating transcriptional activator sequence. The beneficial effects of the present application are: (1) the key raw material superoxide dismutase used in the present application is essentially a protein, with high safety and no side effects on the human body; (2) the product of the present application has excellent use effect, Stubborn psoriasis can be cured after spraying for about half a month; (3) compared with expensive medicines for treating psoriasis, the cost of the product of the present application is low.

Description

APPLICATION AND METHOD OF SUPEROXIDE DISMUTASE IN THE PREPARATION OF A MEDICAMENT FOR TREATING PSORIASIS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This is a patent application which claims the priority and benefit of Chinese Patent Application Number 202110798462.2, filed on July 07, 2021, the disclosure of which is incorporated herein by reference in its entirety.

TECHNICAL FIELD

[0002] The present application belongs to the technical field of application of enzyme preparations, particularly relating to an application or use of superoxide dismutase in the preparation of a medicament for treating psoriasis, methods of application thereof.

BACKGROUND

[0003] Psoriasis is a chronic, refractory, and easily recurring immune skin disease. It has a certain genetic predisposition that manifests as skin erythema and plaque, covered with silvery-white scales, which that can affect the whole body including the trunk, extremities, and scalp. At present, there is no cure for the disease, but can only be alleviated by effectively controlling the progression of the disease.

[0004] The most commonly used medicines in clinical practice are tar, anthralin, corticosteroids, methotrexate, hydroxyurea, ethyleneimine, ethyldimorpholine.

[0005] Acitretin, which has been widely used in psoriasis patients in recent years, has relatively large side effects. In addition to the most common cause of dry lips, it also affects the liver, which can easily lead to increased blood lipids and cholesterol. It can also affect bone growth and development when taken by children and has a teratogenic effect when used by pregnant women.

[0006] These medicines are either not very effective or have serious side effects.

[0007] Through searching patent literatures, the inventors found prior art documents that disclose

Chinese medicines and western medicines being used as medicines for the treatment of psoriasis.

[0008] CN111643669A discloses the application of a glutaminase inhibitor in the preparation of a medicine for treating psoriasis; CN111265529A discloses the application of protein tyrosine phosphatase SHP2 inhibitor in preparing medicine for treating psoriasis; CN110787162A discloses the use of methyl berberine as a JNK2 kinase inhibitor and in the treatment of psoriasis; the above mentioned documents are all enzyme inhibitors used in the treatment of psoriasis; CN108653736A discloses the application of M2-type pyruvate kinase as a drug target in the preparation of a drug for preventing and treating psoriasis.

[0009] In light of the prior art documents found, it appears that there is no relevant literature disclosure about the use of superoxide dismutase in the treatment of psoriasis. Superoxide dismutase, as a protein with antioxidant effect, is difficult to apply in the treatment of psoriasis according to the prediction of those skilled in the art, and it was further found through experiments superoxide dismutase not provided any significant effect in the treatment of psoriasishas.

[0010] Therefore, for the above-mentioned conditions, there is a need to develop a medicine or a drug with high safety and high therapeutic efficacy.

SUMMARY OF THE APPLICATION

[0011] In view of the fact that there is no effective drug or medicament for psoriasis mentioned in the background art at present, and many patients use hormonal drugs or therapy which temporarily relieve the symptoms but are accompanied with serious side effects are, there is an urgent need to develop a non-hormonal, non-toxic, and effective medicine that can quickly relieve the above mentioned symptoms. The superoxide dismutase provided by the present application, when combined with other pharmaceutical excipients, results in a medicine with ideal or high therapeutic effect when used for treatment, and can effectively avoid the side effects of hormonal medicines on the human body.

[0012] The superoxide dismutase mentioned in the present application is not an ordinary superoxide dismutase, but a modified specific superoxide dismutase. and the method for obtaining the above mentioned specific superoxide dismutase was described in the patent application number "2021107192568" and having the title "Preparation method of superoxide dismutase with transmembrane capacity and high stability".

[0013] The objective of present invention is to provide a use of superoxide dismutase in the preparation of a medicament for treating psoriasis. The above-mentioned superoxide dismutase of the present invention provides an unexpected effect that cannot be achieved by ordinary superoxide dismutase.

