CN113308568B - RNA probe for detecting 2019-nCOV, and preparation method and application thereof - Google Patents

Abstract

The invention discloses an RNA probe for detecting 2019-nCOV, wherein the sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 21; the preparation process comprises the following steps: designing a primer, constructing a recombinant plasmid, carrying out PCR amplification, purifying a product and carrying out in vitro transcription; the prepared probe is applied to detection of 2019-nCOV, so that the 2019-nCOV virus nucleic acid can be detected at the single cell level, and the detection sensitivity is improved.

Description

RNA probe for detecting 2019-nCOV, and preparation method and application thereof

Technical Field

The invention relates to the technical field of nucleic acid hybridization, in particular to an RNA probe for detecting 2019-nCOV, and a preparation method and application thereof.

Background

The current methods for identifying novel coronavirus include a fluorescent quantitative PCR method and an antibody detection method, wherein the fluorescent quantitative PCR method for nucleic acid detection is a gold standard for virus detection methods, but the existing methods still have problems such as: (1) Although the fluorescence quantitative PCR method can identify nucleic acid in a suspected patient body, the method needs to extract RNA in cells, then carry out reverse transcription, and then carry out PCR identification, the loss of RNA in the experimental operations is more, and if the suspected patient is in an early infection stage or the virus content in the body is less, the RNA is easily lost in the extraction process, and a false negative result appears; (2) Because the novel coronavirus is an RNA virus, the variation speed of the RNA virus is high, the variation can be accumulated continuously, the requirement of a fluorescent quantitative PCR experiment on a nucleic acid sequence is higher, particularly the requirement on a region covered by a PCR primer is severer, and if the nucleic acid in the region is mutated, the PCR amplification efficiency is reduced and even the nucleic acid cannot be amplified, so that a false negative result is generated; (3) The fluorescent quantitative PCR experiment is not subjected to sequencing identification, and non-target fragments are possibly amplified, so that a false positive phenomenon occurs, and the detection result is inaccurate.

The RNA probe is a single-stranded cDNA or cRNA molecule which is provided with a mark and can be complementarily combined with a corresponding nucleotide sequence in a tissue, and is a promising nucleic acid probe.

Therefore, how to provide a probe capable of effectively detecting 2019-nCoV and apply the probe to the detection of 2019-nCoV is a problem which needs to be solved by the technical personnel in the field.

Disclosure of Invention

In view of the above, the present invention synthesizes an antisense RNA probe with digoxin label based on the base sequence of the novel coronavirus, which can be used for nucleic acid detection of the novel coronavirus and has the advantages of high sensitivity, strong specificity and elimination of false negative results.

In order to achieve the purpose, the invention adopts the following technical scheme:

an RNA probe for detecting 2019-nCOV, wherein the sequence of the RNA probe is shown as SEQ ID NO.1, or as shown as SEQ ID NO:1 by substituting, deleting and/or adding bases and/or modifying the tail end of the sequence to obtain a sequence with homology of more than 90 percent; as a parallel technical scheme of the invention, the sequence of the RNA probe is shown as SEQ ID NO.21, or shown as SEQ ID NO:21 by substitution, deletion and/or addition of bases and/or terminal modification, and has homology of over 90 percent.

As a preferred embodiment of the present invention, the RNA probe has a length of at least 857nt.

As a preferable technical scheme of the invention, the sequence with homology of more than 90 percent obtained by substituting, deleting and/or adding base and/or modifying the tail end of the sequence shown in SEQ ID NO.21 is the sequence shown in SEQ ID NO.22 or SEQ ID NO. 23.

The technical effect achieved by the technical scheme is as follows: so far, in the existing reports, 2019-nCOV contains 149 mutations, and the mutation is in continuous accelerated accumulation, because 937nt of the RNA probe designed by the scheme can be hybridized with a target nucleic acid sequence, and even if 1 or more nucleic acids in the target sequence are mutated, the overall hybridization effect cannot be influenced, the probe can effectively avoid the problem that the fluorescent quantitative PCR detection generates more and more false negative results due to the rapid mutation of the RNA virus.

A preparation method of an RNA probe comprises the following steps:

1) Designing a primer: designing a primer according to a partial base sequence of a target object to obtain a forward primer and a reverse primer;

2) Constructing a recombinant plasmid: performing PCR amplification on a part of base sequence of a target object, connecting the part of base sequence of the target object to a vector by using a cloning technology to obtain a recombinant plasmid, performing double enzyme digestion verification on the obtained recombinant plasmid, and judging whether the enzyme digestion result meets the expectation; the process of double enzyme digestion verification specifically comprises the following steps: carrying out double enzyme digestion on the recombinant plasmid by using two enzymes, judging whether a part of base sequences of the target object are connected into the plasmid or not by gel electrophoresis, and if two bands appear in the electrophoresis and the sizes of the two bands are respectively the sizes of the exogenous target fragment and the vector, the enzyme digestion result is in line with the expectation; if the condition is not the above condition, the enzyme cutting result is not in accordance with expectation;

3) And (3) PCR amplification: taking the recombinant plasmid with the enzyme cutting result in the step 2) meeting the expectation as a template, amplifying the recombinant plasmid by using the forward primer and the reverse primer, and recovering and purifying an amplification product to obtain a DNA template;

4) And (4) carrying out in-vitro transcription by using the DNA template obtained in the step 3) to synthesize an antisense RNA probe with digoxin marks, namely the RNA probe for detecting the target object.

The technical effect achieved by the technical scheme is as follows: in the traditional probe synthesis process, recombinant plasmids need to be subjected to enzyme digestion linearization, purified and recovered, and then amplified in large quantities. The invention directly carries out PCR amplification on the constructed recombinant plasmid so as to obtain a large number of target fragments, and compared with the prior art, the invention omits the processes of bacterial culture, plasmid extraction and identification and enzyme digestion linearization, thereby saving the time cost to the greatest extent. And the target gene is obtained through PCR amplification, and the technology is mature, is not easy to make mistakes, and is high in yield, rapid and efficient.

As a preferable technical scheme of the invention, the target is 2019-nCOV.

As a preferable technical scheme of the invention, the base sequence of the part of 2019-nCOV is shown in SEQ ID NO. 5.

As a preferred technical scheme of the invention, the primer pair of the forward primer and the reverse primer is a scheme I or a scheme II:

the first scheme is as follows: the forward primer is COVID-19-F1, and the sequence of the forward primer is shown in SEQ ID NO. 2; adding a T7 RNA polymerase promoter before the 5' end of the reverse primer, wherein the obtained reverse primer is COVID-19-R2, and the sequence of the reverse primer is shown as SEQ ID NO.4 or SEQ ID NO. 24;

scheme two is as follows: the forward primer is COVID-19-F2, and the sequence of the forward primer is shown in SEQ ID NO. 6; the reverse primer is COVID-19-R3, and the sequence of the reverse primer is shown in SEQ ID NO. 7.

