CN113307876A

CN113307876A - Monoclonal antibody SZ175 of antihuman von willebrand factor leader peptide and application thereof

Info

Publication number: CN113307876A
Application number: CN202110517006.6A
Authority: CN
Inventors: 马珍妮; 殷杰; 凌婧; 苏健; 谢丽倩; 张婷婷; 阮长耿
Original assignee: First Affiliated Hospital of Suzhou University
Current assignee: First Affiliated Hospital of Suzhou University
Priority date: 2021-05-12
Filing date: 2021-05-12
Publication date: 2021-08-27
Anticipated expiration: 2041-05-12
Also published as: CN113307876B

Abstract

The invention discloses a human von willebrand factor (von Willebrand factor) -resistant leader peptide monoclonal antibody SZ175 and application thereof, wherein the monoclonal antibody SZ175 belongs to IgG1 subclass antibody and is generated by a hybridoma cell strain SZ175(2B 10); wherein the preservation number of the hybridoma cell strain SZ175(2B10) is CCTCC NO: C2019272; the monoclonal antibody SZ175 can be specifically bound with a recombinant human VWF D1D2 zone protein. Compared with the prior art, the invention has the following advantages: (1) the monoclonal antibody can specifically recognize VWFPP in blood plasma, and is combined with an enzyme labeling method to construct a method for hemophilia typing diagnosis or diagnosis of endothelial cell injury related diseases, so that compared with the prior art, the method saves time, has low requirements on detection and the detection, and is convenient to apply in various laboratories and clinics; (2) the kit constructed by the application is beneficial to popularization and application, can be obtained from a regular channel after industrialization, and provides convenience for the research and clinical application in the field in China.

Description

Monoclonal antibody SZ175 of antihuman von willebrand factor leader peptide and application thereof

Technical Field

The invention belongs to the field of immunology, and relates to a monoclonal antibody, in particular to an anti-human von willebrand factor leader peptide monoclonal antibody SZ175 and application thereof.

Background

Von Willebrand Factor (VWF) is an important plasma membrane glycoprotein in plasma that is involved in the process of hemostasis and coagulation, and it can mediate adhesion of platelets to damaged blood vessel walls, and is a carrier of coagulation Factor (Factor VIII), FVIII, which stabilizes and protects FVIII from degradation, prolonging the half-life of FVIII. VWF is expressed in endothelial cells and megakaryocytes, and the synthesized VWF undergoes numerous post-translational modifications, including dimerization, glycosylation, polymerization of heterodimers, cleavage of leader peptides, and thiolation modification, before leaving the endothelial cells. Most of the synthetic VWF is secreted by the constitutive pathway, the remainder being stored in weibull-Palade bodies (WPB) of endothelial cells and the alpha-granules of platelets. The constitutively released part of VWF is not completely proteolyzed due to its limited multimerization and poor function. In contrast, VWF released through regulatory pathways is proteolytically fully processed and consists of high molecular weight multimers with biological activity. The human von willebrand factor leader peptide (VWF propeptide, VWFpp) comprises two domains, D1 and D2, and contains 741 amino acids with 32 cysteines in each D region, which can form intra-or interchain disulfide bonds and play an important role in VWF multimerization. The role of VWFpp in VWF transport and secretion is widely studied, but some functions remain to be further elucidated. The research of the VWFPP monoclonal antibody is a good tool for researching the action mechanism and the function of the VWFPP.

Therefore, the development of an anti-human VWFPP monoclonal antibody is of great importance for establishing an effective method for detecting VWFPP. At present, the VWFPP is detected internationally by mainly adopting a kit from Holland Amsterdam, and the VWFPP belongs to a clinical detection kit due to high price, can not be obtained at home in a formal way, is not beneficial to popularization and application, and seriously influences the research and clinical application in the field at home.

Disclosure of Invention

The technical problem to be solved is as follows: in order to overcome the defects of the prior art, the invention obtains the protein of the human von willebrand factor leader peptide VWF D1D2 region and a monoclonal antibody aiming at the region through a eukaryotic expression system, wherein the antibody can specifically recognize VWFpp in plasma but not recognize mature VWF without the leader peptide, thereby constructing a hemophilia typing diagnosis or a diagnosis method of endothelial cell injury related diseases through the detection of the antibody; in view of the above, the present invention provides monoclonal antibody SZ175 against human von Willebrand factor leader peptide and its application.

The technical scheme is as follows: an anti-human von willebrand factor leader peptide monoclonal antibody SZ175, wherein the monoclonal antibody SZ175 belongs to IgG1 subclass antibody and is produced by a hybridoma cell strain SZ175(2B 10); wherein the preservation number of the hybridoma cell strain SZ175(2B10) is CCTCC NO: C2019272; the monoclonal antibody SZ175 can be specifically bound with a recombinant human VWF D1D2 zone protein.

