CN113307876B - Monoclonal antibody SZ175 of antihuman von willebrand factor leader peptide and application thereof - Google Patents

Abstract

The invention discloses a leader peptide monoclonal antibody SZ175 of an anti-human von willebrand factor and application thereof, wherein the monoclonal antibody SZ175 belongs to IgG1 subclass antibody and is generated by a hybridoma cell strain SZ175 (2B 10); wherein the preservation number of the hybridoma cell strain SZ175 (2B 10) is CCTCC NO: C2019272; the monoclonal antibody SZ175 can be specifically combined with a recombinant human VWF D1D2 region protein. Compared with the prior art, the invention has the following advantages: (1) Compared with the prior art, the monoclonal antibody can save time, has low requirements on detection and the detection, and is convenient to apply in various laboratories and clinics; (2) The kit constructed by the application is beneficial to popularization and application, can be obtained from a regular channel after industrialization, and provides convenience for the research and clinical application in the field in China.

Description

Monoclonal antibody SZ175 of antihuman von willebrand factor leader peptide and application thereof

Technical Field

The invention belongs to the field of immunology, and relates to a monoclonal antibody, in particular to an anti-human von willebrand factor leader peptide monoclonal antibody SZ175 and application thereof.

Background

Von Willebrand Factor (VWF) is an important plasma membrane glycoprotein in plasma that is involved in the process of hemostasis and coagulation, and it can mediate adhesion of platelets to damaged blood vessel walls, and is a carrier of coagulation Factor (Factor VIII), FVIII, which stabilizes and protects FVIII from degradation, prolonging the half-life of FVIII. VWF is expressed in endothelial cells and megakaryocytes, and the synthesized VWF undergoes numerous post-translational modifications, including dimerization, glycosylation, polymerization of heterodimers, cleavage of leader peptides, and thiolation modification, before leaving the endothelial cells. Most of the synthetic VWF is secreted by the constitutive pathway, the remainder being stored in weibull-Palade bodies (WPB) of endothelial cells and the alpha-granules of platelets. The constitutively released part of VWF is not completely proteolyzed due to its limited multimerization and poor function. In contrast, VWF released through regulatory pathways is proteolytically fully processed and consists of high molecular weight multimers with biological activity. The human von willebrand factor leader peptide (VWF propeptide, VWFpp) comprises two domains D1 and D2, 741 amino acids, 32 cysteines per D region, which can form intra-or interchain disulfide bonds and play an important role in VWF multimerization. The role of VWFpp in VWF transport and secretion is widely studied, but some functions are yet to be further elucidated. The research of the VWFPP monoclonal antibody is a good tool for researching the action mechanism and function of the VWFPP.

Therefore, the development of an anti-human VWFPP monoclonal antibody is of great importance for establishing an effective method for detecting VWFPP. At present, the VWFPP is detected internationally by mainly adopting a kit from Holland Amsterdam, and the VWFPP belongs to a clinical detection kit due to high price, can not be obtained at home in a formal way, is not beneficial to popularization and application, and seriously influences the research and clinical application in the field at home.

Disclosure of Invention

The technical problem to be solved is as follows: in order to overcome the defects of the prior art, the invention obtains the protein of the human hemophilia factor leader peptide VWF D1D2 region and a monoclonal antibody aiming at the region through a eukaryotic expression system, the antibody can specifically recognize VWFp in plasma, but does not recognize mature VWF without the leader peptide, thereby constructing a hemophilia typing diagnosis method or a diagnosis method of endothelial cell injury related diseases through detecting the antibody; in view of this, the invention provides an antihuman von willebrand factor leader peptide monoclonal antibody SZ175 and application thereof.

The technical scheme is as follows: an anti-human von willebrand factor leader peptide monoclonal antibody SZ175, wherein the monoclonal antibody SZ175 belongs to IgG1 subclass antibody and is produced by a hybridoma cell strain SZ175 (2B 10); wherein the preservation number of the hybridoma cell strain SZ175 (2B 10) is CCTCC NO: C2019272; the monoclonal antibody SZ175 can be specifically combined with a recombinant human VWF D1D2 region protein.