As a preferred technical scheme, the primer pair of the forward primer and the reverse primer is scheme I, the vector is pGEM-T Easy, and the enzyme adopted by double enzyme digestion is the combination of Hind III and Mlu I; when the primer pair of the forward primer and the reverse primer is the second scheme, the vector is pCDNA3.1myc His A, and the enzyme adopted by double enzyme digestion is the combination of Kpn I and Apa I.

As a preferred technical scheme of the invention, the reaction system of the PCR amplification is as follows:

as a preferred technical scheme of the invention, the reaction procedure of the PCR amplification is as follows:

as a preferred technical scheme of the invention, the in vitro transcription system comprises:

as a preferred embodiment of the present invention, the in vitro transcription process comprises:

1) Adding the in vitro transcription system into a 1.5mL EP tube, uniformly mixing, and carrying out water bath at 37 ℃ for 2h;

2) After the water bath is finished, adding DNase for digestion for 15min;

3) The RNA successfully transcribed was purified with RNeasy Mini kit, and the resulting antisense RNA probe with digoxin label was stored at-80 ℃.

The probe prepared by the preparation method is applied to the detection of RNA viruses, and the length of the RNA probe is at least 857nt.

As a preferred technical scheme of the invention, the RNA virus comprises a novel coronavirus 2019-nCOV, a bat coronavirus prc31 strain, a bat coronavirus RacCS203 strain, a bat coronavirus 264 strain, a bat coronavirus 253 strain, a bat coronavirus 224 strain or a pangolin coronavirus MP789 strain.

As a preferable technical scheme of the invention, the method for detecting the RNA viruses such as 2019-nCOV comprises the following steps:

(1) Hybridization pretreatment: taking a sample to be detected for pretreatment;

construction of an overexpression vector (pCMVmyc His3.1A-2019-nCOV plasmid):

(2) Pre-hybridization: dripping 100 μ L of prehybridization solution into the Hek293 cells after passage, covering with a coverslip treated by a siliconizing agent, and putting into a wet box for incubation at 68 ℃ for 60min;

(3) And (3) hybridization: wiping off liquid around the sample, dripping a 50 mu LRNA probe into the liquid, covering a cover glass after the treatment of a siliconizing agent, incubating for 15min at 72 ℃, putting the glass slide with the tissue into a wet box containing HYB + buffer solution, and incubating overnight at 68 ℃;

(4) And (3) post-hybridization treatment: removing the cover glass, and rinsing the sample by sequentially using 50% formamide/2 xSSCT buffer solution preheated at 68 ℃,2 xSSCT buffer solution preheated at 68 ℃ and 0.2 xSSCT buffer solution preheated at 68 ℃ to wash away the residual probe which is not specifically bound, leave the probe which is specifically bound, effectively reduce background staining and obtain better contrast effect; then dropwise adding a blocking solution into the sample, and incubating for 30min at 37 ℃; finally, adding a digoxin antibody diluted by 3000 times by using a new blocking solution, and standing at 4 ℃ overnight to obtain a hybrid sample;

(5) Color development and photography: adding the hybrid sample into MABT solution of 1% heat-treated lamb serum, and washing for 25min at room temperature; washing with MABT for 3 times, 25min each time, and washing with detection buffer for 2 times, 5min each time; and finally adding 100uLAP substrate staining buffer solution, incubating at room temperature, wrapping metal foil in a dark place, washing for 5min each time by PBS (phosphate buffer solution) 2 times after the target is stained, observing by a microscope, taking pictures, and judging whether a positive signal appears.

The technical effect achieved by the technical scheme is as follows: the detection method can effectively avoid the problem of false negative result caused by RNA loss in the fluorescent quantitative PCR detection. Because the in situ hybridization technology does not need to extract RNA in cells, tissues, cells and even single cells can be directly detected, the sensitivity is high, and the required sample is small.

As a preferred embodiment of the present invention, the pre-hybridization solution comprises: 50% formamide, 5 × SSC, 50ug/mL heparin, 5mM EDTA, PH8.0, 50ug/mL ribosomal RNA, 1.84% V/V1M citric acid and 0.1% Tween.

As a preferred technical scheme of the invention, the step of rinsing the sample is as follows: sequentially rinsing with 50% formamide/2 × SSCT buffer solution preheated at 68 deg.C for 2 times, each for 30min; rinsing with preheated 2 × SSCT buffer solution at 68 deg.C for 25min for 1 time; the cells were rinsed 2 times for 30min at 68 ℃ in preheated 0.2 XSSCT buffer.

According to the technical scheme, compared with the prior art, the invention has the following technical effects:

the invention develops the RNA probe which can be specifically hybridized with 2019-nCOV, and the length of the probe is close to or more than 1000bp, so that even if 149 variant sites are generated on the RNA of the new coronavirus, the RNA can be hybridized with most of base sequences of the RNA, the occurrence of false negative results is avoided, and the accuracy of detection results is improved.

In addition, the invention utilizes the in-situ hybridization technology to detect the sample to be detected, only needs to extract the tissue or blood of the patient and directly detects the tissue or blood without extracting RNA in cells, thereby avoiding the loss of RNA and improving the accuracy of the detection result.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art descriptions will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is an electrophoretogram of pGEMT (easy) -COVID-19 recombinant plasmid, pGEMT (easy) vector and viral gene fragment, wherein 1 is the recombinant plasmid, 2 is the pGEMT (easy) vector and viral gene fragment, and M is marker;

FIG. 2 shows a restriction enzyme site map of recombinant plasmid pGEMT (easy) -COVID-19

FIG. 3 is a sequence diagram showing the restriction of recombinant plasmid pGEMT (easy) -COVID-19;

FIG. 4 is an electrophoretogram of amplified products using pGEMT (easy) -COVID-19 as a template and COVID-19-F1 and COVID-19-R2 as primers;

FIG. 5 is an electrophoretogram showing that after PCR amplification was performed using pGEMT (easy) -COVID-19 as a template and COVID-19-F1 and COVID-19-R2 as primers, gel was recovered and purified

FIG. 6 is an electrophoretogram of an antisense RNA probe.

