CN113308568B - RNA probe for detecting 2019-nCOV, and preparation method and application thereof - Google Patents

Abstract

The invention discloses an RNA probe for detecting 2019-nCOV. The sequence of the probe is shown in SEQ ID NO.1 or SEQ ID NO.21; the preparation process includes: designing primers, constructing recombinant plasmids, PCR amplification, and product The process of purification and in vitro transcription; applying the prepared probe to the detection of 2019-nCOV can detect 2019-nCOV viral nucleic acid at the single-cell level, improving the sensitivity of detection.

Description

A kind of RNA probe for detecting 2019-nCOV and its preparation method and application

technical field

The invention relates to the technical field of nucleic acid hybridization, and more specifically relates to an RNA probe for detecting 2019-nCOV and its preparation method and application.

Background technique

Current methods for identifying novel coronaviruses include fluorescent quantitative PCR and antibody detection methods, among which fluorescent quantitative PCR for nucleic acid detection is the gold standard for virus detection methods, but there are still many problems in the existing methods, such as: (1) Although the fluorescent quantitative PCR method can identify the nucleic acid in the suspected patient, this method needs to extract the RNA in the cell, then perform reverse transcription, and then carry out PCR identification. In these experimental operations, the loss of RNA is relatively large. If the suspected patient is infected In the early stage or the amount of virus contained in the body is relatively small, it is easy to cause RNA loss during the extraction process, resulting in false negative results; (2) Since the new coronavirus is an RNA virus, the RNA virus mutates quickly, and the mutation can continue to accumulate , Fluorescent quantitative PCR experiments have relatively high requirements for nucleic acid sequences, especially in the regions covered by PCR primers. If mutations occur in the nucleic acids in this region, the efficiency of PCR amplification will decrease or even fail to amplify, resulting in false negative results; ( 3) The fluorescent quantitative PCR experiment has not been sequenced and identified, and non-target fragments may be amplified, resulting in false positives, resulting in inaccurate test results.

RNA probe refers to a single-stranded cDNA or cRNA molecule with a label that can complementarily bind to the corresponding nucleotide sequence in the tissue. It is a promising nucleic acid probe. Since RNA is a single-stranded molecule, Therefore, its hybridization reaction efficiency with the target sequence is extremely high, and it can detect whether a single cell contains the target RNA, so it can effectively detect the target fragment to be tested.

Therefore, how to provide a probe that can effectively detect 2019-nCoV and apply it to the detection of 2019-nCoV is an urgent problem to be solved by those skilled in the art.

Contents of the invention

In view of this, the present invention synthesizes a digoxin-labeled antisense RNA probe according to the base sequence of the new coronavirus, which can be used for nucleic acid detection of the new coronavirus, has high sensitivity, strong specificity, and eliminates false negatives The merits of the result.

In order to achieve the above object, the present invention adopts the following technical solutions:

An RNA probe for detecting 2019-nCOV, the sequence of the RNA probe is shown in SEQ ID NO.1, or the sequence shown in SEQ ID NO: 1 is substituted, deleted and/or added bases and/or Or a sequence with more than 90% homology obtained after terminal modification; as a side-by-side technical solution of the present invention, the sequence of the RNA probe is shown in SEQ ID NO.21, or as shown in SEQ ID NO:21 A sequence with more than 90% homology obtained after sequence substitution, deletion and/or addition of bases and/or terminal modification.

As a preferred technical solution of the present invention, the length of the RNA probe is at least 857nt.

As a preferred technical solution of the present invention, the sequence shown in SEQ ID NO.21 is the sequence with more than 90% homology obtained after substitution, deletion and/or addition of bases and/or terminal modification is SEQ ID NO. .22 or the sequence shown in SEQ ID NO.23.

The technical effect achieved by the above technical scheme is: So far, in the existing reports, 2019-nCOV contains 149 mutations, and the mutations are still accelerating and accumulating. Since the RNA probe designed in this scheme has 937nt, it can Hybridization with the target nucleic acid sequence, even if one or more nucleic acid mutations occur in the target sequence, it will not affect the overall hybridization effect, so this probe can effectively avoid false negatives in fluorescent quantitative PCR detection due to the rapid mutation of RNA viruses The result is more and more problems.

A method for preparing an RNA probe, comprising the steps of:

1) Design primers: design primers according to the partial base sequence of the target to obtain forward primers and reverse primers;

2) Construction of recombinant plasmid: PCR amplification of part of the nucleotide sequence of the target object, using cloning technology, connecting part of the nucleotide sequence of the target object to the vector to obtain a recombinant plasmid, and performing double enzyme digestion verification on the obtained recombinant plasmid , to determine whether the result of the restriction enzyme digestion is in line with expectations; the process of double enzyme digestion verification is specifically: use two enzymes to perform double enzyme digestion on the recombinant plasmid, and use gel electrophoresis to determine whether the partial base sequence of the target object is connected to the plasmid , if there are two bands in the electrophoresis, and the sizes of the two bands are the size of the exogenous target fragment and the vector respectively, then the digestion result is in line with expectations;

3) PCR amplification: using the recombinant plasmid with the expected digestion result in step 2) as a template, amplifying it with the above-mentioned forward primer and reverse primer, recovering and purifying the amplified product, and obtaining a DNA template;

4) Use the DNA template obtained after the step 3) to perform in vitro transcription, and synthesize a digoxigenin-labeled antisense RNA probe, which is an RNA probe for detecting the target.

The technical effect achieved by the above technical solutions is: in the traditional probe synthesis process, the recombinant plasmid should be digested and linearized, and then purified and recovered for massive amplification. The present invention directly performs PCR amplification on the constructed recombinant plasmid to obtain a large number of target fragments. Compared with the traditional technology, it saves the process of bacterial culture, plasmid extraction and identification, and enzyme digestion linearization, and saves time and cost to the greatest extent. . Moreover, the target gene is obtained through PCR amplification, which is mature, error-prone, high-yield, fast and efficient.

As a preferred technical solution of the present invention, the target object is 2019-nCOV.

As a preferred technical solution of the present invention, the partial base sequence of the 2019-nCOV is shown in SEQ ID NO.5.

As a preferred technical scheme of the present invention, the primer pair of the forward primer and the reverse primer is scheme one or scheme two:

Option 1: The forward primer is COVID-19-F1, its sequence is shown in SEQ ID NO.2; before the 5' end of the reverse primer, a T7 RNA polymerase promoter is added, and the obtained reverse primer is COVID-19-R2, whose sequence is shown in SEQ ID NO.4 or SEQ ID NO.24;

Scheme 2: The forward primer is COVID-19-F2, whose sequence is shown in SEQ ID NO.6; the reverse primer is COVID-19-R3, whose sequence is shown in SEQ ID NO.7.