The preparation method of the hybridoma cell strain SZ175 comprises the following steps:

(1) Balb/C mice were immunized in a conventional manner using a recombinant human von Willebrand factor VWF leader peptide (D1D 2 domain) protein as an immunogen;

(2) Obtaining a fused cell growth clone: taking splenocytes of an immune qualified mouse aseptically as B cells sensitized by antigen, fusing the B cells with myeloma cells SP2/0 strain according to a conventional method, and then screening by utilizing a conventional fusion cell HAT screening method to further obtain the growth clone of the fusion cells;

(3) After biochemical and immunological techniques such as ELISA method and Western immunoblotting are used for screening and identification, the hybridoma cell strain SZ175 (2B 10) with high antibody secretion level is selected.

In the preparation method of the hybridoma cell strain SZ175, recombinant human hemophilia factor VWF leader peptide (D1D 2 region) protein is used as immunogen to immunize female Balb/c mice with the age of 8 weeks for three times at intervals of 4 weeks; detecting the existence and concentration of monoclonal antibody in the serum of the immunized animal by an ELISA method; after completion of the immunization, selecting a mouse producing antiserum at a sufficiently high concentration, isolating the spleen of the animal and preparing a spleen cell suspension; the resulting mouse spleen cells were fused with myeloma to prepare hybridoma cell lines that can be continuously passaged and secrete monoclonal antibodies against von Willebrand factor leader peptide (VWFpp) according to known hybridoma techniques (see: K \466, nature,215, 495-497, 1975, K \466, hler et al, immunology Today, 4.

The preservation information of the hybridoma cell line is as follows: the preservation unit: china Center for Type Culture Collection (CCTCC for short); address: the Wuhan university Collection in the Wuchang area of Wuhan city, hubei province (opposite to the first subsidiary school of Wuhan university); the preservation date is 2019, 11 and 26 months; the preservation number is CCTCC NO of C2019272; and (3) classification and naming: hybridoma cell line SZ175 (2B 10).

The method for producing the monoclonal antibody by adopting the hybridoma cell strain SZ175 (2B 10) comprises the following steps:

the method comprises the following steps: inoculating the hybridoma cells into a hybridoma culture solution, and separating and purifying the culture solution after culture to obtain the required specific monoclonal antibody against von willebrand factor leader peptide.

The second method comprises the following steps: inoculating the hybridoma cells into abdominal cavity of the animal, separating and purifying the ascites fluid of the animal to obtain the required monoclonal antibody of the specific anti-von willebrand factor leader peptide.

The immunoglobulin (IgG) concentration is measured and calculated by an ultraviolet spectrophotometer, and the specificity of the obtained monoclonal antibody can be further detected by an immunoblotting method (Western-Blot). The monoclonal antibody of the invention belongs to IgG1 subclass antibody through immune double diffusion detection. ELISA detection results show that the monoclonal antibody can be specifically combined with a recombinant human VWF D1D2 region (VDD) protein.

Preferably, the recombinant human VWF D1D2 domain protein is a reducing VWF leader peptide.

Preferably, monoclonal antibody SZ175 is bound to the protein with the reducing VWF leader peptide at a molecular weight of 90KDa.

The application of any one of the antihuman von willebrand factor leader peptide monoclonal antibodies SZ175 in preparing a von willebrand disease typing detection kit.

The application of any of the antihuman von willebrand factor leader peptide monoclonal antibody SZ175 in preparing a kit for prognosis detection of endothelial cell damage diseases.

Preferably, the endothelial cell damage disease is myocardial infarction or bone marrow transplantation.

The application principle of the kit is as follows: combining a specific antibody SZ176 on a solid phase carrier to form a solid phase antibody, then combining with a corresponding VWF leader peptide antigen in the plasma to be detected to form an immune complex, washing, adding an enzyme-labeled antibody HRP-SZ175, combining with the antigen in the immune complex to form an enzyme-labeled antibody-antigen-solid phase antibody complex, adding a substrate for color development, and judging the antigen content. The specific method comprises the following steps:

first, the monoclonal antibody SZ175 was labeled with horseradish peroxidase (HRP).

Next, the monoclonal antibody SZ176 was coated on a 96-well plate in a carbonate buffer at 4 ℃ overnight. After washing the plates, blocking was performed with 2% bovine serum albumin BSA at 37 ℃ for 1h.

Again, the mixed normal human plasma was diluted as a standard in a gradient, and the ratio of patient or normal human plasma 1. Incubate at 37 ℃ for 2h. After washing, diluted HRP-SZ175 was added and incubated at 37 ℃ for 1h.