[0014] The characteristics of the superoxide dismutase provided by the present invention is characterized by the following: the superoxide dismutase is a protein having an amino acid (aa) sequence that is cloned from Geobacillus stearothermophilus, wherein the aspartic acid at aa position 20 was mutated to glycine, and the leucine at position 141 was mutated to asparagine; a CPP having a sequence of YGRKKRRQRRR, which has a transmembrane capacity on the HIV-1 peptide, was co-expressed with the superoxide dismutase, conferring said transmembrane capacity to the superoxide dismutase; said CPP sequence is a trans-activating transcriptional activator sequence.

[0015] In one embodiment of the present invention, a medicament for treating psoriasis comprising superoxide dismutase is provided. Particularly, all medicament or pharmaceutical composition comprising said superoxide dismutase for use in the treatment of psoriasis is provided in the present invention.

[0016] The superoxide dismutase of the present invention was used in combination with excipients for use in the treatment of psoriasis. Said excipients include at least one stabilizer, at least one flavor enhancer, at least one preservative, at least one moisturizing agent, and at least one antibacterial agent. Said excipients may further be comprising of other conventional pharmaceutical excipients not limited to the above-mentioned excipients.

[0017] In the medicament for the treatment of psoriasis, the proportions/ratio of the raw materials are as follows: - Superoxide dismutase solution 20000U/ml 60-30OU/ml - Glycerin 0.5-2% - Propylene glycol 0.2-1.0% - Sodium Hyaluronate 0.05-1.0% - Trehalose 0.1-1.0%

- Myristoyl Hexapeptide 2-20[tg/ml - Potassium Sorbate 0.06%-0.2% - the balance is sterile deionized water.

[0018] Preferably, in the above-mentioned medicament for the treatment of psoriasis, the proportions of each raw material are as follows: - Superoxide dismutase solution 20000U/ml 60-300U/ml - Glycerin 1% - Propylene glycol 0.5% - Sodium Hyaluronate 0.25% - Trehalose 0.3% - Myristoyl Hexapeptide 7.5[tg/ml - Potassium Sorbate 0.1% - the balance is sterile deionized water.

[0019] The preparation method for the medicament for treating psoriasis is as follows: 1) Preparation of 2x aqueous matrix components: sterilizing deionized water at 115-125°C for 12-20 minutes, adding glycerol and propylene glycol to said sterilized and deionized water to make their concentrations 2.0% w/v and 1.0% w/v respectively, designated as "A" ; 2) Preparation of 1Ox sodium hyaluronate component: dissolving sodium hyaluronate in deionized water, said deionized water was sterilized at 115-125°C for 12-20 minutes, to make a sodium hyaluronate solution having a concentration of 2.5% w/v, filtering said solution with 0.45[tm microporous filter membrane to obtain a filtrate designated as "B"; 3) Preparation of 100x potassium sorbate component: dissolving potassium sorbate in deionized

water, said deionized water was sterilized at 115-125°C for 12-20 minutes, to make a potassium sorbate solution having a final concentration of 10% w/v, filtering said solution with 0.45uM microporous filter membrane to obtain a filtrate designated as "C"; 4) Preparation of 200x myristoyl hexapeptide component: dissolving myristoyl hexapeptide in

deionized water, said deionized water was sterilized at 115-125°C for 12-20 minutes, to make a myristoyl hexapeptide solution having a final concentration of 1 mg/ml, designated as "D"; ) Filtering a 10,000 U/ml mother solution of highly stable superoxide dismutase solution with 0.22 uM microporous filter membrane to obtain a filtrate designated as "E"; 6) In an example provided, a 1 L preparation of the medicament comprising superoxide dismutase was prepared aseptically using the prepared components according to the following volumes:

A: 500 ml B: 100 ml C: 10 ml D: 7.5 ml E: 10 ml Sterile deionized water 372.5 ml; The above-mentioned components were thoroughly mixed in an ATS high pressure homogenizer under the pressure of 200-500 bar to obtain a homogenized preparation that was aseptically filled into a container, and stored at room temperature.