As a preferred technical scheme of the present invention, the primer pair of the forward primer and the reverse primer is Scheme 1, the vector is pGEM-T Easy, and the enzyme used in the double digestion is a combination of HindIII and MluI; When the primer pair of the forward primer and the reverse primer is Scheme 2, the vector is pCDNA3.1 myc His A, and the enzyme used for the double digestion is a combination of KpnI and ApaI.

As a preferred technical solution of the present invention, the reaction system of the PCR amplification is:

As a preferred technical solution of the present invention, the reaction procedure of the PCR amplification is:

As a preferred technical solution of the present invention, the system for in vitro transcription is:

As a preferred technical solution of the present invention, the process of in vitro transcription includes:

1) Add the in vitro transcription system into a 1.5mL EP tube, mix well, and put it in a water bath at 37°C for 2h;

2) After the water bath, add DNase to digest for 15 minutes;

3) The successfully transcribed RNA was purified using the RNeasy Mini kit, and the finally obtained antisense RNA probe with digoxin labeling was stored at -80°C.

The application of the probe prepared by the above preparation method in the detection of RNA virus, the length of the RNA probe is at least 857nt.

As a preferred technical solution of the present invention, the RNA virus includes novel coronavirus 2019-nCOV, bat coronavirus prc31 strain, bat coronavirus RacCS203 strain, bat coronavirus 264 strain, bat coronavirus 253 strain, bat coronavirus 224 strain or Pangolin coronavirus MP789 strain.

As a preferred technical solution of the present invention, the method for detecting RNA viruses such as 2019-nCOV comprises the following steps:

(1) hybridization pretreatment: take the sample to be tested for pretreatment;

Construction of overexpression vector (pCMVmyc His3.1A-2019-nCOV plasmid):

(2) Pre-hybridization: Add 100 μL of pre-hybridization solution dropwise to the passaged Hek293 cells, cover with a siliconized cover slip, and incubate at 68°C for 60 min in a wet box;

(3) Hybridization: wipe off the liquid around the sample, add 50 μL of RNA probe dropwise, cover with a siliconized cover slip, incubate at 72°C for 15 min, and then put the tissue-loaded slide into HYB+ buffer Incubate overnight at 68°C in a humid chamber;

(4) Post-hybridization treatment: take off the cover slip, and use 50% formamide/2×SSCT buffer preheated at 68°C, 2×SSCT buffer preheated at 68°C, and 0.2×SSCT preheated at 68°C in sequence. Rinse the sample with buffer, in order to wash away the remaining unspecific probes and leave the specifically bound probes, which can effectively reduce the background staining and obtain a better contrast effect; then add the blocking solution to the sample dropwise, 37 Incubate at ℃ for 30 minutes; finally, add Digoxigenin antibody diluted 3000 times with blocking solution, overnight at 4℃, to obtain hybridization samples;

(5) Color development and photography: add the hybridized sample to the MABT solution of 1% heat-treated lamb serum, wash at room temperature for 25 minutes; then wash 3 times with MABT, 25 minutes each time, and then wash 2 times with detection buffer, 5 minutes each time ;Finally, add 100uLAP substrate staining buffer to it, incubate at room temperature, and wrap it with metal foil to avoid light. When the target coloring appears, wash it twice with PBS for 5 minutes each time, observe under a microscope, and take pictures to judge whether there is a positive signal.

The technical effect achieved by the above technical scheme is: the detection method can effectively avoid the problem of false negative results caused by RNA loss in fluorescent quantitative PCR detection. Because in situ hybridization technology does not need to extract RNA from cells, it can directly detect tissues, cells or even single cells, with high sensitivity and small sample required.

As a preferred technical solution of the present invention, the prehybridization solution includes: 50% formamide, 5*SSC, 50ug/mL heparin, 5mM EDTA, pH8.0, 50ug/mL ribosomal RNA, 1.84%V/V1M citric acid and 0.1% Tween.

As a preferred technical solution of the present invention, the steps of rinsing the sample are: sequentially rinse twice with 50% formamide/2×SSCT buffer solution preheated at 68°C, 30 minutes each time; washing solution once, 25min each time; rinse twice with 0.2×SSCT buffer preheated at 68°C, 30min each time.

It can be seen through the above-mentioned technical scheme that, compared with the prior art, the technical effect achieved by the present invention is:

The present invention has developed an RNA probe that can specifically hybridize with 2019-nCOV. The length of the probe is close to or greater than 1000bp, so even if 149 mutation sites are produced in the RNA of the new coronavirus, it can also hybridize with most of the bases of the RNA. Sequence hybridization avoids the occurrence of false negative results and improves the accuracy of detection results.

Moreover, the present invention utilizes the in situ hybridization technique to detect the sample to be tested, and only needs to extract the patient's tissue or blood for direct detection without extracting the RNA in the cells, avoiding the loss of RNA, and improving the accuracy of the detection result.

Description of drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings that need to be used in the description of the embodiments or the prior art. Obviously, the accompanying drawings in the following description are only It is an embodiment of the present invention, and those skilled in the art can also obtain other drawings according to the provided drawings without creative work.

Figure 1 is the electrophoresis diagram of the pGEMT(easy)-COVID-19 recombinant plasmid, pGEMT(easy) vector and viral gene fragment, where 1 is the recombinant plasmid, 2 is the pGEMT(easy) vector and viral gene fragment, and M is a marker;

Figure 2 is a map of the restriction sites of the recombinant plasmid pGEMT(easy)-COVID-19

Figure 3 is a sequence diagram of the enzyme digestion results of the recombinant plasmid pGEMT(easy)-COVID-19;

Figure 4 is an electropherogram of the amplified product using pGEMT(easy)-COVID-19 as a template and using COVID-19-F1 and COVID-19-R2 as primers;

Figure 5 is the electropherogram after gel recovery and purification after PCR amplification using pGEMT(easy)-COVID-19 as a template and COVID-19-F1 and COVID-19-R2 as primers

Fig. 6 is an electropherogram of an antisense RNA probe.