Finally, the plate is washed, developed with chromogenic substrate TMB, the reaction is stopped with 2M sulfuric acid, read and fitted to a standard curve, and the data are analyzed.

Has the advantages that: (1) The monoclonal antibody can specifically recognize VWFPP in blood plasma, and is combined with an enzyme labeling method to construct a method for hemophilia typing diagnosis or diagnosis of endothelial cell injury related diseases, so that compared with the prior art, the method saves time, has low requirements on detection and the detection, and is convenient to apply in various laboratories and clinics; (2) The kit constructed by the application is beneficial to popularization and application, can be obtained from a regular channel after industrialization, and provides convenience for the research and clinical application in the field in China.

Drawings

FIG. 1 is a constructed electrophoresis diagram of the eukaryotic expression plasmid of recombinant VDD after double enzyme digestion;

FIG. 2 shows that Western blot identifies VDD protein expressed recombinantly;

FIG. 3 is an electrophoretogram and Western blot identification profiles of 10% SDS-PAGE identification analysis of purified recombinant VDD protein;

FIG. 4 shows the binding between ascites and VDD in mice detected by ELISA;

FIG. 5 is a Western blot to identify the specificity of VWFpp antibody binding to antigen;

FIG. 6 is the establishment of a standard curve for ELISA double antibody sandwich method;

FIG. 7 is a test of VWFpp before and after transplantation in a bone marrow transplant patient.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications and substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and substance of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1: preparation of immunogen-recombinant human von Willebrand factor D1D2 region (VDD) protein

(1) PCR primer design and Synthesis: designing and synthesizing a pair of primers respectively positioned at the upstream and downstream sides of a cDNA sequence (2223 bp) of a VWF-D1D2 region (amino acids 23-763),

upstream primer, SEQ ID No.1:5' AGATATCGCAGAAAAACTCGC-3 ', wherein the 5' end contains an EcoRV enzyme cutting site;

downstream primer, SEQ ID No.2:5' CGGGCCCTCTTTGTCTGCGA-3 ', the 5' end of which contains ApaI enzyme cutting site; and performing PCR amplification by using the primers and VWF full-length cDNA as a template to obtain a PCR product.

(2) Cloning and sequence analysis of the genes of interest: and directly connecting the purified PCR product with an expression vector pSecTag2B vector (Tag containing 6 XHis) under the action of T4 DNA ligase to obtain the pSecTag2B-VWF-D1D2 recombinant plasmid. Escherichia coli DH 5. Alpha. Competence was transformed with the resulting recombinant plasmid, plated on LB plates, and screened for ampicillin. And (3) determining the DNA sequence by using a full-automatic sequencer with the recombinant plasmid as a template, wherein the determined DNA sequence of the cloned fragment is completely consistent with the known VWF-D1D2 region cDNA sequence, and further indicating that the cloned D1D2 region gene fragment is correct.

The full length of the cDNA sequence for coding and expressing the human VWF-D1D2 region is 2223bp, and the specific sequence of the base sequence shown in SEQ ID NO.3 is as follows:

GCAGAAGGAACTCGCGGCAGGTCATCCACGGCCCGATGCAGCCTTTTCGGAA GTGACTTCGTCAACACCTTTGATGGGAGCATGTACAGCTTTGCGGGATACTGC AGTTACCTCCTGGCAGGGGGCTGCCAGAAACGCTCCTTCTCGATTATTGGGGA CTTCCAGAATGGCAAGAGAGTGAGCCTCTCCGTGTATCTTGGGGAATTTTTTG ACATCCATTTGTTTGTCAATGGTACCGTGACACAGGGGGACCAAAGAGTCTCC ATGCCCTATGCCTCCAAAGGGCTGTATCTAGAAACTGAGGCTGGGTACTACAA GCTGTCCGGTGAGGCCTATGGCTTTGTGGCCAGGATCGATGGCAGCGGCAAC TTTCAAGTCCTGCTGTCAGACAGATACTTCAACAAGACCTGCGGGCTGTGTG GCAACTTTAACATCTTTGCTGAAGATGACTTTATGACCCAAGAAGGGACCTTG ACCTCGGACCCTTATGACTTTGCCAACTCATGGGCTCTGAGCAGTGGAGAAC AGTGGTGTGAACGGGCATCTCCTCCCAGCAGCTCATGCAACATCTCCTCTGGG GAAATGCAGAAGGGCCTGTGGGAGCAGTGCCAGCTTCTGAAGAGCACCTCG GTGTTTGCCCGCTGCCACCCTCTGGTGGACCCCGAGCCTTTTGTGGCCCTGTG TGAGAAGACTTTGTGTGAGTGTGCTGGGGGGCTGGAGTGCGCCTGCCCTGCC CTCCTGGAGTACGCCCGGACCTGTGCCCAGGAGGGAATGGTGCTGTACGGCT GGACCGACCACAGCGCGTGCAGCCCAGTGTGCCCTGCTGGTATGGAGTATAG GCAGTGTGTGTCCCCTTGCGCCAGGACCTGCCAGAGCCTGCACATCAATGAA ATGTGTCAGGAGCGATGCGTGGATGGCTGCAGCTGCCCTGAGGGACAGCTCC TGGATGAAGGCCTCTGCGTGGAGAGCACCGAGTGTCCCTGCGTGCATTCCGG AAAGCGCTACCCTCCCGGCACCTCCCTCTCTCGAGACTGCAACACCTGCATTT GCCGAAACAGCCAGTGGATCTGCAGCAATGAAGAATGTCCAGGGGAGTGCCT TGTCACAGGTCAATCACACTTCAAGAGCTTTGACAACAGATACTTCACCTTCA GTGGGATCTGCCAGTACCTGCTGGCCCGGGATTGCCAGGACCACTCCTTCTCC ATTGTCATTGAGACTGTCCAGTGTGCTGATGACCGCGACGCTGTGTGCACCCG CTCCGTCACCGTCCGGCTGCCTGGCCTGCACAACAGCCTTGTGAAACTGAAG CATGGGGCAGGAGTTGCCATGGATGGCCAGGACGTCCAGCTCCCCCTCCTGA AAGGTGACCTCCGCATCCAGCATACAGTGACGGCCTCCGTGCGCCTCAGCTA CGGGGAGGACCTGCAGATGGACTGGGATGGCCGCGGGAGGCTGCTGGTGAA GCTGTCCCCCGTCTATGCCGGGAAGACCTGCGGCCTGTGTGGGAATTACAATG GCAACCAGGGCGACGACTTCCTTACCCCCTCTGGGCTGGCGGAGCCCCGGGT GGAGGACTTCGGGAACGCCTGGAAGCTGCACGGGGACTGCCAGGACCTGCA GAAGCAGCACAGCGATCCCTGCGCCCTCAACCCGCGCATGACCAGGTTCTCC GAGGAGGCGTGCGCGGTCCTGACGTCCCCCACATTCGAGGCCTGCCATCGTG CCGTCAGCCCGCTGCCCTACCTGCGGAACTGCCGCTACGACGTGTGCTCCTGC TCGGACGGCCGCGAGTGCCTGTGCGGCGCCCTGGCCAGCTATGCCGCGGCCT GCGCGGGGAGAGGCGTGCGCGTCGCGTGGCGCGAGCCAGGCCGCTGTGAGC TGAACTGCCCGAAAGGCCAGGTGTACCTGCAGTGCGGGACCCCCTGCAACCT GACCTGCCGCTCTCTCTCTTACCCGGATGAGGAATGCAATGAGGCCTGCCTGG AGGGCTGCTTCTGCCCCCCAGGGCTCTACATGGATGAGAGGGGGGACTGCGT GCCCAAGGCCCAGTGCCCCTGTTACTATGACGGTGAGATCTTCCAGCCAGAA GACATCTTCTCAGACCATCACACCATGTGCTACTGTGAGGATGGCTTCATGCA CTGTACCATGAGTGGAGTCCCCGGAAGCTTGCTGCCTGACGCTGTCCTCAGC AGTCCCCTGTCTCATCGCAGCAAAAGG

example 2: preparation of monoclonal antibody specific against von Willebrand factor D1D2 region

1.1 transformation amplification and quantification of eukaryotic expression vectors

The pSecTag2B-VWF-D1D2 plasmid was transformed into DH 5. Alpha. Competence and plated overnight at 37 ℃. The positive clone is picked up, the bacteria are cultured by shaking table overnight at 37 ℃ for amplification, the bacteria are collected by centrifugation at 4 ℃, and then plasmid extraction is carried out by using a plasmid extraction kit (according to the operation of the kit specification). The plasmid was identified by EcoRV and ApaI digestion, and the results are shown in FIG. 1.