FIG. 7 is a restriction enzyme cleavage site map of the recombinant plasmid pCDNA3.1myc HisA-COVID-19;

FIG. 8 is an electrophoresis diagram of recombinant plasmids pCDNA3.1myc His A-COVID-19, pCDNA3.1myc His A vectors and viral gene fragments, wherein 1 is the recombinant plasmid, 2 is the pCDNA3.1myc His A vector and viral gene fragment, and M is marker;

FIG. 9 is a sequencing diagram showing the cleavage result of the recombinant plasmid pCDNA3.1myc HisA-COVID-19;

FIG. 10 is a graph showing the results of detection of RNA probes;

FIG. 11 is a diagram showing the results of in situ cell hybridization experiments (A, the results of in situ cell hybridization with RNA probe of the present invention; B, the results of in situ fluorescence hybridization with RNA probe of the present invention; C, the results of in situ cell hybridization with shortened RNA probe fragments);

FIG. 12 is a graph of qPCR amplification efficiency after viral mutation;

FIG. 13 shows the site design of the mutated portion of the 2019-nCOV virus (the query above is the wild-type 2019-nCOV sequence, and the sbjct below is the mutated sequence);

FIG. 14 is a diagram showing the results of in situ hybridization experiments on cells after mutation of a target sequence;

FIG. 15 shows the 2019-nCOV virus mutation type sequence.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

Example 1:

a preparation method of an RNA probe for detecting 2019-nCOV comprises the following steps:

1) Designing a primer: designing primers according to a part of base sequence of 2019-COV by using Premier5.0 software and BLAST analysis of NCBI to obtain primers COVID-19-F1 and COVID-19-R1;

COVID-19-F1:5'TGTGCTTGTGAAATTGTCGGT 3' as shown in SEQ ID NO. 2;

COVID-19-R1:5'CAGAAGTGGCACCAAATTCCA 3' as shown in SEQ ID NO. 3;

2) Synthesis of new primers: adding a T7 RNA polymerase promoter before COVID-19-R15' to obtain a primer COVID-19-R2;

COVID-19-R2:5 'GCGTAATACGACTCACTATAGGCAGAAGTGGCACCAAATTCCA3' as shown in SEQ ID NO.4; or 5 'GCGTAATACGACTCACTATAGGGGTGTGCTTGAATTGTCGGT 3' as shown in SEQ ID NO. 24;

3) Construction of recombinant plasmid pGEMT (easy) -COVID-19: connecting the 2019-COV partial base sequence to a pGEMT (easy) vector to obtain a recombinant plasmid pGEMT (easy) -COVID-19, and carrying out enzyme digestion on the recombinant plasmid pGEMT (easy) -COVID-19, wherein the enzyme digestion result is shown in figure 1, and a lane 1 is a recombinant plasmid electrophoresis diagram; lane 2 shows the HindIII and Mlu I double digestion results, pGEM-T Easy is used as the vector, the fragment size of pGEM-T Easy is about 3000bp, the foreign fragment size is about 900bp, and the total length of the recombinant plasmid is 3954bp (as shown in FIG. 2); recovering the enzyme digestion product, and sequencing the enzyme digestion product, wherein the result is shown in figure 3;

4) And (3) PCR amplification: the reaction system of PCR amplification is as follows:

the reaction procedure for PCR amplification was:

using pGEMT (easy) -COVID-19 as a template, using COVID-19-F1 and COVID-19-R2 to amplify the gel product according to the system and the program, and carrying out 2% agarose electrophoresis on the amplified product, wherein the result is shown in figure 4, the amplified product is recovered and purified according to the cutting position of a DNA marker, and the band at 960bp on the gel product is cut according to the DNA marker, namely the band of the required target product; recovering the cut target product band by using a gel recovery kit to obtain a purified PCR amplification product, performing agarose gel electrophoresis on the purified PCR amplification product, and measuring the concentration (30 ng/. Mu.L) of the PCR amplification product to obtain a DNA template, wherein the result is shown in figure 5;

5) The DNA template is utilized to carry out in vitro transcription, and an antisense RNA probe with digoxin marks is synthesized; the in vitro transcription system is as follows:

the transcription process is as follows:

1) Adding the in vitro transcription system into a 1.5mL EP tube, uniformly mixing, and carrying out water bath at 37 ℃ for 2h;

2) After the water bath is finished, adding DNase for digestion for 15min, and then detecting by agarose electrophoresis, as shown in figure 6, because the figure uses DNA marker, DNA is double-stranded, because RNA is single-stranded structure, and digoxin marker is doped in part of U basic groups, the size of RNA in the electrophoresis result is only half of the size of the RNA and is a little more;

3) The RNA successfully transcribed is purified by an RNeasy Mini kit, and finally the antisense RNA probe with the digoxin marker is obtained and stored in the environment of 80 ℃ below zero, as shown in SEQ ID NO. 1.

Wherein, the base sequence of part of 2019-nCOV is shown in SEQ ID NO. 5.

Example 2: construction of an overexpression vector (pCMV myc His3.1A-2019-nCOV plasmid)

1) Designing a primer: designing a primer according to a part of base sequence of 2019-nCOV to obtain primers COVID-19-F2 and COVID-19-R3;

COVID-19-F2:5 'CCCAAGCTGTGCTAGTTAAGCTTGGTACCATGTCAACCTGTGCTTGCTTGTGGAAATTGTCGGTGGACAA 3' as shown in SEQ ID NO. 6;

COVID-19-R3:5 'CTGAGATGAGTTTTTTGTTCGAAGGGCCCAGCAGCAAGAAGTGGCACCAATTCCAAAGGT 3' as shown in SEQ ID No. 7;

2) Construction of recombinant plasmid pCDNA3.1myc His A-COVID-19: carrying out PCR amplification on a part of base sequence of 2019-nCOV, carrying out Kpn I and Apa I double enzyme digestion on the obtained PCR product and an original pCDNA3.1myc His A vector, connecting the part of base sequence of 2019-nCOV to the pCDNA3.1myc His A vector by using a TA cloning technology to obtain a recombinant plasmid pCDNA3.1myc His A-COVID-19 shown in the figure 7, wherein the sequence 1 is a DNA template sequence, carrying out enzyme digestion and sequencing verification on the recombinant plasmid pCDNA3.1myc His A-COVID-19, wherein the enzyme digestion result is shown in the figure 8, wherein a Lane 1 is a recombinant plasmid electrophoresis diagram, a Lane 2 is a Kpn I and Apa I double enzyme digestion result diagram, the vector uses pCDNA3.1myc His A, the DNA3.1myc His A fragment is about 5500bp, the exogenous fragment size is about 900bp, the recombinant plasmid is 1bp shown in the figure 7, recovering the enzyme digestion product, sequencing is carried out, and the fragment is shown in the figure 9;

example 3: application of RNA probe in 2019-nCOV detection

1. Recovery and passage of Hek293 cells

1) Recovery of Hek293 cells:

taking out the frozen Hek293 cells from the liquid nitrogen, putting the cells into a constant-temperature water bath kettle at 37 ℃ for thawing for 1min, and shaking the frozen cells continuously; transferring the melted cell suspension into a preheated fresh DMEM complete culture solution, and lightly blowing and beating for 2 times; centrifuging at 1000rpm for 3min, and discarding the supernatant; 5ml of fresh DMEM complete medium is added and transferred to a new flask, placed at 37 ℃ and 5% CO ₂ Culturing in an incubator; after 24 hours, the culture medium was replaced with a new one, and the subculture was continued.