Figure 7 is a restriction site map of the recombinant plasmid pCDNA3.1myc HisA-COVID-19;

Figure 8 is the electrophoresis diagram of recombinant plasmid pCDNA3.1myc His A-COVID-19, pCDNA3.1myc His A vector and viral gene fragment, wherein, 1 is the recombinant plasmid, 2 is the pCDNA3.1myc His A vector and viral gene fragment, M for marker;

Figure 9 is a sequence diagram of the enzyme digestion results of the recombinant plasmid pCDNA3.1myc HisA-COVID-19;

Figure 10 is a graph of RNA probe detection results;

Figure 11 is the results of cell in situ hybridization experiments (A, RNA probe cell in situ hybridization results of the present invention; B, RNA probe fluorescence in situ hybridization results of the present invention; C, RNA probe fragment shortened cell in situ hybridization result);

Figure 12 is a qPCR amplification efficiency figure after virus mutation;

Figure 13 is the design of the 2019-nCOV virus mutation site (the query above is the wild-type 2019-nCOV sequence, and the sbjct below is the mutated sequence);

Figure 14 is a graph showing the results of in situ hybridization experiments on cells after mutation of the target sequence;

Figure 15 is the sequence of 2019-nCOV virus mutation type.

Detailed ways

The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

Example 1:

A method for preparing an RNA probe for detecting 2019-nCOV, comprising the steps of:

1) Design primers: design primers according to the partial nucleotide sequence of 2019-COV, and use Premier5.0 software and NCBI BLAST analysis to obtain primers COVID-19-F1 and COVID-19-R1;

COVID-19-F1: 5'TGTGCTTGTGAAATTGTCGGT 3', as shown in SEQ ID NO.2;

COVID-19-R1: 5'CAGAAGTGGCACCAAATTCCA 3', as shown in SEQ ID NO.3;

2) Synthesize new primers: before COVID-19-R15', add T7 RNA polymerase promoter to get primer COVID-19-R2;

COVID-19-R2: 5'GCGTAATACGACTCACTATAGGGCAGAAGTGGCACCAAATTCCA3', as shown in SEQ ID NO.4; or 5'GCGTAATACGACTCACTATAGGGTGTGCTTGTGAAATTGTCGGT 3', as shown in SEQ ID NO.24;

3) Construction of recombinant plasmid pGEMT(easy)-COVID-19: link the partial nucleotide sequence of the 2019-COV to the pGEMT(easy) vector to obtain recombinant plasmid pGEMT(easy)-COVID-19, for the recombinant plasmid pGEMT (easy)-COVID-19 was digested, and the digestion results are shown in Figure 1. Lane 1 is the electrophoresis image of the recombinant plasmid; Lane 2 is the result of HindⅢ and MluⅠ double enzyme digestion, and the vector uses pGEM-T Easy, pGEM-T The fragment size of Easy is about 3000bp, the size of the foreign fragment is about 900bp, and the total length of the recombinant plasmid is 3954bp (as shown in Figure 2); the digested product is recovered and sequenced, and the result is shown in Figure 3;

4) PCR amplification: the reaction system of PCR amplification is:

The reaction procedure of PCR amplification is:

Using pGEMT(easy)-COVID-19 as a template, amplify it with COVID-19-F1 and COVID-19-R2 according to the above system and procedure, and perform 2% agarose electrophoresis on the amplified product, the result is shown in the figure As shown in 4, refer to the cutting position of the DNA marker to recover and purify the amplification product, and refer to the band at 960 bp on the gel product at the cutting position of the DNA marker, which is the desired target product band; the cut target product band is recovered with gel The kit is recovered to obtain a purified PCR amplification product, which is subjected to agarose gel electrophoresis, the result is shown in Figure 5, and its concentration (30ng/μL) is measured to obtain a DNA template;

5) Utilizing the above-mentioned DNA template for in vitro transcription, and synthesizing antisense RNA probes with digoxin labeling; the system for in vitro transcription is:

The transcription process is:

1) Add the in vitro transcription system into a 1.5mL EP tube, mix well, and put it in a water bath at 37°C for 2h;

2) After the water bath is over, add DNase to digest for 15 minutes, and then use agarose electrophoresis to detect, as shown in Figure 6, because the DNA marker used in the figure, DNA is double-stranded, and because RNA is a single-stranded structure, in some U bases Digoxigenin markers are incorporated into the DNA, so the size of the RNA in the electrophoresis results is only a little more than half of its size;

3) The successfully transcribed RNA was purified with the RNeasy Mini kit to obtain a digoxigenin-labeled antisense RNA probe, which was stored at -80°C, as shown in SEQ ID NO.1.

Among them, the partial base sequence of 2019-nCOV is shown in SEQ ID NO.5.

Example 2: Construction of overexpression vector (pCMV myc His 3.1A-2019-nCOV plasmid)

1) Design primers: design primers according to the partial base sequence of 2019-nCOV to obtain primers COVID-19-F2 and COVID-19-R3;

COVID-19-F2: 5'CCCAAGCTGGCTAGTTAAGCTTGGTACCATGTCAACCTGTGCTTGTGAAATTGTCGGTGGACAA 3', as shown in SEQ ID NO.6;

COVID-19-R3: 5'CTGAGATGAGTTTTTGTTCGAAGGGCCCAGCAGCAGAAGTGGCACCAAATTCCAAAGGT 3', as shown in SEQ ID NO.7;

2) Construction of recombinant plasmid pCDNA3.1myc His A-COVID-19: Amplify the partial nucleotide sequence of 2019-nCOV by PCR, and perform KpnⅠ and ApaⅠ double enzymes on the obtained PCR product and the original pCDNA3.1myc His A vector Cut, and use TA cloning technology to connect the partial base sequence of 2019-nCOV to the pCDNA3.1 myc His A vector to obtain the recombinant plasmid pCDNA3.1 myc His A-COVID-19 as shown in Figure 7, wherein the sequence 1 is DNA template sequence, enzyme digestion and sequencing verification of the recombinant plasmid pCDNA3.1 myc His A-COVID-19, the digestion results are shown in Figure 8, in which lane 1 is the electrophoresis image of the recombinant plasmid, and lane 2 is KpnI and ApaI double enzymes Cut the result picture, the vector uses pCDNA3.1 myc His A, the size of the pCDNA3.1 myc His A fragment is about 5500bp, the size of the foreign fragment is about 900bp, the recombinant plasmid is 6371bp as shown in Figure 7, and the enzyme-digested product is recovered, and its Sequencing was carried out, and the results are shown in Figure 9;

Example 3: Application of RNA probes in the detection of 2019-nCOV

1. Recovery and passage of Hek293 cells

1) Recovery of Hek293 cells:

Take out the frozen Hek293 cells from liquid nitrogen, thaw in a 37°C constant temperature water bath for 1 min, and keep shaking the cryopreservation tube; transfer the thawed cell suspension into the preheated fresh DMEM complete culture medium, gently Pipette twice; centrifuge at 1000rpm for 3min, discard the supernatant; add 5ml of fresh DMEM complete medium, and transfer it to a new culture bottle, put it in a 37°C, 5% _CO2 incubator for culture; replace with a new culture medium after 24 hours , continue to pass on.