2pSecTag2B-VWF-D1D2 plasmid transfected HeLa cells

HeLa cell culture: heLa cells were cultured with DMEM (Dulbecco's Modified Eagles Medium) containing 10% calf serum. 24 hours before transfection, cells were seeded in 24 cell culture well plates (1.0X 10) ⁵ mL) to 60-80% confluence.

Preparation of transfection solution: 1 mu g of pSecTag2B-VWF-D1D2 plasmid was diluted to 100. Mu.L of serum-free DMEM medium, 4. Mu.L of Tubofect DNA transfection reagent was added, mixed well and left at room temperature for 20 minutes.

Preparation before transfection: cells were rinsed 1 time in serum-free DMEM, with 900 μ L serum-free DMEM media added per well.

Transfection: slowly adding the mixture to be transfected to the cells to be transfected, mixing, and then, at 37 deg.C, 5% ₂ And (5) performing incubator culture for 6h, discarding serum-free supernatant, and replacing with serum-containing cell culture medium for continuous culture.

And (3) screening of stably transfected cell strains: after 48h of culture, the transfected cells were digested and separated and re-plated into 35mm cell culture dishes (2X 10) ³ /mL), the cells were replaced with cell selection medium (DMEM cell culture containing 10% calf serum)Adding 400 mu g/mL Hygromycin B) to carry out screening of positive cell clone; after most of the cells die and fall off (about 7 to 10 days later), replacing the cells with cell screening maintenance liquid (DMEM cell culture medium containing 10% calf serum and adding 200 mu g/mL hygromycin B) for maintenance screening; after screening, selecting a monoclonal for amplification culture when positive cell clones grow out, namely obtaining a cell strain stably expressing the recombinant VDD protein, and screening a high-expression cell strain by a western blot method for seed conservation and cryopreservation.

1.3 Collection and concentration of supernatant of HeLa stably transfected cell line

And (3) domesticating the cell strain stably expressing the recombinant VDD protein by using a serum-free DMEM cell culture medium, then carrying out a large amount of amplification culture, and collecting a serum-free culture supernatant. The collected supernatant is immediately centrifuged and concentrated by 100 times through an Amicon Ultra-15 centrifugal Ultra-filtration tube, and is frozen and stored in a refrigerator at the temperature of 80 ℃ below zero after being subpackaged for standby.

1.4 Westernblot identification of recombinant VDD protein

The concentrated culture supernatant was subjected to 5% SDS-PAGE, followed by membrane transfer and Western blot identification. The results are shown in fig. 2, wherein a mouse anti-His monoclonal antibody is used as a primary antibody, donkey anti-mouse IgG marked by HRP is used as a secondary antibody, the secondary antibody is developed by ECL developer chemiluminescence, the film is photographed under a gel imager after being cleaned and air-dried, and the image is analyzed by ImageJ software.

1.5 recombinant VDD protein purification

Preparing a protein purification buffer solution: the following protein purification buffers were prepared according to the instructions

Balance Ni-NTA Agarose: mixing Ni-NTA Agarose in the preservation solution with the preservation solution uniformly, and sucking 4mL of Ni-NTA Agarose into a 15mL centrifuge tube; centrifuging at 500 Xg for 5min, and carefully discarding the supernatant; adding 10 times volume of NPI-10 buffer solution to balance Ni-NTA Agarose; centrifuge at 500 Xg for 5min, carefully discard the supernatant.

Protein binding to Ni-NTA Agarose: mixing the concentrated culture supernatant with Ni-NTA Agarose, and shaking-bonding at 4 deg.C overnight; centrifuge at 500 Xg for 5min and carefully collect the supernatant for electrophoresis.

Ni-NTA Agarose Wash: adding NPI-20 buffer solution with the volume 10 times that of the mixed solution to wash Ni-NTA Agarose, fully mixing the mixed solution, centrifuging the mixed solution at 500 Xg for 5min, and carefully collecting supernatant to be subjected to electrophoresis; the washing was repeated once.

Elution of recombinant VDD protein: adding 1-time volume of NPI-250 buffer solution to resuspend and wash the Ni-NTA Agarose, fully and uniformly mixing for 2min at room temperature to separate the recombinant protein from the Ni-NTA Agarose, centrifuging for 5min at 500 Xg, collecting supernatant into numbered centrifuge tubes, and placing on ice; elution was repeated 6 times.