2) Passage of Hek293 cells

When the confluency of cell growth reaches 95% -100%, the old culture medium is removed by suction, and PBS is added for washing once; adding trypsin, digesting for 30s, and sucking off; adding preheated fresh DMEM to stop digestion, and repeatedly blowing and beating until the mixture is a single cell suspension; the flask was filled with 3ml of fresh DMEM medium, 1ml of cell suspension was added, and the mixture was incubated at 37 ℃ in an incubator containing 5% CO2.

2. Transfection of Hek293 cells with the pCDNA3.1myc His A-COVID-19 plasmid

1) Taking Hek293 cells in a logarithmic phase, digesting the cells by trypsin, adding a DMEM (dimethyl ether medium) without double antibodies to dilute the cells, transferring the cells into a 24-pore plate with 1ml per pore, and replacing a new culture medium after culturing for 24 hours;

2) Transfecting according to a Lipofectamine 2000Reagent kit, taking two 1.5ml centrifuge tubes, respectively adding 250 mu L of Opti-MEM culture medium, and adding pCDNA3.1myc His A-CODV-19 plasmid (2-4 mu g) into one centrifuge tube; adding 6 μ L Lipofectamine 2000 to the other, and incubating at room temperature for 5min;

3) Mixing the two centrifuge tubes, incubating at room temperature for 20min to obtain plasmid-liposome mixture, and adding 1ml of DMEM medium without double antibody;

4) Dripping the above mixture into 24-well plate, mixing, adding CO at 37 deg.C 5% ₂ The incubator of (2).

3. The application of the RNA probe in 2019-nCOV detection comprises the following steps:

1) Pretreatment for hybridization

(1) 200ul protease K (10 ng/. Mu.L) is dripped into the cultured Hek293 cells, and the cells are incubated for 30min at 37 ℃;

(2) Rinsing with PBST solution prepared with DEPC water for 3 times, each time for 5min;

(3) Fixing with 4% paraformaldehyde prepared with DEPC water for 20min;

(4) Rinsing with PBST solution prepared with DEPC water for 3 times, each time for 5min;

2) Prehybridization

200 μ L of prehybridization solution (50% formamide; 2 × SSC 50ug/mL heparin; 5mM EDTA, PH8.0;50ug/mL ribosomal RNA;1.84% V/V1M citric acid (citric acid;0.1% Tween) was added dropwise and the 24-well petri dishes were placed in a 68 ℃ water bath for 60min.

3) Hybridization of

(1) The prehybridization solution was aspirated, 200. Mu.L of the hybridization solution of the present invention (containing 2ng/uL of antisense RNA of digoxin marker, whose sequence is shown in SEQ ID NO. 1) was added dropwise, and the 24-well plate was incubated overnight in a water bath at 68 ℃.

4) Post-hybridization treatment

(1) Sucking out the hybridization solution, adding into 200ul of preheated 50% formamide/2 xSSCT buffer solution at 68 ℃ for washing for 2 times, each time for 30min;

(2) Washing in preheated 2 × SSCT buffer solution at 68 deg.C for 1 time and 30min;

(3) Washing in preheated 0.2 × SSCT buffer solution at 68 deg.C for 2 times, each for 30min;

(4) The liquid was aspirated, blocking solution was added dropwise and incubated at room temperature for 60min.

(5) Digoxin antibody (Anti-Digoxigenin-AP, fab fragments) diluted 3000-fold with new blocking solution was added overnight at 4 ℃.

5) Developing and photographing

(1) Adding into MABT solution of 1% heat-treated lamb serum (heat treated lamb serum), and washing at room temperature for 25min;

(2) Washing with MABT for 25min for 3 times;

(3) Assay buffer (per 50mL solution: 100mM NaCl (1mL 5M); 50mM MgCl2 (2.5mL 1M); 100mM Tris) -HCl (5mL 1M; pH 9.5); 0.1% Tween-20: 1mM levamisole (50 uL 1M)) was washed 2 times for 5min;

(4) Adding 200uL AP substrate staining buffer (every 1mL of detection buffer is added with 4.5uL NBT,3.5uLBCIP (also called X-phosphate) and 4uL levamisole), incubating at room temperature, and wrapping metal foil in dark place;

(5) When the target coloration appeared, washing with PBS for 5min for 2 times to stop the reaction;

(6) And (5) observing by a microscope and taking a picture.

6) Results

FIG. 10, in which the left panel is NC (non-specific control) control, no signal, only very weak background; the right panel shows the results of in situ hybridization 4 hours after cell transfection, with dark blue-purple (indicated by the arrow) as a positive signal and light purple as a negative signal. Both pictures were 40 x magnified.

Example 4:

an RNA probe for detecting 2019-nCOV, the sequence of which is shown in SEQ ID NO. 21. The preparation method of the RNA probe comprises the following steps:

1) Designing a primer: designing primers according to a part of base sequence of 2019-COV by using Premier5.0 software and BLAST analysis of NCBI to obtain primers COVID-19-F1 and COVID-19-R1;

COVID-19-F1:5'TGTGCTTGTGAAATTGTCGGT 3' as shown in SEQ ID NO. 2;

COVID-19-R1:5'CAGAAGTGGCACCAAATTCCA 3' as shown in SEQ ID NO. 3;

2) Synthesis of new primers: adding a T7 RNA polymerase promoter before COVID-19-R15' to obtain a primer COVID-19-R2;

COVID-19-R2:5 'GCGTAATACGACTATCACAGAGGGCAGAAGTGGCACCAAATTCCAA 3' as shown in SEQ ID NO.4; or 5 'GCGTAATACGACTATCACACTATAGGTGTGTGCTTGTGAATTGTCGGT 3' as shown in SEQ ID NO. 24;

3) Construction of recombinant plasmid pGEMT (easy) -COVID-19: connecting the 2019-COV partial base sequence to a pGEMT (easy) vector to obtain a recombinant plasmid pGEMT (easy) -COVID-19, and carrying out enzyme digestion on the recombinant plasmid pGEMT (easy) -COVID-19, wherein the enzyme digestion result is in line with the expectation; recovering the enzyme digestion product, and sequencing the enzyme digestion product;

