Detailed Description
The present inventors have conducted extensive and intensive studies and extensive screening to develop a chimeric measles attenuated strain and a strain derived therefrom for the first time. Specifically, the inventors replaced the F gene of H1a genotype measles virus to the corresponding position of A genotype vaccine strain; experimental results show that the in vitro replication capacity of the chimeric virus is enhanced by the replacement, the immunogenicity is better, and the better immune protection effect on the measles virus epidemic strain can be realized. The present invention has been completed based on this finding.
Term(s) for
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….
As used herein, the term "polynucleotide" refers to a chain compound formed by the polymerization of nucleotides.
As used herein, the term "vaccine" refers to a biological product made against infection by various types of pathogenic microorganisms for prophylactic or therapeutic vaccination. Vaccines are roughly classified into attenuated live vaccines, inactivated vaccines, recombinant protein vaccines, vector vaccines, nucleic acid vaccines, and the like; attenuated live vaccines are preferred herein.
As used herein, the term "serotype" refers to a method of classification of a pathogen: typically, the immunogenicity of a virus or bacterium, e.g., if the serotypes are the same, is generally consistent between different strains of the same serotype.
As used herein, the term "genotype" refers to the classification of a virus or bacterium at the genetic level, which is more refined than serotype classification.
As used herein, the term "cross-protective insufficiency" refers to the inability of one of the serotypes as a vaccine to completely protect against challenge by the other serotype, which is referred to as cross-protective insufficiency. Herein, a phenomenon is involved: there are many viruses (such as measles virus, mumps virus, etc.), which have only one serotype, but there is also a certain phenomenon of incomplete cross-protection among different genotypes.
Measles Virus (Measles Virus, MV)
MV belongs to the genus morbillivirus (Morblil ivirus) of the family Paramyxoviridae (Paramyxoviridae), and its virions are spherical, have a diameter of about 120nm to 250nm, and comprise single-stranded negative-strand RNA and nucleocapsid (nucleocapsid) structures. The MV genome is a non-fragmented single-stranded negative-strand 50S RNA, approximately 16kb in length. The genome is sequentially N-P/C/V-M-F-H-L from the 3 'end to the 5' end, and 6 structural and functional proteins are respectively coded: nucleoprotein (N), Phosphoprotein (P), Membrane protein (M), fusion protein, hemagglutinin glycoprotein and RNA-dependent RNA polymerase (Large protein, L).
Measles virus has 6 structural genes, which correspond to 6 major structural proteins. Wherein the P gene can encode three proteins: p, C and V, the other genes each encoding a protein. They are: n protein (60kDa), P protein (72kDa), M protein (38kDa), F protein (a 60kDa protein consisting of two 41kDa and 18kDa polypeptides linked by disulfide bonds), H protein (78-80kDa), often disulfide bonds, form a homodimer and an L polymerase molecule (180- "200 kDa).
The F protein is a glycoprotein with membrane fusion characteristics, has conserved nucleotide sequence and is a characteristic protein shared by members of the Paramyxoviridae family. Both the F protein and the H protein are neutralizing antigens, which induce the production of neutralizing antibodies. The neutralizing antibody induced by the F protein has important significance for resisting virus infection of organisms. The combined effect of the anti-F protein and H protein antibodies is significantly higher than the titer of anti-F protein antibody or anti-H protein antibody alone in vitro neutralizing measles virus.
The measles virus F gene features long non-coding region (580bp) and rich G + C content up to 65.1%. Recent studies have shown that the non-coding region has no effect on the functions of virus replication, infection and the like. The F protein has a signal peptide consisting of 28 amino acid residues. Both the F and H proteins are embedded in the viral lipid bilayer, are encapsulated and form a protuberance. The measles virus F protein, aided by the H protein, acts as a promoter of cell-to-cell or cell-to-virus fusion and mediates virus entry into host cells through fusion of the virus with the cell membrane. F0 is a precursor of the F protein, which is the determinant factor of the virulence of morbillivirus, and the function of the F protein depends mainly on the amino acid sequence to be cleaved and the cleavage efficiency of intracellular cleavage protease. The enzymatic cleavage is not very important for the enrichment of the virus, but it is a prerequisite for the infectivity and pathogenicity of the virus.