Protein quantification after purification: and (3) quantifying the purified protein by using a spectrophotometer, zeroing by using NPI-250 buffer solution, measuring the absorbance of the protein sample at 280nm, and calculating the concentration of the purified protein.

1.6 dialysis to remove imidazole: high imidazole concentrations may cause protein precipitation, therefore, high imidazole concentrations in purified proteins were removed using sterile PBS buffer, and proteins were cryopreserved at-80 ℃ for use.

1.7 identification of the purified protein

The combined culture supernatant, washed supernatant and eluate were subjected to 10% SDS-PAGE, and the results are shown in FIG. 3, followed by Coomassie blue staining and Western blot identification. And taking a mouse anti-His monoclonal antibody as a primary antibody, taking horse anti-mouse IgG marked by HRP as a secondary antibody, developing by an ECL developer chemiluminescence method, washing and air-drying the film, photographing under a gel imager, and analyzing by ImageJ software. SDS-PAGE electrophoresis results show that the purity of the purified protein exceeds more than 90 percent, and Western blot results show that the protein can be specifically combined with the His monoclonal antibody, and the size of a band is about 90kDa.

Example 3: preparation of specific monoclonal antibody against von Willebrand factor leader peptide preparation of specific monoclonal antibody against von Willebrand factor D1D2 region

We used conventional immunological methods and hybridoma techniques (K \46466and Milstein, nature, 215.

First, 8-week-old female Balb/c mice (Shanghai academy of sciences laboratory animal center) were immunized with purified recombinant VDD protein three times at four-week intervals. The former two times are subcutaneous multipoint injection and intraperitoneal injection at the back, and the third time is tail vein injection and intraperitoneal injection of the mouse.

After the serum antibody titer of the immunized mice had reached a sufficiently high value, the animals were sacrificed and spleen cells were isolated. Spleen cells from immunized Balb/c mice were cell fused with mouse SP2/0 myeloma cells (introduced in hybridoma laboratories, paris transfusion center, france) using standard monoclonal antibody cell fusion techniques. And (3) selectively culturing the fused cells in HAT culture medium, and screening cell strains secreting antibody at high level by ELISA (enzyme-linked immunosorbent assay) on the supernatant after culture. For further scale-up culture or cryopreservation.

After biochemical and immunological techniques such as ELISA method and Western blotting are used for screening and identifying, two specific monoclonal antibodies of von Willebrand factor leader peptide are obtained and named as SZ175.

In order to prepare monoclonal antibody in large quantity, balb/c mouse or its parental mouse is first intraperitoneally injected with pristaneous mouse and hybridoma cell is inoculated to abdominal cavity of mouse one week later (5X 10) ⁵ Mice). Ascites production was evident about one week after inoculation and 5-10 mL of ascites could be collected per mouse.

Example 4: chemical Properties of the monoclonal antibody of the present invention

(1) The monoclonal antibody SZ175 of the invention belongs to IgG1 subclass as proved by the determination of an immune double diffusion method.

(2) The monoclonal antibody SZ175 is inoculated to the abdominal cavity of Balb/c mice to generate ascites, and the ascites is extracted 7 to 14 days later. Detecting ascites titer by using an ELISA method: the purified VDD protein is prepared into 1 mu g/mL by carbonate buffer solution, 100 mu L/hole plate package, and the temperature is kept overnight at 4 ℃; after 0.05% tween-TBS washing 2 times, 2% bsa-TBS blocking overnight, after the same washing, 100 μ L of ascites fluid diluted in a certain proportion (1, 100,1, 1000,1 10000,1 20000) was added per well, TBS was a blank control, the serum of a naive mouse was a negative control, the serum of an immunized mouse was a positive control, and incubation was carried out for 2h at 37 ℃. After washing 4 times as above, 100. Mu.L/well of HRP-labeled donkey anti-mouse secondary antibody (diluted 1 to 10000) was added and incubated at 37 ℃ for 1 hour. The reaction was stopped by washing 6 times as above, TMB developed 100. Mu.L/well, room temperature 8-10min, 50. Mu.L/well 3M sulfuric acid. OD450 values were read on a microplate reader. As shown in FIG. 4, the ascites titer and the positive control titer both reached 1.

(3) Ascites purification: purifying by Protein A/G, dialyzing by PBS, measuring IgG content by ultraviolet spectrophotometer, and purifying to obtain IgG 4-6mg per 1mL ascites.