The preparation method of the hybridoma cell strain SZ175 comprises the following steps:

(1) Balb/C mice were immunized in the conventional manner using a recombinant human von Willebrand factor VWF leader peptide (D1D2 region) protein as an immunogen;

(2) obtaining a fused cell growth clone: taking splenocytes of an immune qualified mouse aseptically as B cells sensitized by antigen, fusing the B cells with myeloma cells SP2/0 strain according to a conventional method, and then screening by utilizing a conventional fusion cell HAT screening method to further obtain the growth clone of the fusion cells;

(3) after screening and identification by biochemical and immunological techniques such as ELISA method and Western immunoblotting, hybridoma cell line SZ175(2B10) with high antibody secretion level is selected.

In the preparation method of the hybridoma cell strain SZ175, recombinant human von Willebrand factor VWF leader peptide (D1D2 region) protein is used as immunogen to immunize female Balb/c mice aged for 8 weeks three times at intervals of 4 weeks; detecting the existence and concentration of monoclonal antibody in the serum of the immunized animal by an ELISA method; after completion of the immunization, selecting a mouse producing antiserum at a sufficiently high concentration, isolating the spleen of the animal and preparing a spleen cell suspension; the resulting spleen cells of mice were fused with myeloma cells according to known hybridoma techniques (see: K ǒ hler and Milstein, Nature, 215: 495-497, 1975; K ǒ hler et al, Immunology Today, 4: 72-76, 1983) to prepare hybridoma cell lines which can be continuously passaged and secrete monoclonal antibodies against von Willebrand factor leader peptide (VWFpp).

The preservation information of the hybridoma cell line is as follows: the preservation unit: china Center for Type Culture Collection (CCTCC for short); address: the Wuhan university Collection in the Wuchang area of Wuhan city, Hubei province (opposite to the first subsidiary school of Wuhan university); the preservation date is 2019, 11 and 26 months; the preservation number is CCTCC NO of C2019272; and (3) classification and naming: hybridoma cell line SZ175(2B 10).

The method for producing monoclonal antibodies by using the hybridoma cell line SZ175(2B10) is as follows:

the method comprises the following steps: inoculating the hybridoma cells into a hybridoma culture solution, and separating and purifying the culture solution after culture to obtain the required specific monoclonal antibody against von willebrand factor leader peptide.

The second method comprises the following steps: inoculating the hybridoma cells into abdominal cavity of the animal, separating and purifying the ascites fluid of the animal to obtain the required monoclonal antibody of the specific anti-von willebrand factor leader peptide.

The immunoglobulin (IgG) concentration is measured and calculated by an ultraviolet spectrophotometer, and the specificity of the obtained monoclonal antibody can be further detected by an immunoblotting method (Western-Blot). The monoclonal antibody of the invention belongs to IgG1 subclass antibody through immune double diffusion detection. ELISA detection results show that the monoclonal antibody of the invention can be specifically combined with the recombinant human VWF D1D2 region (VDD) protein.

Preferably, the recombinant human VWF D1D2 domain protein is a reductive VWF leader peptide.

Preferably, monoclonal antibody SZ175 is bound to a protein having a molecular weight of 90KDa of the reductive VWF leader peptide.

The application of any one of the antihuman von willebrand factor leader peptide monoclonal antibodies SZ175 in preparing a von willebrand disease typing detection kit.

The application of any of the antihuman von willebrand factor leader peptide monoclonal antibody SZ175 in preparing a kit for prognosis detection of endothelial cell damage diseases.

Preferably, the endothelial cell damage disease is myocardial infarction or bone marrow transplantation.

The application principle of the kit is as follows: combining a specific antibody SZ176 on a solid phase carrier to form a solid phase antibody, then combining with a corresponding VWF leader peptide antigen in the plasma to be detected to form an immune complex, washing, adding an enzyme-labeled antibody HRP-SZ175, combining with the antigen in the immune complex to form an enzyme-labeled antibody-antigen-solid phase antibody complex, adding a substrate for color development, and judging the antigen content. The specific method comprises the following steps:

first, the monoclonal antibody SZ175 was labeled with horseradish peroxidase (HRP).

Next, the monoclonal antibody SZ176 was coated on a 96-well plate in a carbonate buffer at 4 ℃ overnight. After washing the plates, blocking was performed with 2% bovine serum albumin BSA at 37 ℃ for 1 h.