4) And (3) PCR amplification: the reaction system of PCR amplification is as follows:

the reaction procedure for PCR amplification was:

taking pGEMT (easy) -COVID-19 as a template, amplifying the product by using COVID-19-F1 and COVID-19-R2 according to the system and the program, carrying out 2% agarose electrophoresis on the amplified product, recovering and purifying the amplified product according to the cutting position of a DNAmarker, and cutting a band at the position of 937bp on the gel product according to the DNAmarker to obtain the band of the required target product; recovering the cut target product band by using a gel recovery kit to obtain a purified PCR amplification product, carrying out agarose gel electrophoresis on the purified PCR amplification product, and measuring the concentration (30 ng/mu L) of the purified PCR amplification product to obtain a DNA template;

5) The DNA template is utilized to carry out in vitro transcription, and an antisense RNA probe with digoxin marks is synthesized; the in vitro transcription system is as follows:

the transcription process is as follows:

1) Adding the in vitro transcription system into a 1.5mL EP tube, uniformly mixing, and carrying out water bath at 37 ℃ for 2h;

2) After the water bath is finished, adding DNase for digestion for 15min, and then detecting by agarose electrophoresis;

3) The RNA successfully transcribed was purified with RNeasy Mini kit to obtain an antisense RNA probe with digoxin label, and stored at-80 ℃ as shown in SEQ ID NO. 21.

Wherein, the base sequence of part of 2019-nCOV is shown in SEQ ID NO. 5.

The sequence with homology of more than 90 percent is obtained by substituting, deleting and/or adding base and/or modifying the tail end on the basis of the sequence shown in SEQ ID NO.21, and is shown as SEQ ID NO.22 or SEQ ID NO. 23. The RNA probe sequence shown in SEQ ID NO.22 or SEQ ID NO.23 has the same effect as the sequence shown in SEQ ID NO. 21.

Example 5:

the use of the RNA probe described in example 4 for detecting 2019-nCOV.

1. Detection method

1) Pretreatment for hybridization

(1) 200ul of proteinase K (10 ng/. Mu.L) is dripped into the cultured Hek293 cells, and the cells are incubated for 30min at 37 ℃;

(2) Rinsing with PBST solution prepared with DEPC water for 3 times, each time for 5min;

(3) Fixing with 4% paraformaldehyde prepared with DEPC water for 20min;

(4) Rinsing with PBST solution prepared with DEPC water for 3 times, each for 5min;

2) Prehybridization

200 μ L of prehybridization solution (50% formamide; 2 × SSC 50ug/mL heparin; 5mM EDTA, PH8.0;50ug/mL ribosomal RNA;1.84% V/V1M citric acid (citric acid;0.1% Tween) was added dropwise and the 24-well plates were placed in a 68 ℃ water bath for 60min.

3) Hybridization of

(1) The prehybridization solution was aspirated, 200. Mu.L of the hybridization solution of the present invention (antisense RNA containing 2ng/uL of digoxin marker, whose sequence is shown in SEQ ID NO. 21) was added dropwise, and the 24-well plate was incubated overnight in a water bath at 68 ℃.

4) Post-hybridization treatment

(1) The hybridization solution was aspirated, and washed 2 times for 30min in 50% formamide/2 × SSCT buffer preheated at 200ul 68 ℃;

(2) Washing in 2 × SSCT buffer solution preheated at 68 deg.C for 1 time and 30min;

(3) Washing in preheated 0.2 × SSCT buffer solution at 68 deg.C for 2 times, each for 30min;

(4) The liquid was aspirated, the blocking solution was added dropwise, and incubation was carried out at room temperature for 60min.

(5) Digoxin antibody (Anti-Digoxigenin-AP, fab fragments) diluted 3000-fold with new blocking solution was added overnight at 4 ℃.

5) Developing and photographing

(1) Adding into MABT solution of 1% heat-treated lamb serum (heat treated lamb serum), and washing at room temperature for 25min;

(2) Washing with MABT for 3 times, each for 25min;

(3) Detection buffer (per 50mL solution: 100mM NaCl (1mL 5M); 50mM MgCl2 (2.5mL 1M); 100mM Tris-HCl (5mL 1M; pH 9.5); 0.1% Tween-20 (50 uL 1M)) was washed 2 times for 5min;

(4) Adding 200uLAP substrate staining buffer (every 1mL of detection buffer solution is added with 4.5uLNBT,3.5uLBCIP (also called X-phosphate and 4uL levamisole), incubating at room temperature, and wrapping with metal foil to prevent light;

(5) When the target coloring appeared, washing with PBS for 5min for 2 times to stop the reaction;

(6) The positive signal appears as a result of microscopic observation and photographing.

2. Mutation tolerance of the RNA probes of the invention

The mutation rate of the prior 2019-nCOV is extremely high, the sequence is unstable, the prior RNAscope method is the same as the fluorescent quantitative PCR method, a very specific base sequence is needed, and when the target sequence is mutated, the combination efficiency of the target sequence and the target sequence is obviously reduced and even fails, so that the detection result fails. At present, the number of 2019-nCOV mutation types is more than 6000, one base has mutation on average in 5 bases, if a conventional experimental detection mode is adopted, 50 bases in a target sequence have mutation on average in 10 bases, and in actual detection, if one base has mutation in 50 target sequences, the sensitivity of the method is sharply reduced, and even the detection fails. Such as the mutation types in FIG. 15. The RNA probe sequence claimed by the invention adopts an in-situ hybridization technology, utilizes a method of combining single sequence and long fragment to be combined with a target gene, and even if the target sequence is mutated, the integral combination efficiency is not influenced. Even if a plurality of nucleic acids are mutated in the target sequence, it can hybridize to most of the base sequences of the RNA probe without affecting the overall hybridization effect.

To further verify the tolerance of the RNA probe (the sequence of which is shown in SEQ ID NO. 21) of the invention to the mutation of the part of the base sequence of 2019-nCOV (shown in SEQ ID NO.5, 937 nt), the following experiments were carried out:

experimental design 1: the same RNA probe sequence is used for in situ hybridization experiments by adopting different signal amplification systems. The RNA probe of the invention and a cell in-situ hybridization experiment of a 2019-nCOV partial base sequence (937 nt) are subjected to a digoxin labeling and alkaline phosphatase signal amplification system to obtain a specific and very strong hybridization signal (see figure 11A); the same RNA probe fragment, using fluorescence in situ hybridization assay, no hybridization signal was detected under a fluorescence microscope (see FIG. 11B).