[0020] After testing, the density of the prepared medicament (homogenized preparation) for treating psoriasis is 1.02 g/ml.

[0021] The method or use of a medicament for treating psoriasis is as follows: spraying a medicament for treating psoriasis on the affected area, and gently applying said medicament to allow absorption, for 2-3 times a day.

[0022] The beneficial effects of the present application are: (1) The superoxide dismutase provided by the present invention is essentially a protein, is safe and has no side effects on the human body; 2) The product of a medicament of the present invention provides effective use, and the chronic psoriasis can be treated by spraying for about half a month; The present invention has verified the mechanism of superoxide dismutase on psoriasis through experiments such as the above-mentioned superoxide dismutase inhibiting the excessive proliferation of skin keratinocytes or skin kerating forming cells HaCaT, inhibiting the cell cycle of keratinocytes, and reducing the degree of skin keratinization, thereby confirming its effectiveness. 3) The product of the present application has low cost compared with expensive medicines for treating psoriasis.

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Fig. 1 provides a photograph of a psoriasis-infected area on a leg, as captured one day before a patient's treatment in clinical application;

[0024] Fig. 2 provides a photograph of a psoriasis-infected area on a leg, as captured on the first day of treatment (12 hours after spraying) of the patient in Figure 1;

[0025] Fig. 3 provides a photograph of a psoriasis-infected area on a leg as captured on the sixth day of treatment of the patient in Figure 1;

[0026] Fig. 4 provides a photograph of a psoriasis-infected area on a leg as captured on the sixteenth day of treatment;

[0027] Fig. 5 shows a comparative graph showing that the medicament of the present invention inhibits the excessive proliferation of skin keratinocyte/skin kerating-forming cells Hacat;

[0028] Fig. 6 shows a comparative graph showing that the medicament of the present invention inhibits the cell cycle of skin keratinocyte Hacat;

[0029] FIG. 7 shows a comparative diagram wherein the present inventionreducing skin keratinization according to the present application;

[0030] FIG. 8 provides a photograph of the effect of ordinary/common superoxide dismutase on the treatment of psoriasis.

DETAILED DESCRIPTION

[0031] In order to further illustrate the present application, the present application will be described in detail with specific embodiments, but the present application is not limited thereto.

Example 1

[0032] In an example, a method for the preparation of a medicament for treating psoriasis is as follows: 1) Preparation of 2x aqueous matrix components: sterilizing deionized water at 121°C for 15 minutes, adding glycerol and propylene glycol to said sterilized and deionized water to make their concentrations 2.0% w/v and 1.0% w/v respectively, designated as "A" ;

2) Preparation of 10x sodium hyaluronate components: dissolving sodium hyaluronate in deionized water, said deionized water was sterilized at 121°C for 15 minutes to make a sodium hyaluronate solution having a concentration of 2.5% w/v, filtering said solution with 0.45tm microporous filter membrane to obtain a filtrate designated as "B"; 3) Preparation of 100x potassium sorbate components: dissolving potassium sorbate in deionized

water, said deionized water was sterilized at 121°C for 15 minutes, to make a potassium sorbate solution having a final concentration of 10% w/v, filtering said solution with 0.45uM microporous filter membraneto obtain a filtrate designated as "C"; 4) Preparation of 200x myristoyl hexapeptide components: dissolving myristoyl hexapeptide in

deionized water, said deionized water was sterilized at 121°C for 15 minutes, to make a myristoyl hexapeptide solution having a final concentration 1 mg/ml, designated as "D; ) Filtering a 10,000 U/ml mother solution of highly stable superoxide dismutase solution with 0.22 uM microporous filter membrane to obtain a filtrate was designated as "E"; 6) In an example provided, a 1 L preparation of the medicament comprising superoxide dismutase was prepared aseptically using the prepared components according to the following volumes: A 500 ml B 100 ml C 10 ml D 7.5 ml E 10ml Sterile deionized water 372.5 ml; The above-mentioned components were thoroughly mixed in an ATS high pressure homogenizer under the pressure of 200-500 bar to obtain a homogenized preparation that was aseptically filled in a container, and stored at room temperature.