(4) Detecting the antigen protein recognized by the monoclonal antibody by a Western blot immunoblotting method: normal human pooled plasma and recombinant mature VWF (without leader peptide) proteins were subjected to 10% sds-PAGE electrophoresis, transferred on a Bio-Rad system to nitrocellulose acid, blocked overnight with 2-bsa-PBS, washed with 0.05% tween-PBS the next day, added with purified antibody SZ175 and rabbit anti-human positive control polyclonal 1-AP (commercial antibody) (1. The results show that the monoclonal antibody SZ175 can bind to VWFPP in plasma and shows a band at 90kDa, and the positive control polyclonal antibody 1-AP also shows a band at the site, and the two antibodies and the positive control polyclonal antibody are not reacted with the recombinant mature VWF protein, which indicates that the antibody is specifically bound to VWFPP.

Example 5: ELISA kit for constructing and detecting VWFpp antigen by using two anti-von willebrand factor leader peptide monoclonal antibodies

1. Labeling monoclonal antibody SZ175 with horse radish peroxidase

1.1 Add 500mL of ultrapure water to lyophilized Phosphate Buffer (PBS).

1.2 prepare 1mg of purified mAb SZ175 (IgG) (present in 0.5mL to 1.0mL of PBS).

1.3 resuspend 1mg of EZ-Link Plus activated peroxidase in lyophilized state with 100. Mu.L of ultra pure water and mix it directly with IgG solution.

1.4 in a fume hood, sodium cyanoborohydride is rapidly added to the mixture to react, and the mixture is incubated for 1h at room temperature.

1.5 Add 20. Mu.L of Quenching Buffer and react at room temperature for 15min.

1.6 dialysis purification of the conjugated antibody for desalting, storing in a stock solution containing BSA at a concentration of 10mg/mL, mixing with an equal volume of glycerol, subpackaging and storing at-20 ℃.

2. The kit for detecting the VWFPP is constructed by utilizing two monoclonal antibodies SZ175 and SZ176 and applying the principle of a double-antibody sandwich method. A standard curve was prepared from normal human pooled plasma (1.

Example 6: detection of VWFP (von Willebrand factor leader peptide) on plasma of leukemia patients before and after bone marrow transplantation by using constructed ELISA (enzyme-Linked immunosorbent assay) detection kit for von Willebrand factor leader peptide

(1) Plasma was collected from 15 leukemia patients before and after bone marrow transplantation (1.

(2) Normal human pooled plasma was used as a standard (1, 20,1, 50,1, 100,1, 200,1, 500,1, 1000,1 dilution), patient plasma 1. 0.05% Tween-TBS wash 4 times, add 100. Mu.L/well of HRP-labeled SZ175 (1 diluted 2000), and incubate for 1h at 37 ℃. The reaction was stopped by washing 6 times as above, TMB developed 100. Mu.L/well, room temperature 8-10min, 50. Mu.L/well 3M sulfuric acid. OD reading on enzyme-labeled detector ₄₅₀ Values, results as shown in fig. 7, VWFpp concentration in normal human pooled plasma was set to 100IU/dL, and the VWFpp concentration in patient plasma was converted according to the standard curve.

Sequence listing

<110> Suzhou university affiliated first hospital

<120> antihuman von willebrand factor leader peptide monoclonal antibody SZ175 and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

agatatcgca gaagaaactc gc 22

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgggccctca ccttttgctg cga 23

<210> 3

<211> 2223

<212> DNA

<213> human (human)