Again, the mixed plasma of normal human was diluted in gradient as standard, and the patient or normal human plasma was diluted 1:50 in TBS, and 100. mu.L per well of the above blocked ELISA plate was added. Incubate at 37 ℃ for 2 h. After washing, diluted HRP-SZ175 was added and incubated at 37 ℃ for 1 h.

Finally, the plate is washed, developed with chromogenic substrate TMB, the reaction is stopped with 2M sulfuric acid, read and fitted to a standard curve, and the data are analyzed.

Has the advantages that: (1) the monoclonal antibody can specifically recognize VWFPP in blood plasma, and is combined with an enzyme labeling method to construct a method for hemophilia typing diagnosis or diagnosis of endothelial cell injury related diseases, so that compared with the prior art, the method saves time, has low requirements on detection and the detection, and is convenient to apply in various laboratories and clinics; (2) the kit constructed by the application is beneficial to popularization and application, can be obtained from a regular channel after industrialization, and provides convenience for the research and clinical application in the field in China.

Drawings

FIG. 1 is a constructed electrophoresis diagram of the eukaryotic expression plasmid of recombinant VDD after double enzyme digestion;

FIG. 2 shows that Western blot identifies VDD protein expressed recombinantly;

FIG. 3 is an electrophoretogram and Western blot identification of 10% SDS-PAGE identification of purified recombinant VDD protein;

FIG. 4 shows the binding of ascites in mice to VDD by ELISA;

FIG. 5 is a Western blot to identify the specificity of VWFpp antibody binding to antigen;

FIG. 6 is the establishment of a standard curve of ELISA double antibody sandwich method;

FIG. 7 is a test of VWFpp before and after transplantation in a bone marrow transplant patient.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications and substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and substance of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1: preparation of immunogen, recombinant human von Willebrand factor D1D2 region (VDD) protein

(1) PCR primer design and synthesis: designing and synthesizing a pair of primers respectively positioned at the upstream and downstream sides of a cDNA sequence (2223bp) of a VWF-D1D2 region (amino acids 23-763),

upstream primer, SEQ ID No. 1: 5'-AGATATCGCAGAAGAAACTCGC-3', the 5 ' end contains EcoRV enzyme cutting site;

downstream primer, SEQ ID No. 2: 5'-CGGGCCCTCACCTTTTGCTGCGA-3', the 5 ' end contains ApaI enzyme cutting site; and performing PCR amplification by using the primer and VWF full-length cDNA as a template to obtain a PCR product.

(2) Cloning and sequence analysis of the genes of interest: under the action of T4 DNA ligase, the purified PCR product is directly connected with an expression vector pSecTag2B vector (Tag containing 6 XHis) to obtain a pSecTag2B-VWF-D1D2 recombinant plasmid. Escherichia coli DH 5. alpha. was transformed with the resulting recombinant plasmid, plated on LB plates, and screened for ampicillin. And (3) determining the DNA sequence by using a full-automatic sequencer with the recombinant plasmid as a template, wherein the determined DNA sequence of the cloned fragment is completely consistent with the known VWF-D1D2 region cDNA sequence, and further indicating that the cloned D1D2 region gene fragment is correct.

The full length of the cDNA sequence for coding the expression human VWF-D1D2 area is 2223bp, and the specific sequence of the base sequence shown in SEQ ID NO.3 is as follows:

GCAGAAGGAACTCGCGGCAGGTCATCCACGGCCCGATGCAGCCTTTTCGGAA GTGACTTCGTCAACACCTTTGATGGGAGCATGTACAGCTTTGCGGGATACTGC AGTTACCTCCTGGCAGGGGGCTGCCAGAAACGCTCCTTCTCGATTATTGGGGA CTTCCAGAATGGCAAGAGAGTGAGCCTCTCCGTGTATCTTGGGGAATTTTTTG ACATCCATTTGTTTGTCAATGGTACCGTGACACAGGGGGACCAAAGAGTCTCC ATGCCCTATGCCTCCAAAGGGCTGTATCTAGAAACTGAGGCTGGGTACTACAA GCTGTCCGGTGAGGCCTATGGCTTTGTGGCCAGGATCGATGGCAGCGGCAAC TTTCAAGTCCTGCTGTCAGACAGATACTTCAACAAGACCTGCGGGCTGTGTG GCAACTTTAACATCTTTGCTGAAGATGACTTTATGACCCAAGAAGGGACCTTG ACCTCGGACCCTTATGACTTTGCCAACTCATGGGCTCTGAGCAGTGGAGAAC AGTGGTGTGAACGGGCATCTCCTCCCAGCAGCTCATGCAACATCTCCTCTGGG GAAATGCAGAAGGGCCTGTGGGAGCAGTGCCAGCTTCTGAAGAGCACCTCG GTGTTTGCCCGCTGCCACCCTCTGGTGGACCCCGAGCCTTTTGTGGCCCTGTG TGAGAAGACTTTGTGTGAGTGTGCTGGGGGGCTGGAGTGCGCCTGCCCTGCC CTCCTGGAGTACGCCCGGACCTGTGCCCAGGAGGGAATGGTGCTGTACGGCT GGACCGACCACAGCGCGTGCAGCCCAGTGTGCCCTGCTGGTATGGAGTATAG GCAGTGTGTGTCCCCTTGCGCCAGGACCTGCCAGAGCCTGCACATCAATGAA ATGTGTCAGGAGCGATGCGTGGATGGCTGCAGCTGCCCTGAGGGACAGCTCC TGGATGAAGGCCTCTGCGTGGAGAGCACCGAGTGTCCCTGCGTGCATTCCGG AAAGCGCTACCCTCCCGGCACCTCCCTCTCTCGAGACTGCAACACCTGCATTT GCCGAAACAGCCAGTGGATCTGCAGCAATGAAGAATGTCCAGGGGAGTGCCT TGTCACAGGTCAATCACACTTCAAGAGCTTTGACAACAGATACTTCACCTTCA GTGGGATCTGCCAGTACCTGCTGGCCCGGGATTGCCAGGACCACTCCTTCTCC ATTGTCATTGAGACTGTCCAGTGTGCTGATGACCGCGACGCTGTGTGCACCCG CTCCGTCACCGTCCGGCTGCCTGGCCTGCACAACAGCCTTGTGAAACTGAAG CATGGGGCAGGAGTTGCCATGGATGGCCAGGACGTCCAGCTCCCCCTCCTGA AAGGTGACCTCCGCATCCAGCATACAGTGACGGCCTCCGTGCGCCTCAGCTA CGGGGAGGACCTGCAGATGGACTGGGATGGCCGCGGGAGGCTGCTGGTGAA GCTGTCCCCCGTCTATGCCGGGAAGACCTGCGGCCTGTGTGGGAATTACAATG GCAACCAGGGCGACGACTTCCTTACCCCCTCTGGGCTGGCGGAGCCCCGGGT GGAGGACTTCGGGAACGCCTGGAAGCTGCACGGGGACTGCCAGGACCTGCA GAAGCAGCACAGCGATCCCTGCGCCCTCAACCCGCGCATGACCAGGTTCTCC GAGGAGGCGTGCGCGGTCCTGACGTCCCCCACATTCGAGGCCTGCCATCGTG CCGTCAGCCCGCTGCCCTACCTGCGGAACTGCCGCTACGACGTGTGCTCCTGC TCGGACGGCCGCGAGTGCCTGTGCGGCGCCCTGGCCAGCTATGCCGCGGCCT GCGCGGGGAGAGGCGTGCGCGTCGCGTGGCGCGAGCCAGGCCGCTGTGAGC TGAACTGCCCGAAAGGCCAGGTGTACCTGCAGTGCGGGACCCCCTGCAACCT GACCTGCCGCTCTCTCTCTTACCCGGATGAGGAATGCAATGAGGCCTGCCTGG AGGGCTGCTTCTGCCCCCCAGGGCTCTACATGGATGAGAGGGGGGACTGCGT GCCCAAGGCCCAGTGCCCCTGTTACTATGACGGTGAGATCTTCCAGCCAGAA GACATCTTCTCAGACCATCACACCATGTGCTACTGTGAGGATGGCTTCATGCA CTGTACCATGAGTGGAGTCCCCGGAAGCTTGCTGCCTGACGCTGTCCTCAGC AGTCCCCTGTCTCATCGCAGCAAAAGG

example 2: preparation of monoclonal antibody specific against von Willebrand factor D1D2 region

1.1 transformation amplification and quantification of eukaryotic expression vectors

The pSecTag2B-VWF-D1D2 plasmid was transformed into DH 5. alpha. competence and cultured overnight at 37 ℃ after plating. The positive clone is picked up, the bacteria are cultured by shaking table overnight at 37 ℃ for amplification, the bacteria are collected by centrifugation at 4 ℃, and then plasmid extraction is carried out by using a plasmid extraction kit (according to the operation of the kit specification). The plasmid was identified by EcoRV and ApaI digestion, and the results are shown in FIG. 1.