[0033] After testing, the density of the prepared medicament (homogenized preparation) for treating psoriasis prepared by the above-mentioned method is about 1.02 g/ml.

[0034] The method for obtaining the highly stable superoxide dismutase in Example 1 is described in the patent application number "2021107192568" and having the title "Preparation method of a highly stable superoxide dismutase with transmembrane capacity

[0035] The general method is as follows:

1) The RNA of Geobacillus stearothermophilus was extracted using an RNA extraction kit (purchased from Tiangen Biochemical), a cDNA of said microorganism was synthesized using a reverse transcription kit (purchased from Tiangen Biochemical), specific primers (primer sequences are as follows) were designed and optimized according to the restriction endonuclease site, and amplifying the sequence encoding superoxide dismutase. The upstream primer sequence fished by superoxide dismutase: 5'-CATATGCCCTTTGAACTACCAGCAT-3' The downstream primer sequence fished by superoxide dismutase: 5'- AAGCTTCTTCGCTTTCGCCTCGCTG -3' 2) The pET30a vector (purchased from Youbao Biotechnology) was selected as the expression vector, the amplified sequence of superoxide dismutase and expression vector were double digested by HindIl and NdeI (purchased from ABclonal), and the digested products were recovered by DNA gel recovery kit (purchased from Tiangen Biochemical). The recovered double-enzyme digestion products were ligated into the expression vector using DNA ligase at 16°C for 12 hours (optimized ligation conditions) according to the optimized ratio of DNA fragment to plasmid (pET30a vector) is 2:1 (molar ratio) to obtain a recombinant vector. Bacterial transformation was performed by introducing the recombinant vector into a competent E. coli E.coli BL21 (DE3) by 42°C using heat shock method. Spreading the transformed E.coli on LB plates containing 50ug/ml kanamycin and cultured at 37°C for 18-26 hours for screening antibiotic resistance. After a single colony of bacteria is formed, the colony PCR method (see the following sequence for colony PCR primers) was used to verify a successful DNA clone; 3) The correctly validated colony was selected for expression verification, and the expression conditions are: Inoculation of monoclonal colonies into 5ml of LB liquid medium (the medium contains kanamycin 50ug/ml), when the OD600 value reached 0.7 IPTG was added to a final concentration of 0.5mM, then IPTG induction was performed at various temperatures (16°C, 37°C for preferred representative). After IPTG induction, the bacterial cells were collected and lysed by ultrasonication (the ultrasonic volume is 1 mL, ultrasoniccation was performed for 2 seconds followed by 3 seconds of rest, wherein the total ultrasonication time is 10 minutes). 4) Improving the stability of superoxide dismutase The aspartic acid at aa position 20 was mutated to glycine, and the leucine at aa position 141 was mutated to asparagine to improve the thermal stability of the enzyme.

Example 2

[0036] In an example, a method for the preparation of a medicament for treating psoriasis is as follows: 1) Preparation of 2x aqueous matrix components: sterilizing deionized water at 115°C for 20 minutes, adding glycerol and propylene glycol to said sterilized and deionized water to make their concentrations 2.0% w/v and 1.0% w/v respectively, designated as "A"; 2) Preparation of 10 x sodium hyaluronate components: dissolving sodium hyaluronate in deionized water, said deionized water was sterilized at 115°C for 20 minutes to make a sodium hyaluronate solution having a concentration of 2.5% w/v, filtering said solution with 0.45tm microporous filter membrane to obtain a filtrate designated as "B"; 3) Preparation of 100x potassium sorbate components: dissolving potassium sorbate in deionized water, said deionized water was sterilized at 115°C for 20 minutes to make a potassium sorbate solution having a final concentration of 10% w/v, filtering with 0.45uM microporous membrane to obtain a filtrate designated as "C"; 4) Preparation of 200x myristoyl hexapeptide components: dissolving myristoyl hexapeptide in deionized water, said deionized water wassterilized at 115°C for 20 minutes, to make a myristoyl hexapeptide solution having a final concentration of 1 mg/ml, designated as "D"; ) Filtering a 10,OOOU/ml mother solution of highly stable superoxide dismutase solution with 0.22 uM microporous filter membrane to obtain a filtrate designated as "E"; 6) In an example provided, a1 L preparation of the medicament comprising superoxide dismutase was prepared aseptically using the prepared components according to the following volumes: A 500 ml B 100 ml C 10 ml D 7.5 ml E 10ml Sterile deionized water 372.5 ml; The above-mentioned components were thoroughly mixed in an ATS high pressure homogenizer under the pressure of 200-500 bar to obtain a homogenized preparation that was aseptically filled into a container, and stored at room temperature.