<400> 3

gcagaaggaa ctcgcggcag gtcatccacg gcccgatgca gccttttcgg aagtgacttc 60

gtcaacacct ttgatgggag catgtacagc tttgcgggat actgcagtta cctcctggca 120

gggggctgcc agaaacgctc cttctcgatt attggggact tccagaatgg caagagagtg 180

agcctctccg tgtatcttgg ggaatttttt gacatccatt tgtttgtcaa tggtaccgtg 240

acacaggggg accaaagagt ctccatgccc tatgcctcca aagggctgta tctagaaact 300

gaggctgggt actacaagct gtccggtgag gcctatggct ttgtggccag gatcgatggc 360

agcggcaact ttcaagtcct gctgtcagac agatacttca acaagacctg cgggctgtgt 420

ggcaacttta acatctttgc tgaagatgac tttatgaccc aagaagggac cttgacctcg 480

gacccttatg actttgccaa ctcatgggct ctgagcagtg gagaacagtg gtgtgaacgg 540

gcatctcctc ccagcagctc atgcaacatc tcctctgggg aaatgcagaa gggcctgtgg 600

gagcagtgcc agcttctgaa gagcacctcg gtgtttgccc gctgccaccc tctggtggac 660

cccgagcctt ttgtggccct gtgtgagaag actttgtgtg agtgtgctgg ggggctggag 720

tgcgcctgcc ctgccctcct ggagtacgcc cggacctgtg cccaggaggg aatggtgctg 780

tacggctgga ccgaccacag cgcgtgcagc ccagtgtgcc ctgctggtat ggagtatagg 840

cagtgtgtgt ccccttgcgc caggacctgc cagagcctgc acatcaatga aatgtgtcag 900

gagcgatgcg tggatggctg cagctgccct gagggacagc tcctggatga aggcctctgc 960

gtggagagca ccgagtgtcc ctgcgtgcat tccggaaagc gctaccctcc cggcacctcc 1020

ctctctcgag actgcaacac ctgcatttgc cgaaacagcc agtggatctg cagcaatgaa 1080

gaatgtccag gggagtgcct tgtcacaggt caatcacact tcaagagctt tgacaacaga 1140

tacttcacct tcagtgggat ctgccagtac ctgctggccc gggattgcca ggaccactcc 1200

ttctccattg tcattgagac tgtccagtgt gctgatgacc gcgacgctgt gtgcacccgc 1260

tccgtcaccg tccggctgcc tggcctgcac aacagccttg tgaaactgaa gcatggggca 1320

ggagttgcca tggatggcca ggacgtccag ctccccctcc tgaaaggtga cctccgcatc 1380

cagcatacag tgacggcctc cgtgcgcctc agctacgggg aggacctgca gatggactgg 1440

gatggccgcg ggaggctgct ggtgaagctg tcccccgtct atgccgggaa gacctgcggc 1500

ctgtgtggga attacaatgg caaccagggc gacgacttcc ttaccccctc tgggctggcg 1560

gagccccggg tggaggactt cgggaacgcc tggaagctgc acggggactg ccaggacctg 1620

cagaagcagc acagcgatcc ctgcgccctc aacccgcgca tgaccaggtt ctccgaggag 1680

gcgtgcgcgg tcctgacgtc ccccacattc gaggcctgcc atcgtgccgt cagcccgctg 1740

ccctacctgc ggaactgccg ctacgacgtg tgctcctgct cggacggccg cgagtgcctg 1800

tgcggcgccc tggccagcta tgccgcggcc tgcgcgggga gaggcgtgcg cgtcgcgtgg 1860

cgcgagccag gccgctgtga gctgaactgc ccgaaaggcc aggtgtacct gcagtgcggg 1920

accccctgca acctgacctg ccgctctctc tcttacccgg atgaggaatg caatgaggcc 1980

tgcctggagg gctgcttctg ccccccaggg ctctacatgg atgagagggg ggactgcgtg 2040

cccaaggccc agtgcccctg ttactatgac ggtgagatct tccagccaga agacatcttc 2100

tcagaccatc acaccatgtg ctactgtgag gatggcttca tgcactgtac catgagtgga 2160

gtccccggaa gcttgctgcc tgacgctgtc ctcagcagtc ccctgtctca tcgcagcaaa 2220

agg 2223

Claims (3)

1. An anti-human von willebrand factor leader peptide monoclonal antibody SZ175, which is characterized in that the monoclonal antibody SZ175 belongs to IgG1 subclass antibody and is produced by a hybridoma cell strain SZ 175; wherein the preservation number of the hybridoma cell strain SZ175 is CCTCC NO of C2019272; the monoclonal antibody SZ175 can be specifically combined with a recombinant human VWF D1D2 region protein.

2. The anti-human von willebrand factor leader peptide monoclonal antibody SZ175 of claim 1, wherein the monoclonal antibody SZ175 is capable of binding to the recombinant human VWF D1D2 region encoded by the base sequence of SEQ ID No. 3.

3. Use of the anti-human von willebrand factor leader peptide monoclonal antibody SZ175 of claim 1 or 2 in the preparation of a kit for detecting a human von willebrand factor leader peptide antigen.

Images