2) Subculture of Hek293 cells

When the confluence of cell growth reaches 95%-100%, suck off the old medium, add PBS to wash once; add trypsin, digest for 30 seconds, and suck off; add preheated fresh DMEM to stop digestion, and repeatedly pipette until it is Single-cell suspension: take a culture bottle, add 3ml of fresh DMEM medium, then add 1ml of cell suspension, and culture in an incubator at 37°C and 5% CO2.

2. Transfect Hek293 cells with pCDNA3.1myc His A-COVID-19 plasmid

1) Take Hek293 cells in the logarithmic growth phase, digest with trypsin, add DMEM medium without double antibody to dilute the cells, and transfer to a 24-well plate, 1ml per well, culture for 24 hours, replace with new medium;

2) Perform transfection according to the Lipofectamine 2000 Reagent kit, take two 1.5ml centrifuge tubes, add 250μL Opti-MEM medium respectively, and add pCDNA3.1 myc His A-COVID-19 plasmid (2～4μg) to one of them ; Add 6 μL Lipofectamine 2000 to the other and incubate at room temperature for 5 minutes;

3) Mix the above two centrifuge tubes, incubate at room temperature for 20 minutes to obtain the plasmid-liposome mixture, and then add 1ml of DMEM medium without double antibody;

4) The above mixed solution was dropped into a 24-well plate, mixed evenly, and cultured in an incubator at 37° C. and 5% CO ₂ .

3. The application of the RNA probe of the present invention in the detection of 2019-nCOV, the detection method is as follows:

1) hybridization pretreatment

(1) Add 200ul proteinase K (10ng/μL) dropwise to the cultured Hek293 cells, and incubate at 37°C for 30min;

(2) Rinse with PBST solution prepared with DEPC water for 3 times, each time for 5 minutes;

(3) Fix with 4% paraformaldehyde prepared with DEPC water for 20 min;

(4) Rinse 3 times with PBST solution prepared with DEPC water, 5 min each time;

2) Pre-hybridization

Add 200 μL prehybridization solution (50% formamide; 2*SSC; 50ug/mL heparin; 5mM EDTA, pH8.0; 50ug/mL ribosomal RNA; 1.84% V/V 1M citric acid; 0.1% Tween , put the 24-well petri dish in a 68°C water bath for 60 minutes.

3) hybridization

(1) Suck off the pre-hybridization solution, add dropwise 200 μL of the hybridization solution of the present invention (antisense RNA containing 2ng/uL digoxin marker, its sequence is shown in SEQ ID NO.1), put the 24-well culture dish Incubate overnight in a 68°C water bath.

4) Post-hybridization treatment

(1) Aspirate the hybridization night, add 200ul 68°C preheated 50% formamide/2×SSCT buffer and wash twice, 30min each time;

(2) Wash once in 68°C preheated 2×SSCT buffer for 30 minutes;

(3) Wash twice in 0.2×SSCT buffer preheated at 68°C, 30 min each time;

(4) Aspirate the liquid, add the blocking solution dropwise, and incubate at room temperature for 60 min.

(5) Digoxigenin antibody (Anti-Digoxigenin-AP, Fabfragments) diluted 3000 times with blocking solution was added, overnight at 4°C.

5) Color development, photography

(1) Add to MABT solution of 1% heat treated lamb serum, wash at room temperature for 25min;

(2) Wash 3 times with MABT, 25 minutes each time;

(3) Detection buffer (per 50mL solution: 100mM NaCl (1mL 5M); 50mM MgCl2 (2.5mL 1M); 100mM Tris-HCl (5mL 1M, pH9.5); 0.1% Tween -20; 1mM levamisole (50uL1M)) washed twice, 5min each time;

(4) Add 200uL AP substrate staining buffer (per 1mL detection buffer: 4.5uL NBT, 3.5uL BCIP, also known as X-phosphate, add 4uL levamisole), incubate at room temperature, wrap with metal foil to avoid light;

(5) When the target coloration appears, wash it twice with PBS, each time for 5 minutes, to stop the reaction;

(6) Microscopic observation and photography.

6) Results

As shown in Figure 10, the left picture is the NC (non-specific control) control, with no signal and only a very weak background; the right picture is the result of in situ hybridization after 4 hours of cell transfection, and the dark blue purple (arrow) is positive Signal, light purple is negative signal. Both images are at 40× magnification.

Example 4:

An RNA probe for detecting 2019-nCOV, the sequence of which is shown in SEQ ID NO.21. The preparation method of this RNA probe comprises the steps:

1) Design primers: design primers according to the partial nucleotide sequence of 2019-COV, and use Premier5.0 software and NCBI BLAST analysis to obtain primers COVID-19-F1 and COVID-19-R1;

COVID-19-F1: 5'TGTGCTTGTGAAATTGTCGGT 3', as shown in SEQ ID NO.2;

COVID-19-R1: 5'CAGAAGTGGCACCAAATTCCA 3', as shown in SEQ ID NO.3;

2) Synthesize new primers: before COVID-19-R15', add T7 RNA polymerase promoter to get primer COVID-19-R2;

COVID-19-R2: 5'GCGTAATACGACTCACTATAGGGCAGAAGTGGCACCAAATTCCA3', as shown in SEQ ID NO.4; or 5'GCGTAATACGACTCACTATAGGGTGTGCTTGTGAAATTGTCGGT 3', as shown in SEQ ID NO.24;

3) Construction of recombinant plasmid pGEMT(easy)-COVID-19: link the partial nucleotide sequence of the 2019-COV to the pGEMT(easy) vector to obtain recombinant plasmid pGEMT(easy)-COVID-19, for the recombinant plasmid pGEMT (easy)-COVID-19 was digested, and the digestion results were in line with expectations; the digested products were recovered and sequenced;

4) PCR amplification: the reaction system of PCR amplification is:

The reaction procedure of PCR amplification is:

Using pGEMT(easy)-COVID-19 as a template, amplify it with COVID-19-F1 and COVID-19-R2 according to the above system and procedure, and perform 2% agarose electrophoresis on the amplified product, and cut it out with reference to DNAmarker Recover and purify the amplified product by position, and refer to the DNA marker to cut out the band at 937 bp on the gel product, which is the desired target product band; recover the cut target product band with a gel recovery kit to obtain purified The PCR amplified product was subjected to agarose gel electrophoresis, and its concentration (30ng/μL) was measured to obtain a DNA template;

5) Utilizing the above-mentioned DNA template for in vitro transcription, and synthesizing antisense RNA probes with digoxin labeling; the system for in vitro transcription is:

The transcription process is:

1) Add the in vitro transcription system into a 1.5mL EP tube, mix well, and put it in a water bath at 37°C for 2h;

2) After the water bath, add DNase to digest for 15 minutes, and then detect by agarose electrophoresis;

3) The successfully transcribed RNA was purified using the RNeasy Mini kit to obtain a digoxigenin-labeled antisense RNA probe, which was stored at -80°C, as shown in SEQ ID NO.21.