Example 3

[0037] In an example, a method for the preparation of a medicament for treating psoriasis is as follows:

1) Preparation of 2x aqueous matrix components: sterilizing deionized water at 125°C for 12 minutes, adding glycerol and propylene glycol to said sterilized and deionized water to make their concentrations 2.0% w/v and 1.0% w/v respectively, designated as "A" ; 2) Preparation of 10x sodium hyaluronate components: dissolving sodium hyaluronate in deionized water, said deionized water was sterilized at 125°C for 12 minutes to make a sodium hyaluronate solution having a concentration of 2.5% w/v, filtering said solution with 0.45tm microporous filter membrane to obtain a filtrate designated as "B"; 3) Preparation of 100x potassium sorbate components: dissolving potassium sorbate in deionized

water, said deionized water was sterilized at 125°C for 12 minutes to make a potassium sorbate solution having a final concentration of 10% w/v, filtering said solution with 0.45uM microporous filter membrane to obtain a filtrate designated as "C"; 4) Preparation of 200x myristoyl hexapeptide components: dissolving myristoyl hexapeptide in

deionized water, said deionized water was sterilized at 125°C for 12 minutes to make a myristoyl hexapeptide solution having a final concentration of 1 mg/ml, designated as "D"; ) Filtering a 10000U/ml mother solution of highly stable superoxide dismutase solution with 0.22 uM microporous filter membrane to obtain a filtrate designated as "E"; 6) In an example provided, a 1 L preparation of the medicament comprising superoxide dismutase was prepared aseptically using the prepared components according to the following volumes: A 500 ml B 100 ml C 10 ml D 7.5 ml E 10ml Sterile deionized water 372.5 ml; The above-mentioned components were thoroughly mixed in an ATS high pressure homogenizer under the pressure of 200-500 bar to obtain a homogenized preparation that was aseptically filled into a container and stored at room temperature.

Example 4

[0038] How to use: Spray the medicament for treating psoriasis in Embodiment 1 on the affected area, gently apply to allow absorption after spraying, for 2-3 times a day. The patient (from Guangzhou) had been suffering from psoriasis for 2 years, and various treatments were ineffective. The patient stopped using other medicines while the product of the present invention was used for treatment. After using the medicament of the present invention according to the instructions provided, the patient had significant improvement after 6 days, and the patient was observed to have almost recovered after half a month (as shown in Figures 1-4). Figure 1 shows that before the treatment, the erythema of the patient's legs was severe; After 12 hours of medication, some parts of the erythema began to scab, and the wound at the erythema was gradually healing. After 6 days of medication, the skin of the patient's legs improved significantly, the color of the erythema became lighter, and many psoriasis-affected areas were observed to show imminent healing; After 16 days of treatment, the erythema of the patient's leg skin faded and gradually transformed to normal skin. These observations regarding the treatment is considered as curative.

Example 5

[0039] Figure 5 shows the phenomenon of excessive proliferation of epidermal cells in patients with psoriasis. The inventor used skin keratinocytes as a cell model to study the effect of the medicine of the present application. As shown in Figure 5, it was observed that in the cell experiment, the addition of the medicament of the present application can effectively inhibit the excessive proliferation of skin keratinocytes (HaCaT).

[0040] In the control group, the same dose of pure water was used as a placeboto compare and confirm the effect of the present invention. In Figures 5, 6, and 7, the control group all took the same dose of pure water as a placebo.