1.2 transfection of plasmid pSecTag2B-VWF-D1D2 into HeLa cells

HeLa cell culture: HeLa cells were cultured with DMEM (Dulbecco's Modified Eagles Medium) containing 10% calf serum. 24 hours prior to the transfection, the cells were,cells were seeded in 24 cell culture well plates (1.0X 10)⁵mL) to 60-80% confluence.

Preparation of transfection solution: 1. mu.g of pSecTag2B-VWF-D1D2 plasmid was diluted to 100. mu.L of serum-free DMEM medium, 4. mu.L of Tubofect DNA transfection reagent was added, and the mixture was mixed well and left at room temperature for 20 minutes.

Preparation before transfection: cells were rinsed 1 time in serum-free DMEM, and 900 μ L serum-free DMEM medium was added to each well.

Transfection: slowly adding the mixture to be transfected into the cells to be transfected, uniformly mixing, and then adding 5% CO at 37 DEG C₂And (5) performing incubator culture for 6h, discarding serum-free supernatant, and replacing with serum-containing cell culture medium for continuous culture.

And (3) screening of stably transfected cell strains: after 48h of culture, the transfected cells were digested and separated and re-plated into 35mm cell culture dishes (2X 10)³/mL), and then cell screening solution (DMEM cell culture medium containing 10% calf serum and 400 mug/mL hygromycin B is added) is added for screening positive cell clones; after most of the cells die and fall off (about 7 to 10 days later), replacing the cells with cell screening maintenance liquid (DMEM cell culture medium containing 10% calf serum and adding 200 mu g/mL hygromycin B) for maintenance screening; after screening, selecting a monoclonal for amplification culture after positive cell clones grow out, namely obtaining a cell strain for stably expressing the recombinant VDD protein, and screening a high-expression cell strain by a western blot method for seed preservation and freezing storage.

1.3 Collection and concentration of supernatant of HeLa stably transfected cell line

And (3) domesticating the cell strain stably expressing the recombinant VDD protein by using a serum-free DMEM cell culture medium, then carrying out a large amount of amplification culture, and collecting a serum-free culture supernatant. The collected supernatant is immediately centrifuged and concentrated by 100 times through an Amicon Ultra-15 centrifugal ultrafiltration tube, and frozen and stored in a refrigerator at the temperature of minus 80 ℃ for later use after subpackaging.

1.4 Westernblot identification of recombinant VDD protein

And (3) carrying out 5% SDS-PAGE electrophoresis on the concentrated culture supernatant, transferring the membrane, and identifying by Western blot. The results are shown in fig. 2, in which a mouse anti-His monoclonal antibody is used as a primary antibody, an HRP-labeled donkey anti-mouse IgG is used as a secondary antibody, the secondary antibody is developed by an ECL developer chemiluminescence method, the film is washed, air-dried, photographed under a gel imager and analyzed by ImageJ software.

1.5 recombinant VDD protein purification

Preparing a protein purification buffer solution: the following protein purification buffers were prepared according to the instructions

Balance Ni-NTA Agarose: mixing Ni-NTA Agarose in the preservation solution with the preservation solution uniformly, and sucking 4mL of Ni-NTA Agarose into a 15mL centrifuge tube; centrifuging at 500 Xg for 5min, and carefully discarding the supernatant; adding 10 times volume of NPI-10 buffer solution to balance Ni-NTA Agarose; centrifuge at 500 Xg for 5min, carefully discard the supernatant.

Protein binding to Ni-NTA Agarose: mixing the concentrated culture supernatant with Ni-NTA Agarose, and shaking-mixing at 4 deg.C overnight; centrifuge at 500 Xg for 5min and carefully collect the supernatant for electrophoresis.

Ni-NTA Agarose Wash: adding NPI-20 buffer solution with the volume 10 times that of the mixed solution to wash Ni-NTA Agarose, fully and uniformly mixing, centrifuging for 5min at 500 Xg, and carefully collecting supernatant for electrophoresis; the washing was repeated once.

Elution of recombinant VDD protein: adding 1-time volume of NPI-250 buffer solution to resuspend and wash the Ni-NTA Agarose, fully and uniformly mixing for 2min at room temperature to separate the recombinant protein from the Ni-NTA Agarose, centrifuging for 5min at 500 Xg, collecting supernatant into a numbered centrifuge tube, and placing on ice; elution was repeated 6 times.

Protein quantification after purification: and (3) quantifying the purified protein by using a spectrophotometer, zeroing by using NPI-250 buffer solution, measuring the absorbance of the protein sample at 280nm, and calculating the concentration of the purified protein.

1.6 dialysis to remove imidazole: high imidazole concentrations may cause protein precipitation, therefore, high imidazole concentrations in purified proteins were removed using sterile PBS buffer, and proteins were cryopreserved at-80 ℃ for use.