Among them, the partial base sequence of 2019-nCOV is shown in SEQ ID NO.5.

A sequence with more than 90% homology obtained after substitution, deletion and/or addition of bases and/or terminal modifications on the basis of the sequence shown in SEQ ID NO.21, such as SEQ ID NO.22 or SEQ ID NO .23 shown. The RNA probe sequence shown in SEQ ID NO.22 or SEQ ID NO.23 has the same effect as the sequence shown in SEQ ID NO.21.

Example 5:

Application of the RNA probe described in Example 4 in the detection of 2019-nCOV.

1. Detection method

1) hybridization pretreatment

(1) Add 200ul proteinase K (10ng/μL) dropwise to the cultured Hek293 cells, and incubate at 37°C for 30min;

(2) Rinse with PBST solution prepared with DEPC water for 3 times, each time for 5 minutes;

(3) Fix with 4% paraformaldehyde prepared with DEPC water for 20 min;

(4) Rinse 3 times with PBST solution prepared with DEPC water, 5 min each time;

2) Pre-hybridization

Add 200 μL prehybridization solution (50% formamide; 2*SSC; 50ug/mL heparin; 5mM EDTA, pH8.0; 50ug/mL ribosomal RNA; 1.84% V/V 1M citric acid; 0.1% Tween , put the 24-well petri dish in a 68°C water bath for 60 minutes.

3) hybridization

(1) Suck off the pre-hybridization solution, add dropwise 200 μL of the hybridization solution of the present invention (antisense RNA containing 2ng/uL digoxin marker, its sequence is shown in SEQ ID NO.21), put the 24-well culture dish Incubate overnight in a 68°C water bath.

4) Post-hybridization treatment

(1) Aspirate the hybridization night, add 200ul 68°C preheated 50% formamide/2×SSCT buffer and wash twice, 30min each time;

(2) Wash once in 68°C preheated 2×SSCT buffer for 30 minutes;

(3) Wash twice in 0.2×SSCT buffer preheated at 68°C, 30 min each time;

(4) Aspirate the liquid, add the blocking solution dropwise, and incubate at room temperature for 60 min.

(5) Digoxigenin antibody (Anti-Digoxigenin-AP, Fabfragments) diluted 3000 times with blocking solution was added, overnight at 4°C.

5) Color development, photography

(1) Add to MABT solution of 1% heat treated lamb serum, wash at room temperature for 25min;

(2) Wash 3 times with MABT, 25 minutes each time;

(3) Detection buffer (per 50mL solution: 100mM NaCl (1mL 5M); 50mM MgCl2 (2.5mL 1M); 100mM Tris-HCl (5mL 1M, pH9.5); 0.1% Tween -20; 1mM levamisole (50uL1M)) washed twice, 5min each time;

(4) Add 200uLAP substrate staining buffer (per 1mL detection buffer: 4.5uLNBT, 3.5uLBCIP, also known as X-phosphate, add 4uL levamisole), incubate at room temperature, wrap with metal foil to avoid light;

(5) When the target coloration appears, wash it twice with PBS, each time for 5 minutes, to stop the reaction;

(6) Microscopic observation and photography showed positive signals.

2. RNA probe mutation tolerance of the present invention

The current 2019-nCOV mutation rate is extremely high, and the sequence is not stable. The RNAscope method currently used, like the fluorescent quantitative PCR method, requires a very specific base sequence. When the target sequence mutates, the target sequence and the target sequence The binding efficiency will decrease significantly or even fail, resulting in the failure of the detection result. At present, there are more than 6,000 types of 2019-nCOV mutations, with an average of 1 base mutation in 5 bases. If conventional experimental detection methods are used, there are 50 bases in the target sequence, and an average of 10 bases In actual detection, if one of the 50 target sequences is mutated, the sensitivity of the method will drop sharply or even the detection will fail. Figure 15 shows the mutation types. However, the in situ hybridization technology adopted by the RNA probe sequence claimed in the present invention utilizes the single-sequence and long-fragment combination method to combine with the target gene, even if the target sequence is mutated, it will not affect the overall binding efficiency. Even if there are multiple nucleic acid mutations in the target sequence, it can hybridize with most of the base sequences of the RNA probe without affecting the overall hybridization effect.

In order to further verify the mutation tolerance of the RNA probe of the present invention (its sequence as shown in SEQ ID NO.21) to the partial base sequence of 2019-nCOV (as shown in SEQ ID NO.5, 937nt), the following experiments were carried out :

Experimental Design 1: The same RNA probe sequence was used for in situ hybridization experiments using different signal amplification systems. Using digoxigenin labeling and alkaline phosphatase signal amplification system, the RNA probe of the present invention and the 2019-nCOV partial base sequence (937nt) cell in situ hybridization experiment obtained a specific and very strong hybridization signal (see Figure 11A ); the same RNA probe fragment, using fluorescence in situ hybridization experiment, no hybridization signal can be detected under the fluorescence microscope (see Figure 11B).

Experimental Design 2: Using digoxin labeling and alkaline phosphatase signal amplification system, the RNA probe of the present invention can obtain a strong hybridization signal (see Figure 11A); after the RNA probe fragment is shortened (such as SEQ ID NO.8 The sequence shown, 255nt, this sequence is the UTP band digoxin-labeled RNA probe sequence obtained after the RNA probe of the present invention is truncated; as shown in the sequence of SEQ ID NO.9, 255nt, this sequence is the same as 2019-nCOV nucleic acid binding RNA probe sequence encoding E protein), the result of cell in situ hybridization was negative (see Figure 11C).

Experimental design 3: mutation experiment, qPCR experiment mutation amplification efficiency detection

The wild-type plasmid and the mutated plasmid were transfected into HEK293T cells, the RNA of the cells was extracted, verified by qPCR, and qPCR primers were designed near the mutation site. A total of 8 sets of mutant primers were designed (m1, m2, m3, m4, r1, r2, r3, r4). The results of the qPCR experiment are shown in Figure 13. The results show that with f as a reference (the virus has not mutated), the PCR amplification efficiency is 100%. The efficiency of m4, r2, r4 is respectively 1%, 6%, 4% before the mutation, and the in situ hybridization experiment result shows that the RNA probe of the present invention is not affected by the nucleic acid mutation, and still obtains a very strong positive signal ( See Figure 14 on the right), this experiment proves that the RNA probe of the present invention has a high tolerance to 2019-nCOV mutations, while the qPCR method is very sensitive to virus mutations, which can easily lead to false negative results. In the same way, it can be deduced that the commonly used short probe binding method has a nucleic acid hybridization size similar to that of qPCR, so the short probe binding method is also very sensitive to mutations.