[0041] The cell morphology of the cells treatment group (lower left) as compared to the control group (upper left) after 72 hours of treatment, as shown left panel in Figure 5. HaCaT cell line was purchased from Wuhan Procell Company. The right panel in Figure 5 shows the relative value of cell viability after 72 hours of treatment between the treatment group and the control group. Quantitative detection of cell viability was performed using the CCK8 method (CCk8 kit was purchased from Dongren, Japan).

[0042] In FIG. 6, a cell model shows of the present invention inhibiting the cell cycle of skin keratinocyte HaCaT. The figure on the right shows the cell cycle detection results after 72 hours of treatment group, wherein the cells were treated with the medicament of the present invention. Compared with the control group, it is found that the medicament of the present invention can down-regulate the S phase and the G2 phase, indicating that the present invention has the effect of inhibiting the cell cycle of keratinocytes, which is important for preventing the onset of psoriasis and preventing further aggravation of psoriasis.

[0043] Figure 7 shows the phenomenon of hyperkeratinization of epidermis-forming cells in patients with psoriasis, wherein Keratin 6 is a marker of skin keratinization. Figure 7 shows that the medicament of the present application can significantly reduce the expression of Keratin 6 in skin keratinocytes, that is, the present invention can reduce the degree of skin keratinization, thereby inhibiting psoriasis. The present invention has determined that one of the causes of psoriasis is the increased keratinization of the skin, which leads to aggravation and prolongation of the disease course.

[0044] Fig. 8 is the comparative experiment carried out by the present invention to confirm whether the common/ordinary or unmodified superoxide dismutase also has a therapeutic effect for psoriasis;

[0045] After the common superoxide dismutase was prepared according to the same formula as in Example 1, it was used for 3 times a day, and the usage amount was also the same as that in Example 1.

[0046] The results show that the therapeutic effect on psoriasis of the products obtained with ordinary superoxide dismutase as the main raw material is significantly less effective than that of the present invention. It can be seen from the figure that the patient has no significant improvement after 6 days of use, while the effect of the present invention provided significant improvement after 6 days of use, so no further comparison was made for longer period of time of treatment. Since the aspartic acid at aa position 20 was mutated to glycine, and the leucine at aa position 141 was mutated to asparagine, and the co-expression of the CPP, having a sequence of YGRKKRRQRRR on the HIV-1 peptide having the transmembrane capacity, with superoxide dismutase, conferred the therapeutic effect of the medicament of the present invention in the treatment of psoriasis. This is an effect that ordinary superoxide dismutase cannot achieve.

[0047] Through the above-mentioned comparison, it can be seen that the formula of the present application has achieved unexpected technical effects, and is applied to the medicine for the treatment of psoriasis, providing a milder, safer and more effective way for the prevention and treatment of the disease.