Experimental design 2: the RNA probe of the present invention can obtain a strong hybridization signal using digoxin labeling, an alkaline phosphatase signal amplification system (see FIG. 11A); after the RNA probe fragment is shortened (shown as a sequence shown in SEQ ID NO.8, 255nt, wherein the sequence is an RNA probe sequence with digoxin marks of UTP obtained after the RNA probe is truncated, shown as a sequence shown in SEQ ID NO.9, 255nt, wherein the sequence is an RNA probe sequence combined with the nucleic acid of the 2019-nCOV encoding E protein), the cell in situ hybridization result is negative (shown as a figure 11C).

Experimental design 3: mutation experiment, qPCR experiment detection of mutation amplification efficiency

The wild type plasmid and the mutated plasmid are transfected into HEK293T cells, RNA of the cells is extracted and verified by qPCR, qPCR primers are designed near mutation sites, and 8 groups of mutant primers (respectively represented by m1, m2, m3, m4, r1, r2, r3 and r 4) are designed in total. The qPCR experiment result is shown in figure 13, and the result shows that f is used as a reference (the virus does not have mutation), the PCR amplification efficiency is 100%, when the virus has mutation, signals cannot be completely detected by m1, m2, m3, r1 and r3, and the efficiencies of m4, r2 and r4 are respectively 1%,6% and 4% before mutation, while the in situ hybridization experiment result shows that the RNA probe of the invention is not influenced by nucleic acid mutation and still obtains very strong positive signals (shown in figure 14, right picture), and the experiment proves that the RNA probe of the invention has high tolerance to 2019-nCOV mutation, and the qPCR method is very sensitive to virus mutation and is easy to cause false negative result. By analogy, the size of nucleic acid hybridization is similar to that of qPCR in the conventional short probe binding method, and thus the short probe binding method is also very sensitive to mutation.

Shown as SEQ ID NO.10 is the nucleotide sequence obtained after wild type plasmid qPCR.

Wild type primers (shown as SEQ ID NO. 11-12) adopted in the qPCR experiment:

qPCR-F2：tgcttgtgaaattgtcggtgga；

qPCR-R2：agagtcagcacacaaagccaa；

8 sets of mutant primers used in the qPCR experiments: (capital marked is mutation site, and the sequence is shown as SEQ ID NO. 13-20)

SNP1：qPCR-F2 m1：tgcttgtgaaattgtcggtggT；

SNP2：qPCR-F2 m2：tgcttgtgaaattgtcggtgCT；

SNP3：qPCR-F2 m3：tgcttgtgaaTAtgtcggtgga；

SNP4：qPCR-F2 m4：tgcttgtgaaaAtgtcggtgga；

SNP5：qPCR-R2 r1：agagtcagcacacaaagccaT；

SNP6：qPCR-2 r2：agagtcagcacacaaagccGT；

SNP7：qPCR-2 r3：agagtcagcacaGaaagccaa；

SNP8：qPCR-2 r4：agagtcagcaGTcaaagccaa。

SNP1-SNP8 are forward primers m1-m4 and reverse primers r1-r4 of qPCR experiment respectively. Gene mutations have a very large effect on the amplification efficiency of qPCR, when the mutation site is at the 3 'end of the primer, the effect is very large, and when the mutation site is in the middle of the primer, the effect is also large, but not as large as at the 3' end.

Experimental design 4: in situ hybridization mutation design

Based on the target hybridization sequence (shown as SEQ ID NO.5, 937 nt), we designed an experiment with 2, 3 consecutive base mutations, as shown in FIG. 13, in which 360 bases were truncated and the unmatched base was the mutated base).

Results of the experiments see FIG. 14, the left panel is the experimental control transfected with pCMVB myc hisA empty vector, and the right panel is the results of the in situ hybridization experiments with the RNA probe of the present invention. The results show that: after mutation of the target sequence, the RNA probe of the invention still obtains very strong and specific hybridization signals. Even if the nucleic acid sequence of the target virus generates single or multiple base mutation, the RNA probe still obtains very strong positive signal, and the tolerance of the method to the nucleic acid mutation is higher. The RNA probe of the invention has the advantages of low cost, simple manufacture, good effect and mutation resistance.

The above experiments further prove that the RNA probe (the sequence of which is shown in SEQ ID NO. 21) of the invention has high tolerance to virus mutation, while the qPCR method is very sensitive to virus mutation, which easily causes false negative results. By analogy, the size of nucleic acid hybridization is similar to that of qPCR in the conventional short probe binding method, and thus the short probe binding method is also very sensitive to mutation. Therefore, the present invention is significantly superior to conventional methods for new coronaviruses with very high mutation frequency.

According to the detection principle of the RNA probe, the sequence shown in SEQ ID NO.21 can reach equivalent effect in the detection of viruses such as bat coronavirus prc31 strain, bat coronavirus RacCS203 strain, bat coronavirus 264 strain, bat coronavirus 253 strain, bat coronavirus 224 strain or pangolin coronavirus MP789 strain and the like.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other. The device disclosed by the embodiment corresponds to the method disclosed by the embodiment, so that the description is simple, and the relevant points can be referred to the method part for description.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Hunan university, xiangya II Hospital

<120> RNA probe for detecting 2019-nCOV, and preparation method and application thereof

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 960

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ugugcuugug aaauugucgg uggacaaauu gucaccugug caaaggaaau uaaggagagu 60

guucagacau ucuuuaagcu uguaaauaaa uuuuuggcuu ugugugcuga cucuaucauu 120

auugguggag cuaaacuuaa agccuugaau uuaggugaaa cauuugucac gcacucaaag 180

ggauuguaca gaaagugugu uaaauccaga gaagaaacug gccuacucau gccucuaaaa 240

gccccaaaag aaauuaucuu cuuagaggga gaaacacuuc ccacagaagu guuaacagag 300

gaaguugucu ugaaaacugg ugauuuacaa ccauuagaac aaccuacuag ugaagcuguu 360

gaagcuccau ugguugguac accaguuugu auuaacgggc uuauguugcu cgaaaucaaa 420

gacacagaaa aguacugugc ccuugcaccu aauaugaugg uaacaaacaa uaccuucaca 480

cucaaaggcg gugcaccaac aaagguuacu uuuggugaug acacugugau agaagugcaa 540

gguuacaaga gugugaauau cacuuuugaa cuugaugaaa ggauugauaa aguacuuaau 600

gagaagugcu cugccuauac aguugaacuc gguacagaag uaaaugaguu cgccuguguu 660

guggcagaug cugucauaaa aacuuugcaa ccaguaucug aauuacuuac accacugggc 720

auugauuuag augaguggag uauggcuaca uacuacuuau uugaugaguc uggugaguuu 780

aaauuggcuu cacauaugua uuguucuuuc uacccuccag augaggauga agaagaaggu 840

gauugugaag aagaagaguu ugagccauca acucaauaug aguaugguac ugaagaugau 900

uaccaaggua aaccuuugga auuuggugcc acuucugccc uauagugagu cguauuacgc 960

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgtgcttgtg aaattgtcgg t 21

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cagaagtggc accaaattcc a 21

<210> 4

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcgtaatacg actcactata gggcagaagt ggcaccaaat tcca 44