The nucleotide sequence obtained after qPCR of the wild-type plasmid is shown as SEQ ID NO.10.

Wild-type primers used in qPCR experiments (as shown in SEQ ID NO.11-12):

qPCR-F2: tgcttgtgaaattgtcggtgga;

qPCR-R2:agagtcagcacacaaagccaa;

8 sets of mutant primers used in qPCR experiments: (The uppercase marks are the mutation sites, and the sequences are shown in SEQ ID NO.13-20)

SNP1: qPCR-F2 m1: tgcttgtgaaattgtcggtggT;

SNP2: qPCR-F2 m2: tgcttgtgaaattgtcggtgCT;

SNP3: qPCR-F2 m3: tgcttgtgaaTAtgtcggtgga;

SNP4: qPCR-F2 m4: tgcttgtgaaaAtgtcggtgga;

SNP5: qPCR-R2 r1:agagtcagcacacaaagccaT;

SNP6: qPCR-2 r2:agagtcagcacacaaagccGT;

SNP7: qPCR-2 r3:agagtcagcacaGaaagccaa;

SNP8: qPCR-2 r4:agagtcagcaGTcaaagccaa.

SNP1-SNP8 are the forward primers m1-m4 and the reverse primers r1-r4 of the qPCR experiment, respectively. Gene mutation has a great impact on the amplification efficiency of qPCR. When the mutation site is at the 3' end of the primer, the impact is very large. When the mutation site is in the middle of the primer, it also has an impact, but it is not as large as at the 3' end.

Experimental Design 4: In Situ Hybridization Mutation Experimental Design

On the basis of the target hybridization sequence (as shown in SEQ ID NO.5, 937nt), we designed an experiment of consecutive 2 and 3 base mutations, as shown in Figure 13, wherein 360 bases were intercepted, and no The matched base is the mutant base).

See Figure 14 for the experimental results. The left figure is the experimental control transfected with pCMVB myc hisA empty vector, and the right figure is the result of the RNA probe in situ hybridization experiment of the present invention. The results show that after the target sequence is mutated, the RNA probe of the present invention still obtains a very strong and specific hybridization signal. Even if single or multiple base mutations occur in the nucleic acid sequence of the target virus, the RNA probe of the present invention still obtains very strong positive signals, and the method has a relatively high tolerance to nucleic acid mutations. The RNA probe of the invention has low cost, simple manufacture, good effect and anti-mutation effect.

The above experiment further proves that the RNA probe of the present invention (its sequence is shown in SEQ ID NO.21) has a high tolerance to virus mutation, while the qPCR method is very sensitive to virus mutation, which easily leads to false negative results. In the same way, it can be deduced that the commonly used short probe binding method has a nucleic acid hybridization size similar to that of qPCR, so the short probe binding method is also very sensitive to mutations. Therefore, for the new coronavirus with a very high mutation frequency, the present invention is obviously better than conventional methods.

According to the detection principle of this RNA probe, it can be inferred that the sequence shown in SEQ ID NO. Or the detection of viruses such as pangolin coronavirus MP789 strain can also achieve considerable results.

Each embodiment in this specification is described in a progressive manner, each embodiment focuses on the difference from other embodiments, and the same and similar parts of each embodiment can be referred to each other. As for the device disclosed in the embodiment, since it corresponds to the method disclosed in the embodiment, the description is relatively simple, and for the related information, please refer to the description of the method part.

The above description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention will not be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

sequence listing

<110> Hunan Normal University, Second Xiangya Hospital of Central South University

<120> An RNA probe for detecting 2019-nCOV and its preparation method and application