Claims

CLAIMS 1. Use of superoxide dismutase in the preparation of a medicament for treating psoriasis, wherein the superoxide dismutase is a modified superoxide dismutase obtained by modifying a superoxide dismutase is cloned from Geobacillus stearothermophilus by mutating an aspartic acid at amino acid (aa) position 20 to glycine in, and mutating a leucine at aa position 141 to asparagine; and wherein said superoxide dismutase has a coding sequence obtained from a method of cloning superoxide dismutase from Geobacillus stearothermophilus, said method comprising the steps of extracting an RNA of Geobacillus stearothermophilus using an RNA extraction kit, synthesizing a cDNA using a reverse transcription kit to synthesize cDNA, designing and optimizing primers according to the restriction endonuclease sites, and amplifying sequences encoding superoxide dismutaseusing primer pairs having a sequences 5'-CATATGCCCTTTGAACTACCAGCAT-3', and 5'- AAGCTTCTTCGCTTTCGCCTCGCTG -3'.
2. The use of superoxide dismutase in the preparation of a medicament for treating psoriasis according to claim 1, wherein said medicament further comprises at least one excipient selected from the group consisting of at least one stabilizer, at least one flavor enhancer, at least one preservative, at least one moisturizing agent, and at least one antibacterial agent.
3. The use of superoxide dismutase in the preparation of a medicament for treating psoriasis according to claim 1, said medicament comprising: superoxide dismutase solution 20000U/ml 60-300U/ml; glycerin 0.5-2% w/v; propylene glycol 0.2-1.0% w/v; sodium hyaluronate 0.05-1.0% w/v; trehalose 0.1-1.0% w/v; myristoyl hexapeptide 2-20[tg/ml; potassium sorbate 0.06%-0.2% w/v; and the balance is sterile deionized water.
4. The use of superoxide dismutase in the preparation of a medicament for treating psoriasis according to claim 1, said medicament comprising: superoxide dismutase solution 20000U/ml 60-300U/ml glycerin 1% w/v; propylene glycol 0.5% w/v; sodium hyaluronate 0.25% w/v; trehalose 0.3% w/v; myristoyl hexapeptide 7.5[tg/ml; potassium sorbate 0.1% w/v; and the balance is sterile deionized water.
5. The use of superoxide dismutase in the preparation of a medicament for treating psoriasis according to claim 1, wherein said medicament is obtained by a method comprising the steps of: preparing 2x aqueous matrix components by sterilizing deionized water at 115~125°C for 12-20 minutes, adding glycerol and propylene glycol to said sterilized and deionized water to make their concentrations of 2.0% w/v and 1.0% w/v, respectively designated as "A" ; preparing 10x sodium hyaluronate components by dissolving sodium hyaluronate in deionized water, said deionized water was sterilized at 115-125°C for 12-20 minutes, to make a sodium hyaluronate solution having a concentration of 2.5% w/v, and filtering said solution with 0.45 m microporous filter membraneto obtain a filtrate designated as "B"; preparing 100x potassium sorbate component by dissolving potassium sorbate in deionized water, said deionized water was sterilized at 115-125°C for 12-20 minutes, to make a potassium sorbate solution having a final concentration of 10% w/v, and filtering with 0.45uM microporous filter membrane to obtain a filtrate designated as "C"; preparing 200x myristoyl hexapeptide component by dissolving myristoyl hexapeptide in deionized water, said deionized water was sterilized at 115-125°C for 12-20 minutes, to make a potassium myristoyl hexapeptide having a final concentration of 1 mg/ml, denoted as "D"; filtering a 10000U/ml mother solution of highly stable superoxide dismutase solution with 0.22 uM microporous filter membrane to obtain a filtrate designated as "E"; 500 ml of component A, 100 ml of component B, 10 ml of component C, 7.5 ml of component D, 10 ml of component E, and 372.5 ml of sterile deionized water were thoroughly mixed in a high pressure homogenizer at 200-500 bar to obtain a homogenized preparation.
6. The use of superoxide dismutase in the preparation of a medicament for treating psoriasis according to claim 5, wherein the density of the medicament for treating psoriasis is 1.02 g/ml.
7. A medicament for treating psoriasis, comprising a modified superoxide dismutase obtained by modifying a superoxide dismutase is cloned from Geobacillus stearothermophilus by mutating an aspartic acid at amino acid (aa) position 20 to glycine, and mutating a leucine at aa position 141 to asparagine.
8. A method for treating psoriasis using medicament comprising a modified superoxide dismutase, said comprising the steps of, spraying a medicament to a psoriasis affected area; and gently applying said medicament to allow absorption; wherein said medicament comprises a modified superoxide dismutase obtained by modifying a superoxide dismutase cloned from Geobacillus stearothermophilus by mutating an aspartic acid at amino acid (aa) position 20 to glycine in, and mutating a leucine at aa position 141 to asparagine.

1/ 4 28 Jun 2022

Drawings: 2022204563

Fig. 1

Fig. 2

2/ 4

Fig. 4 Fig. 3

3/ 4 28 Jun 2022

Control group 2022204563

Co ntr ol gro up

Fig. 5

Control group

Fig. 6

4/ 4 28 Jun 2022

Co ntr ol gr ou p Ha ca t 2022204563

Fig. 7

Fig. 8