<210> 5

<211> 937

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgtgcttgtg aaattgtcgg tggacaaatt gtcacctgtg caaaggaaat taaggagagt 60

gttcagacat tctttaagct tgtaaataaa tttttggctt tgtgtgctga ctctatcatt 120

attggtggag ctaaacttaa agccttgaat ttaggtgaaa catttgtcac gcactcaaag 180

ggattgtaca gaaagtgtgt taaatccaga gaagaaactg gcctactcat gcctctaaaa 240

gccccaaaag aaattatctt cttagaggga gaaacacttc ccacagaagt gttaacagag 300

gaagttgtct tgaaaactgg tgatttacaa ccattagaac aacctactag tgaagctgtt 360

gaagctccat tggttggtac accagtttgt attaacgggc ttatgttgct cgaaatcaaa 420

gacacagaaa agtactgtgc ccttgcacct aatatgatgg taacaaacaa taccttcaca 480

ctcaaaggcg gtgcaccaac aaaggttact tttggtgatg acactgtgat agaagtgcaa 540

ggttacaaga gtgtgaatat cacttttgaa cttgatgaaa ggattgataa agtacttaat 600

gagaagtgct ctgcctatac agttgaactc ggtacagaag taaatgagtt cgcctgtgtt 660

gtggcagatg ctgtcataaa aactttgcaa ccagtatctg aattacttac accactgggc 720

attgatttag atgagtggag tatggctaca tactacttat ttgatgagtc tggtgagttt 780

aaattggctt cacatatgta ttgttctttc taccctccag atgaggatga agaagaaggt 840

gattgtgaag aagaagagtt tgagccatca actcaatatg agtatggtac tgaagatgat 900

taccaaggta aacctttgga atttggtgcc acttctg 937

<210> 6

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cccaagctgg ctagttaagc ttggtaccat gtcaacctgt gcttgtgaaa ttgtcggtgg 60

acaa 64

<210> 7

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctgagatgag tttttgttcg aagggcccag cagcagaagt ggcaccaaat tccaaaggt 59

<210> 8

<211> 225

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cagaaguggc accaaauucc aaagguuuac cuugguaauc aucuucagua ccauacucau 60

auugaguuga uggcucaaac ucuucuucuu cacaaucacc uucuucuuca uccucaucug 120

gaggguagaa agaacaauac auaugugaag ccaauuuaaa cucaccagac ucaucaaaua 180

aguaguaugu agccauacuc cacucaucua aaucaaugcc cagug 225

<210> 9

<211> 225

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gaccagaaga ucaggaacuc uagaagaauu cagauuuuua acacgagagu aaacguaaaa 60

agaagguuuu acaagacuca cguuaacaau auugcagcag uacgcacaca aucgaagcgc 120

aguaaggaug gcuaguguaa cuagcaagaa uaccacgaaa gcaagaaaaa gaaguacgcu 180

auuaacuauu aacguaccug ucucuuccga aacgaaugag uacau 225

<210> 10

<211> 112

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgcttgtgaa attgtcggtg gacaaattgt cacctgtgca aaggaaatta aggagagtgt 60

tcagacattc tttaagcttg taaataaatt tttggctttg tgtgctgact ct 112

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgcttgtgaa attgtcggtg ga 22

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agagtcagca cacaaagcca a 21

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tgcttgtgaa attgtcggtg gt 22

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tgcttgtgaa attgtcggtg ct 22

<210> 15

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tgcttgtgaa tatgtcggtg ga 22

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tgcttgtgaa aatgtcggtg ga 22

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

agagtcagca cacaaagcca t 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

agagtcagca cacaaagccg t 21

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

agagtcagca cagaaagcca a 21

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

agagtcagca gtcaaagcca a 21

<210> 21

<211> 937

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

cagaaguggc accaaauucc aaagguuuac cuugguaauc aucuucagua ccauacucau 60

auugaguuga uggcucaaac ucuucuucuu cacaaucacc uucuucuuca uccucaucug 120

gaggguagaa agaacaauac auaugugaag ccaauuuaaa cucaccagac ucaucaaaua 180

aguaguaugu agccauacuc cacucaucua aaucaaugcc caguggugua aguaauucag 240

auacugguug caaaguuuuu augacagcau cugccacaac acaggcgaac ucauuuacuu 300

cuguaccgag uucaacugua uaggcagagc acuucucauu aaguacuuua ucaauccuuu 360

caucaaguuc aaaagugaua uucacacucu uguaaccuug cacuucuauc acagugucau 420

caccaaaagu aaccuuuguu ggugcaccgc cuuugagugu gaagguauug uuuguuacca 480

ucauauuagg ugcaagggca caguacuuuu cugugucuuu gauuucgagc aacauaagcc 540

cguuaauaca aacuggugua ccaaccaaug gagcuucaac agcuucacua guagguuguu 600

cuaaugguug uaaaucacca guuuucaaga caacuuccuc uguuaacacu ucugugggaa 660

guguuucucc cucuaagaag auaauuucuu uuggggcuuu uagaggcaug aguaggccag 720

uuucuucucu ggauuuaaca cacuuucugu acaaucccuu ugagugcgug acaaauguuu 780

caccuaaauu caaggcuuua aguuuagcuc caccaauaau gauagaguca gcacacaaag 840

ccaaaaauuu auuuacaagc uuaaagaaug ucugaacacu cuccuuaauu uccuuugcac 900

aggugacaau uuguccaccg acaauuucac aagcaca 937

<210> 22

<211> 857

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ucuucuucuu cacaaucacc uucuucuuca uccucaucug gaggguagaa agaacaauac 60