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 960

<212> RNA

<213> Artificial Sequence

<400> 1

ugugcuugug aaauugucgg uggacaaauu gucaccugug caaaggaaau uaaggagagu 60

guucagacau ucuuuaagcu uguaaauaaa uuuuuggcuu ugugugcuga cucuaucauu 120

auugguggag cuaaacuuaa agccuugaau uuaggugaaa cauuugucac gcacucaaag 180

ggauuguaca gaaagugugu uaaauccaga gaagaaacug gccuacucau gccucuaaaa 240

gccccaaaag aaauuaucuu cuuagaggga gaaacacuuc ccacagaagu guuaacagag 300

gaaguugucu ugaaaacugg ugauuuacaa ccauuagaac aaccuacuag ugaagcuguu 360

gaagcuccau ugguuggac accaguuugu auuaacgggc uuauguugcu cgaaaucaaa 420

gacacagaaa aguacugugc ccuugcaccu aauaugaugg uaacaaacaa uaccuucaca 480

cucaaaggcg gugcaccaac aaagguuacu uuuggugaug acacugugau agaagugcaa 540

gguuacaaga gugugaauau cacuuuugaa cuugaugaaa ggauugauaa aguacuuaau 600

gagaagugcu cugccuauac aguugaacuc gguacagaag uaaaugaguu cgccuguguu 660

guggcagaug cugucauaaa aacuuugcaa ccaguaucug aauuacuuac accacugggc 720

auugauuuag augaguggag uauggcuaca uacuacuuau uugaugaguc uggugaguu 780

aaauuggcuu cacauaugua uuguucuuuc uacccuccag augaggauga agaagaaggu 840

gauugugaag aagaagaguu ugagccauca acucaauaug aguauguac ugaagaugau 900

uaccaaggua aaccuuugga auuuggugcc acuucugccc uauagugagu cguauuacgc 960

<210> 2

<211> 21

<212>DNA

<213> Artificial Sequence

<400> 2

tgtgcttgtg aaattgtcgg t 21

<210> 3

<211> 21

<212>DNA

<213> Artificial Sequence

<400> 3

cagaagtggc accaaattcc a 21

<210> 4

<211> 44

<212>DNA

<213> Artificial Sequence

<400> 4

gcgtaatacg actcactata gggcagaagt ggcaccaaat tcca 44

<210> 5

<211> 937

<212>DNA

<213> Artificial Sequence

<400> 5

tgtgcttgtg aaattgtcgg tggacaaatt gtcacctgtg caaaggaaat taaggagagt 60

gttcagacat tctttaagct tgtaaataaa tttttggctt tgtgtgctga ctctatcatt 120

attggtggag ctaaacttaa agccttgaat ttaggtgaaa catttgtcac gcactcaaag 180

ggattgtaca gaaagtgtgt taaatccaga gaagaaactg gcctactcat gcctctaaaa 240

gccccaaaag aaattatctt cttagaggga gaaacacttc ccacagaagt gttaacagag 300

gaagttgtct tgaaaactgg tgattacaa ccattagaac aacctactag tgaagctgtt 360

gaagctccat tggttggtac accagtttgt attaacgggc ttatgttgct cgaaatcaaa 420

gacacagaaa agtactgtgc ccttgcacct aatatgatgg taacaaacaa taccttcaca 480

ctcaaaggcg gtgcaccaac aaaggttact tttggtgatg acactgtgat agaagtgcaa 540

ggttacaaga gtgtgaatat cacttttgaa cttgatgaaa ggattgataa agtacttaat 600

gagaagtgct ctgcctatac agttgaactc ggtacagaag taaatgagtt cgcctgtgtt 660

gtggcagatg ctgtcataaa aactttgcaa ccagtatctg aattacttac accactgggc 720

attgatttag atgagtggag tatggctaca tactacttat ttgatgagtc tggtgagttt 780

aaattggctt cacatatgta ttgttctttc taccctccag atgaggatga agaagaaggt 840

gattgtgaag aagaagagtt tgagccatca actcaatatg agtatggtac tgaagatgat 900

taccaaggta aacctttgga atttggtgcc acttctg 937

<210> 6

<211> 64

<212>DNA

<213> Artificial Sequence

<400> 6

cccaagctgg ctagttaagc ttggtaccat gtcaacctgt gcttgtgaaa ttgtcggtgg 60

acaa 64

<210> 7

<211> 59

<212>DNA

<213> Artificial Sequence

<400> 7

ctgagatgag tttttgttcg aagggcccag cagcagaagt ggcaccaaat tccaaaggt 59

<210> 8

<211> 225

<212> RNA

<213> Artificial Sequence

<400> 8

cagaaguggc accaaauucc aaagguuuac cuuggaauc aucucagua ccauacucau 60

augaguuga uggcucaaac ucuucuucuu cacaaucacc uucuucuuca uccucaucug 120

gaggguagaa agaacaauac auaugugaag ccaauuuaaa cucaccagac ucaucaaaua 180

aguaguaugu agccauacuc cacucaucua aaucaaugcc cagug 225

<210> 9

<211> 225

<212> RNA

<213> Artificial Sequence

<400> 9

gaccagaaga ucaggaacuc uagaagaauu cagauuuuua acacgagagu aaacguaaaa 60

agaagguuuu acaagacuca cguuaacaau auugcagcag uacgcacaca aucgaagcgc 120

aguaaggaug gcuaguguaa cuagcaagaa uaccacgaaa gcaagaaaaa gaaguacgcu 180

auuaacuauu aacguaaccug ucucuuccga aacgaaugag uacau 225

<210> 10

<211> 112

<212>DNA

<213> Artificial Sequence

<400> 10

tgcttgtgaa attgtcggtg gacaaattgt cacctgtgca aaggaaatta aggagagtgt 60

tcagacattc tttaagcttg taaataaatt tttggctttg tgtgctgact ct 112

<210> 11

<211> 22

<212>DNA

<213> Artificial Sequence

<400> 11

tgcttgtgaa attgtcggtg ga 22

<210> 12

<211> 21

<212>DNA

<213> Artificial Sequence

<400> 12

agagtcagca cacaaagcca a 21

<210> 13

<211> 22

<212>DNA

<213> Artificial Sequence

<400> 13

tgcttgtgaa attgtcggtg gt 22

<210> 14

<211> 22

<212>DNA

<213> Artificial Sequence

<400> 14

tgcttgtgaa attgtcggtg ct 22

<210> 15

<211> 22

<212>DNA

<213> Artificial Sequence

<400> 15

tgcttgtgaa tatgtcggtg ga 22

<210> 16

<211> 22

<212>DNA

<213> Artificial Sequence

<400> 16

tgcttgtgaa aatgtcggtg ga 22

<210> 17

<211> 21

<212>DNA

<213> Artificial Sequence

<400> 17

agagtcagca cacaaagcca t 21

<210> 18

<211> 21

<212>DNA

<213> Artificial Sequence

<400> 18

agagtcagca cacaaagccg t 21

<210> 19

<211> 21

<212>DNA

<213> Artificial Sequence

<400> 19

agagtcagca cagaaagcca a 21

<210> 20

<211> 21

<212>DNA

<213> Artificial Sequence

<400> 20

agagtcagca gtcaaagcca a 21

<210> 21

<211> 937

<212> RNA

<213> Artificial Sequence

<400> 21

cagaaguggc accaaauucc aaagguuuac cuuggaauc aucucagua ccauacucau 60

augaguuga uggcucaaac ucuucuucuu cacaaucacc uucuucuuca uccucaucug 120

gaggguagaa agaacaauac auaugugaag ccaauuuaaa cucaccagac ucaucaaaua 180

aguaguaugu agccauacuc cacucaucua aaucaaugcc caguggugua aguaauucag 240

auacugguug caaaguuuuu augacagcau cugccacaac acaggcgaac ucauuuacuu 300

cuguaccgag uucaacugua uaggcagagc acuucucauu aaguacuuua ucaauccuuu 360

caucaaguuc aaaagugaua uucacacucu uguaaccuug cacuucuauc acagugucau 420

caccaaaagu aaccuuuguu ggugcaccgc cuuugagugu gaagguauug uuuguuacca 480

ucauauuagg ugcaagggca caguacuuuu cugugucuuu gauuucgagc aacauaagcc 540

cguuaauaca aacuggugua ccaaccaaug gagcuucaac agcuucacua guagguuguu 600

cuaaugguug uaaaucacca guuuucaaga caacuuccuc uguuaacacu ucugugggaa 660

guguuucucc cucuaagaag auaauuucuu uuggggcuuu uagaggcaug aguaggccag 720

uuucuucucu ggauuuaaca cacuuucugu acaaucccuu ugagugcgug acaaauguuu 780

caccuaaauu caaggcuuua aguuuagcuc caccaauaau gauagaguca gcacacaaag 840

ccaaaaauuu auuuacaagc uuaaagaaug ucugaacacu cuccuuaauu uccuuugcac 900

aggugacaau uuguccaccg acaauuucac aagcaca 937

<210> 22

<211> 857

<212> RNA

<213> Artificial Sequence

<400> 22