1.7 identification of proteins after purification

The combined culture supernatant, washed supernatant and eluate were subjected to 10% SDS-PAGE, and the results are shown in FIG. 3, followed by Coomassie blue staining and Western blot identification. And taking a mouse anti-His monoclonal antibody as a primary antibody, taking donkey anti-mouse IgG marked by HRP as a secondary antibody, developing by an ECL developer chemiluminescence method, washing and air-drying the film, photographing under a gel imager, and analyzing by ImageJ software. SDS-PAGE electrophoresis results show that the purity of the purified protein is over 90 percent, and Western blot results show that the protein can be specifically combined with the His monoclonal antibody, and the size of a band is about 90 kDa.

Example 3: preparation of specific monoclonal antibody against von Willebrand factor leader peptide preparation of monoclonal antibody specific against von Willebrand factor D1D2 region

We applied conventional immunological methods and hybridoma techniques (K ǒ hler and Milstein, Nature, 215: 495-.

First, 8-week-old female Balb/c mice (Shanghai academy of sciences laboratory animal center) were immunized with purified recombinant VDD protein three times at four-week intervals. The former two times are subcutaneous multipoint injection and intraperitoneal injection at the back, and the third time is tail vein injection and intraperitoneal injection of the mouse.

After the serum antibody titer of the immunized mice had reached a sufficiently high value, the animals were sacrificed and spleen cells were isolated. Spleen cells from immunized Balb/c mice were cell fused with mouse SP2/0 myeloma cells (introduced in hybridoma laboratories, Paris transfusion center, France) using standard monoclonal antibody cell fusion techniques. And (3) selectively culturing the fused cells in HAT culture medium, and screening cell strains secreting antibody at high level by ELISA (enzyme-linked immunosorbent assay) on the supernatant after culture. For further scale-up culture or cryopreservation.

After biochemical and immunological techniques such as ELISA method and Western blotting are used for screening and identifying, two specific monoclonal antibodies of von Willebrand factor leader peptide are obtained and named as SZ 175.

For mass production of monoclonal antibodies, Balb/c mice or parental mice were selected, injected intraperitoneally with pristaneous mice, and one week later hybridoma cells were inoculated into the abdominal cavity of mice (5X 10)⁵Mice). Ascites is evident about one week after inoculation, and 5-10 mL of ascites can be collected per mouse.

Example 4: chemical Properties of the monoclonal antibody of the present invention

(1) The monoclonal antibody SZ175 of the invention belongs to IgG1 subclass as proved by the determination of an immune double diffusion method.

(2) The monoclonal antibody SZ175 is inoculated to the abdominal cavity of Balb/c mice to generate ascites, and the ascites is extracted 7 to 14 days later. Detecting ascites titer by ELISA method: the purified VDD protein is prepared into a 1 mu g/mL carbonate buffer solution, 100 mu L/well plate package, and is kept overnight at 4 ℃; after washing with 0.05% Tween-TBS for 2 times, blocking with 2% BSA-TBS overnight, after the above washing, adding 100. mu.L of ascites (1:100, 1:1000, 1:10000, 1:20000) diluted in a certain proportion into each well, using TBS as blank control, using serum of a non-immunized mouse at the same period as negative control, using serum of an immunized mouse as positive control, and incubating at 37 ℃ for 2 h. After washing 4 times as above, 100. mu.L/well of HRP-labeled donkey-anti-mouse secondary antibody (diluted 1: 10000) was added and incubated at 37 ℃ for 1 hour. Washing 6 times as above, developing TMB color 100 μ L/well, room temperature 8-10min, and stopping reaction with 50 μ L/well 3M sulfuric acid. OD450 values were read on a microplate reader. The results are shown in FIG. 4, the ascites and positive control titer both reached 1:20000 or more.

(3) Ascites purification: purifying by Protein A/G, dialyzing by PBS, measuring IgG content by ultraviolet spectrophotometer, and purifying every 1mL ascites to obtain IgG 4-6 mg.

(4) Detecting the antigen protein recognized by the monoclonal antibody by a Western blot immunoblotting method: normal human mixed plasma and recombinant mature VWF (containing no leader peptide) protein were subjected to 10% SDS-PAGE, transferred to nitrocellulose acid on a Bio-Rad system, blocked overnight with 2% BSA-PBS, washed the next day with 0.05% Tween-PBS, added with purified antibody SZ175 and rabbit anti-human positive control polyclonal antibody 1-AP (commercial antibody) (1:1000 dilution), incubated at room temperature for 2h, washed for half an hour, added with HRP-labeled donkey-anti-mouse secondary antibody (1: 40000 dilution) and HRP-labeled goat-anti-rabbit secondary antibody (1:10000 dilution), incubated at room temperature for 1h, washed again, developed with ECL, and subjected to tabletting, and the results are shown in FIG. 5. The results show that the monoclonal antibody SZ175 can bind to VWFPP in plasma and shows a band at 90kDa, and the positive control polyclonal antibody 1-AP also shows a band at the site, and the two antibodies and the positive control polyclonal antibody are not reacted with the recombinant mature VWF protein, which indicates that the antibody is specifically bound to VWFPP.