auaugugaag ccaauuuaaa cucaccagac ucaucaaaua aguaguaugu agccauacuc 120

cacucaucua aaucaaugcc caguggugua aguaauucag auacugguug caaaguuuuu 180

augacagcau cugccacaac acaggcgaac ucauuuacuu cuguaccgag uucaacugua 240

uaggcagagc acuucucauu aaguacuuua ucaauccuuu caucaaguuc aaaagugaua 300

uucacacucu uguaaccuug cacuucuauc acagugucau caccaaaagu aaccuuuguu 360

ggugcaccgc cuuugagugu gaagguauug uuuguuacca ucauauuagg ugcaagggca 420

caguacuuuu cugugucuuu gauuucgagc aacauaagcc cguuaauaca aacuggugua 480

ccaaccaaug gagcuucaac agcuucacua guagguuguu cuaaugguug uaaaucacca 540

guuuucaaga caacuuccuc uguuaacacu ucugugggaa guguuucucc cucuaagaag 600

auaauuucuu uuggggcuuu uagaggcaug aguaggccag uuucuucucu ggauuuaaca 660

cacuuucugu acaaucccuu ugagugcgug acaaauguuu caccuaaauu caaggcuuua 720

aguuuagcuc caccaauaau gauagaguca gcacacaaag ccaaaaauuu auuuacaagc 780

uuaaagaaug ucugaacacu cuccuuaauu uccuuugcac aggugacaau uuguccaccg 840

acaauuucac aagcaca 857

<210> 23

<211> 1072

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

uaauugaggu ugaaccucaa caauuguuug aauaguaguu gucugauugu ccucacugcc 60

gucuuguuga ccaacaguuu guugacuauc aucaucuaac caaucuucuu cuugcucuuc 120

uucagguuga agagcagcag aaguggcacc aaauuccaaa gguuuaccuu gguaaucauc 180

uucaguacca uacucauauu gaguugaugg cucaaacucu ucuucuucac aaucaccuuc 240

uucuucaucc ucaucuggag gguagaaaga acaauacaua ugugaagcca auuuaaacuc 300

accagacuca ucaaauaagu aguauguagc cauacuccac ucaucuaaau caaugcccag 360

ugguguaagu aauucagaua cugguugcaa aguuuuuaug acagcaucug ccacaacaca 420

ggcgaacuca uuuacuucug uaccgaguuc aacuguauag gcagagcacu ucucauuaag 480

uacuuuauca auccuuucau caaguucaaa agugauauuc acacucuugu aaccuugcac 540

uucuaucaca gugucaucac caaaaguaac cuuuguuggu gcaccgccuu ugagugugaa 600

gguauuguuu guuaccauca uauuaggugc aagggcacag uacuuuucug ugucuuugau 660

uucgagcaac auaagcccgu uaauacaaac ugguguacca accaauggag cuucaacagc 720

uucacuagua gguuguucua augguuguaa aucaccaguu uucaagacaa cuuccucugu 780

uaacacuucu gugggaagug uuucucccuc uaagaagaua auuucuuuug gggcuuuuag 840

aggcaugagu aggccaguuu cuucucugga uuuaacacac uuucuguaca aucccuuuga 900

gugcgugaca aauguuucac cuaaauucaa ggcuuuaagu uuagcuccac caauaaugau 960

agagucagca cacaaagcca aaaauuuauu uacaagcuua aagaaugucu gaacacucuc 1020

cuuaauuucc uuugcacagg ugacaauuug uccaccgaca auuucacaag ca 1072

<210> 24

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gcgtaatacg actcactata gggtgtgctt gtgaaattgt cggt 44

Claims (5)

1. An RNA probe for detecting 2019-nCOV is characterized in that the sequence of the RNA probe is shown as SEQ ID NO. 1; the RNA probe is an antisense RNA probe with digoxin labels.

2. A method for preparing an RNA probe, which is characterized by comprising the following steps:

1) Designing a primer: designing a primer according to a partial base sequence of the target 2019-nCOV to obtain a forward primer and a reverse primer; the forward primer is COVID-19-F1, and the sequence of the forward primer is shown as SEQ ID NO. 2; adding a T7 RNA polymerase promoter before the 5' end of the reverse primer to obtain a reverse primer COVID-19-R2, wherein the sequence of the reverse primer is shown as SEQ ID NO.4;

2) Constructing a recombinant plasmid: performing PCR amplification on a part of base sequence of the target object 2019-nCOV, wherein a forward primer adopted by the PCR amplification is COVID-19-F2, and the sequence of the forward primer is shown as SEQ ID NO. 6; the reverse primer adopted by the PCR amplification is COVID-19-R3, and the sequence of the reverse primer is shown as SEQ ID NO. 7; connecting a part of base sequence of the target object to a vector by using a cloning technology to obtain a recombinant plasmid, carrying out double enzyme digestion verification on the obtained recombinant plasmid, and judging whether an enzyme digestion result is in accordance with expectation;

3) And (3) PCR amplification: taking the recombinant plasmid with the enzyme cutting result in the step 2) meeting the expectation as a template, amplifying the recombinant plasmid by using the forward primer and the reverse primer, and recovering and purifying an amplification product to obtain a DNA template;

4) Carrying out in vitro transcription by using the DNA template obtained in the step 3) to synthesize an antisense RNA probe with a digoxin label, namely an RNA probe for detecting a target object;

the partial base sequence of the target object is shown as SEQ ID NO. 5.

3. The method according to claim 2, wherein in step 1), the vector used is pGEM-T Easy, and the enzyme used for the double digestion is a combination of HindIII and Mlu I; in step 2), the vector used was pCDNA3.1myc His A and the enzyme used for the double digestion was a combination of Kpn I and Apa I.

4. The application of the RNA probe in the detection of RNA viruses for non-diagnostic purposes is characterized in that the RNA viruses are novel coronavirus 2019-nCOV, and the sequence of the RNA probe is shown as SEQ ID NO. 1; the RNA probe is an antisense RNA probe with digoxin labels.

5. Use according to claim 4, wherein the method for the detection of RNA viruses for non-diagnostic purposes comprises the following steps:

(1) Hybridization pretreatment: taking a sample to be detected for pretreatment;

(2) Pre-hybridization: dripping a pre-hybridization solution into the pretreated sample, and putting the sample into a wet box for incubation;

(3) And (3) hybridization: sucking the prehybridization solution to be dry, dripping the RNA probe into the prehybridization solution, and incubating;

(4) And (3) post-hybridization treatment: recovering the overnight incubated RNA probe, and rinsing the sample; adding a blocking solution into the sample, and incubating at room temperature; finally, adding a digoxin antibody newly diluted by the blocking solution to obtain a hybrid sample;

(5) Color development and photography: adding the hybridization sample into MABT solution of heat-treated lamb serum, and washing at room temperature; washing with MABT and detection buffer solution; and finally, adding an AP substrate staining buffer solution, incubating at room temperature, wrapping in dark place, washing with PBS after the target is stained, observing under a microscope, taking a picture, and judging whether a positive signal appears.

Images