ucuucuucuu cacaaucacc uucuucuuca uccucaucug gaggguagaa agaacaauac 60

auaugugaag ccaauuuaaa cucaccagac ucaucaaaua aguaguaugu agccauacuc 120

cacucaucua aaucaaugcc caguggugua aguaauucag auacugguug caaaguuuuu 180

augacagcau cugccacaac acaggcgaac ucauuuacuu cuguaccgag uucaacugua 240

uaggcagagc acuucucauu aaguacuuua ucaauccuuu caucaaguuc aaaagugaua 300

uucacacucu uguaaccuug cacuucuauc acagugucau caccaaaagu aaccuuuguu 360

ggugcaccgc cuuugagugu gaagguauug uuuguuacca ucauauuagg ugcaagggca 420

caguacuuuu cugugucuuu gauuucgagc aacauaagcc cguuaauaca aacuggugua 480

ccaaccaaug gagcuucaac agcuucacua guagguuguu cuaaugguug uaaaucacca 540

guuuucaaga caacuuccuc uguuaacacu ucugugggaa guguuucucc cucuaagaag 600

auaauuucuu uuggggcuuu uagaggcaug aguaggccag uuucuucucu ggauuuaaca 660

cacuuucugu acaaucccuu ugagugcgug acaaauguuu caccuaaauu caaggcuuua 720

aguuuagcuc caccaauaau gauagaguca gcacacaaag ccaaaaauuu auuuacaagc 780

uuaaagaaug ucugaacacu cuccuuaauu uccuuugcac aggugacau uuguccaccg 840

acaauuucac aagcaca 857

<210> 23

<211> 1072

<212> RNA

<213> Artificial Sequence

<400> 23

uaauugaggu ugaaccucaa caauuguuug aauaguaguu gucugauugu ccucacugcc 60

gucuuguuga ccaacaguuu guugacuauc aucaucuaac caaucuucuu cuugcucuuc 120

uucagguuga agagcagcag aaguggcacc aaauuccaaa gguuuaccuu gguaaucauc 180

uucaguacca uacucauauu gaguugaugg cucaaacucu ucuucuucac aaucaccuuc 240

uucuucaucc ucaucuggag gguagaaaga acaauacaua ugugaagcca auuuaaacuc 300

accagacuca ucaaauaagu aguauguagc cauacuccac ucaucuaaau caaugcccag 360

ugguguaagu aauucagaua cugguugcaa aguuuuuaug acagcaucug ccacaacaca 420

ggcgaacuca uuuacuucug uaccgaguuc aacuguauag gcagagcacu ucucauuaag 480

uacuuuauca auccuuucau caaguucaaa agugauauuc acacucuugu aaccuugcac 540

uucuaucaca gugucaucac caaaaguaac cuuuguuggu gcaccgccuu ugagugugaa 600

gguauuguuu guuaccauca uauuaggugc aagggcacag uacuuuucug ugucuuugau 660

uucgagcaac auaagcccgu uaauacaaac ugguguacca accaauggag cuucaacagc 720

uucacuagua gguuguucua auguuguaa aucaccaguu uucaagacaa cuuccucugu 780

uaacacuucu ggggaagug uuucucccuc uaagaagaua auuucuuuug gggcuuuuag 840

aggcaugagu aggccaguuu cuucucugga uuuaacacac uuucuguaca aucccuuuga 900

gugcgugaca aauguuucac cuaaauucaa ggcuuuaagu uuagcuccac caauaaugau 960

agagucagca cacaaagcca aaaauuuauu uacaagcuua aagaaugucu gaacacucuc 1020

cuuaauuucc uuugcacagg ugacaauuug uccaccgaca auuucacaag ca 1072

<210> 24

<211> 44

<212>DNA

<213> Artificial Sequence

<400> 24

gcgtaatacg actcactata gggtgtgctt gtgaaattgt cggt 44

Claims (5)

1. An RNA probe for detecting 2019-nCOV, characterized in that, the sequence of the RNA probe is as shown in SEQ ID NO.1; the RNA probe is an antisense RNA probe with digoxin labeling Needle. 2. a preparation method of RNA probe, is characterized in that, comprises the steps: 1) Design primers: design primers according to the partial base sequence of the target 2019-nCOV to obtain forward primers and reverse primers; the forward primer is COVID-19-F1, and its sequence is shown in SEQ ID NO.2 ; Before the 5' end of the reverse primer, a T7 RNA polymerase promoter is added, and the obtained reverse primer is COVID-19-R2, and its sequence is as SEQ ID NO.4; 2) Constructing a recombinant plasmid: performing PCR amplification on the partial nucleotide sequence of the target 2019-nCOV, the forward primer used in the PCR amplification is COVID-19-F2, and its sequence is shown in SEQ ID NO.6; The reverse primer used in the PCR amplification is COVID-19-R3, and its sequence is shown in SEQ ID NO.7; using cloning technology, the partial base sequence of the target is connected to the vector to obtain a recombinant plasmid , carry out double enzyme digestion verification on the obtained recombinant plasmid, and judge whether the enzyme digestion results meet expectations; 3) PCR amplification: using the recombinant plasmid with the expected digestion result in step 2) as a template, amplifying it with the above-mentioned forward primer and reverse primer, recovering and purifying the amplified product, and obtaining a DNA template; 4) performing in vitro transcription with the DNA template obtained after step 3), and synthesizing a digoxin-labeled antisense RNA probe, which is an RNA probe for detecting the target; The partial base sequence of the target object is shown in SEQ ID NO.5. 3. The preparation method according to claim 2, characterized in that, in step 1), the carrier used is pGEM-TEasy, and the enzyme used for double digestion is the combination of HindIII and MluI; in step 2), using The vector used was pCDNA3.1 mycHis A, and the enzyme used for double digestion was the combination of Kpn Ⅰ and Apa Ⅰ. 4. An application of an RNA probe in the detection of RNA viruses for non-diagnostic purposes, wherein the RNA virus is a novel coronavirus 2019-nCOV, and the sequence of the RNA probe is as shown in SEQ ID NO.1; The RNA probe is an antisense RNA probe labeled with Digoxigenin. 5. application according to claim 4, is characterized in that, the method for non-diagnostic purpose detection RNA virus comprises the steps: (1) hybridization pretreatment: take the sample to be tested for pretreatment; (2) Pre-hybridization: add the pre-hybridization solution dropwise to the pretreated sample, and put it into a wet box for incubation; (3) Hybridization: blot the pre-hybridization liquid, drop the RNA probe thereinto, and incubate; (4) Post-hybridization treatment: recover the RNA probe incubated overnight, rinse the sample; then add blocking solution to the sample and incubate at room temperature; finally, add Digoxigenin antibody diluted with the blocking solution to obtain a hybridized sample; (5) Color development and photography: add the hybridization sample to the MABT solution of heat-treated lamb serum, wash at room temperature; then wash with MABT and detection buffer respectively; finally add AP substrate staining buffer to it, incubate at room temperature, wrap Protect from light, when the target coloration appears, wash with PBS, observe under a microscope, and take pictures to judge whether there is a positive signal.

Images