Example 5: ELISA kit for constructing and detecting VWFpp antigen by using two anti-von willebrand factor leader peptide monoclonal antibodies

1. Labeling monoclonal antibody SZ175 with horse radish peroxidase

1.1 Add 500mL of ultrapure water to lyophilized Phosphate Buffer (PBS).

1.2 prepare 1mg of purified mAb SZ175(IgG) (present in 0.5mL to 1.0mL of PBS).

1.3 resuspend 1mg of EZ-Link Plus activated peroxidase in lyophilized state with 100. mu.L of ultra pure water and mix it directly with IgG solution.

1.4 in a fume hood, rapidly adding sodium cyanoborohydride into the mixture for reaction, and incubating for 1h at room temperature.

1.5 Add 20. mu.L of Quenching Buffer and react at room temperature for 15 min.

1.6 dialysis purification of the conjugated antibody for desalting, storing in a stock solution containing BSA at a concentration of 10mg/mL, mixing with an equal volume of glycerol, subpackaging and storing at-20 ℃.

2. The kit for detecting the VWFPP is constructed by utilizing two monoclonal antibodies SZ175 and SZ176 and applying the principle of a double-antibody sandwich method. A standard curve was prepared using normal human pooled plasma (1:20, 1:50, 1:100, 1:200, 1:500, 1:1000, 1:2000 dilutions) as shown in FIG. 6.

Example 6: detection of VWFP (von Willebrand factor leader peptide) on plasma of leukemia patients before and after bone marrow transplantation by using constructed ELISA (enzyme-Linked immunosorbent assay) detection kit for von Willebrand factor leader peptide

(1) Plasma (anticoagulated with sodium citrate at a ratio of 1: 9) before and after bone marrow transplantation of 15 cases of leukemia patients was collected and frozen at 80 ℃.

(2) Normal human mixed plasma is used as a standard (diluted by 1:20, 1:50, 1:100, 1:200, 1:500, 1:1000 and 1: 2000), patient plasma is diluted by 1:50, an enzyme label plate coated with SZ176 (after blocking) is added, each well is 100 mu L, TBS is blank control, and the mixture is incubated for 2 hours at 37 ℃. 0.05% Tween-TBS was washed 4 times, 100. mu.L/well of HRP-labeled SZ175(1:2000 dilution) was added, and incubated at 37 ℃ for 1 h. Washing 6 times as above, developing TMB color 100 μ L/well, room temperature 8-10min, and stopping reaction with 50 μ L/well 3M sulfuric acid. OD reading on enzyme-labeled detector₄₅₀Values and results are shown in FIG. 7, where the VWFpp concentration in normal human pooled plasma was set at 100IU/dL and the VWFpp concentration in patient plasma was converted according to the standard curve.

Sequence listing

<110> Suzhou university affiliated first hospital

<120> antihuman von willebrand factor leader peptide monoclonal antibody SZ175 and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

agatatcgca gaagaaactc gc 22

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgggccctca ccttttgctg cga 23

<210> 3

<211> 2223

<212> DNA

<213> human (human)

<400> 3

gcagaaggaa ctcgcggcag gtcatccacg gcccgatgca gccttttcgg aagtgacttc 60

gtcaacacct ttgatgggag catgtacagc tttgcgggat actgcagtta cctcctggca 120

gggggctgcc agaaacgctc cttctcgatt attggggact tccagaatgg caagagagtg 180

agcctctccg tgtatcttgg ggaatttttt gacatccatt tgtttgtcaa tggtaccgtg 240

acacaggggg accaaagagt ctccatgccc tatgcctcca aagggctgta tctagaaact 300

gaggctgggt actacaagct gtccggtgag gcctatggct ttgtggccag gatcgatggc 360

agcggcaact ttcaagtcct gctgtcagac agatacttca acaagacctg cgggctgtgt 420

ggcaacttta acatctttgc tgaagatgac tttatgaccc aagaagggac cttgacctcg 480

gacccttatg actttgccaa ctcatgggct ctgagcagtg gagaacagtg gtgtgaacgg 540

gcatctcctc ccagcagctc atgcaacatc tcctctgggg aaatgcagaa gggcctgtgg 600

gagcagtgcc agcttctgaa gagcacctcg gtgtttgccc gctgccaccc tctggtggac 660

cccgagcctt ttgtggccct gtgtgagaag actttgtgtg agtgtgctgg ggggctggag 720

tgcgcctgcc ctgccctcct ggagtacgcc cggacctgtg cccaggaggg aatggtgctg 780

tacggctgga ccgaccacag cgcgtgcagc ccagtgtgcc ctgctggtat ggagtatagg 840

cagtgtgtgt ccccttgcgc caggacctgc cagagcctgc acatcaatga aatgtgtcag 900

gagcgatgcg tggatggctg cagctgccct gagggacagc tcctggatga aggcctctgc 960

gtggagagca ccgagtgtcc ctgcgtgcat tccggaaagc gctaccctcc cggcacctcc 1020

ctctctcgag actgcaacac ctgcatttgc cgaaacagcc agtggatctg cagcaatgaa 1080

gaatgtccag gggagtgcct tgtcacaggt caatcacact tcaagagctt tgacaacaga 1140

tacttcacct tcagtgggat ctgccagtac ctgctggccc gggattgcca ggaccactcc 1200

ttctccattg tcattgagac tgtccagtgt gctgatgacc gcgacgctgt gtgcacccgc 1260

tccgtcaccg tccggctgcc tggcctgcac aacagccttg tgaaactgaa gcatggggca 1320

ggagttgcca tggatggcca ggacgtccag ctccccctcc tgaaaggtga cctccgcatc 1380

cagcatacag tgacggcctc cgtgcgcctc agctacgggg aggacctgca gatggactgg 1440

gatggccgcg ggaggctgct ggtgaagctg tcccccgtct atgccgggaa gacctgcggc 1500

ctgtgtggga attacaatgg caaccagggc gacgacttcc ttaccccctc tgggctggcg 1560

gagccccggg tggaggactt cgggaacgcc tggaagctgc acggggactg ccaggacctg 1620

cagaagcagc acagcgatcc ctgcgccctc aacccgcgca tgaccaggtt ctccgaggag 1680

gcgtgcgcgg tcctgacgtc ccccacattc gaggcctgcc atcgtgccgt cagcccgctg 1740

ccctacctgc ggaactgccg ctacgacgtg tgctcctgct cggacggccg cgagtgcctg 1800

tgcggcgccc tggccagcta tgccgcggcc tgcgcgggga gaggcgtgcg cgtcgcgtgg 1860

cgcgagccag gccgctgtga gctgaactgc ccgaaaggcc aggtgtacct gcagtgcggg 1920

accccctgca acctgacctg ccgctctctc tcttacccgg atgaggaatg caatgaggcc 1980

tgcctggagg gctgcttctg ccccccaggg ctctacatgg atgagagggg ggactgcgtg 2040

cccaaggccc agtgcccctg ttactatgac ggtgagatct tccagccaga agacatcttc 2100

tcagaccatc acaccatgtg ctactgtgag gatggcttca tgcactgtac catgagtgga 2160

gtccccggaa gcttgctgcc tgacgctgtc ctcagcagtc ccctgtctca tcgcagcaaa 2220

agg 2223

Claims

1. An anti-human von willebrand factor leader peptide monoclonal antibody SZ175, which is produced by a hybridoma cell line SZ175(2B10), wherein the monoclonal antibody SZ175 belongs to an antibody of IgG1 subclass; wherein the preservation number of the hybridoma cell strain SZ175(2B10) is CCTCC NO: C2019272; the monoclonal antibody SZ175 can be specifically bound with a recombinant human VWF D1D2 zone protein.

2. The anti-human von willebrand factor leader peptide monoclonal antibody SZ175 of claim 1, wherein the recombinant human VWF D1D2 region protein is a reducing VWF leader peptide.

3. The anti-human von willebrand factor leader peptide monoclonal antibody SZ175 of claim 2, wherein monoclonal antibody SZ175 binds to a protein of the reducing VWF leader peptide at a molecular weight of 90 KDa.

4. Use of the anti-human von willebrand factor leader peptide monoclonal antibody SZ175 of any one of claims 1 to 3 in the preparation of a von willebrand disease typing detection kit.

5. Use of the anti-human von willebrand factor leader peptide monoclonal antibody SZ175 of any one of claims 1 to 3 in the preparation of a kit for prognosis of a disease in which endothelial cells are damaged.

6. The use according to claim 5, wherein the endothelial cell damage disease is myocardial infarction or bone marrow transplantation.