In measles viruses of genotype A and H1a, there is a separate F protein. The F proteins of the two have certain homology. The amino acid sequences are respectively shown as SEQ ID NO 1 and SEQ ID NO 2.
Amino acid sequence of protein F of a genotype a measles virus:
MGLKVNVSAIFMAVLLTLQTPTGQIHWGNLSKIGVVGIGSASYKVMTRSSHQSLVIKLMPNITLLNNCTRVEIAEYRRLLRTVLEPIRDALNAMTQNIRPVQSVASSRRHKRFAGVVLAGAALGVATAAQITAGIALHQSMLNSQAIDNLRASLETTNQAIEAIRQAGQEMILAVQGVQDYINNELIPSMNQLSCDLIGQKLGLKLLRYYTEILSLFGPSLRDPISAEISIQALSYALGGDINKVLEKLGYSGGDLLGILESRGIKARITHVDTESYFIVLSIAYPTLSEIKGVIVHRLEGVSYNIGSQEWYTTVPKYVATQGYLISNFDESSCTFMPEGTVCSQNALYPMSPLLQECLRGSTKSCARTLVSGSFGNRFILSQGNLIANCASILCKCYTTGTIINQDPDKILTYIAADHCPVVEVNGVTIQVGSRRYPDAVYLHRIDLGPPISLERLDVGTNLGNAIAKLEDAKELLESSDQILRSMKGLSSTSIVYILIAVCLGGLIGIPALICCCRGRCNKKGEQVGMSRPGLKPDLTGTSKSYVRSL(SEQ ID NO:1)
amino acid sequence of the F protein of measles virus genotype H1 a:
MGLKASVSAIFMTVLLTLQTPTGQIHWGNLSKIGVVGIGSASYKVMTRSSHQSLVIKLMPNITLLNNCTRVEITEYRRLLRTVLEPIRDALNAMTQNIRPVQSVTSSRRHKRFAGVVLAGAALGVATAAQITAGIALHQSMLNSQAIDNLKVSLETTNQAIETIRQAGQEIILAVQGVQDYINNELIPSMNQLSCDLIGQKLGLKLLRYYTEILSLFGPSLRDPISAEISIQALSYALGGDINKVLEKLGYSGDDLLGILESRGIKARITHVDTESYFIVLSIAYPTLSEIKGVIVHRLEGVSYNIGSQEWYTTVPKYVATQGYLISNFDESSCTFMPEGTVCSQNALYPMSPLLQECLRGSTKSCARTLVSGSFGNRFILSQGNLIANCASILCKCYTTGTIINQDPDKILTYIAADYCPVVEVNGVTIQVGSRKYPDAVYLHRIDLGPPISLEKLDVGTNLGNAVAKLEDAKELLESSDQILRSMKGLSSTNIVYILIAVCLGGLIGIPTLICCCRGRCNKKGGQVGMSRPGLKPDLTGTSKSYVRSL(SEQ ID NO:2)
chimeric measles virus attenuated strains and derivative virus strains
As used herein, the terms "chimeric virus", "chimeric measles virus attenuated strain", "attenuated strain of the present invention", "measles virus rMV/F (H1 a)" are used interchangeably and refer to a virus having a preservation number of CCTCC NO: measles virus rMV/F of V202101 (H1 a).
In the present invention, the provided attenuated strain of chimeric measles virus is derived from the wild type a genotype measles virus vaccine strain and, on the basis thereof, the F gene in the genome is replaced by the F gene derived from H1a genotype measles virus.
Wherein the post-replacement region (or new insertion sequence) in the attenuated strain of the chimeric measles virus comprises not only the gene encoding the F protein of the measles virus of H1a genotype, but also the 5 'UTR and 3' UTR sequences of the F gene of the measles virus of H1a genotype, so that the F protein thereof can be better expressed in the recombinant virus.
The sequence of the F gene of the introduced measles virus of H1a genotype:
AGGGCCAAGGAACACACACACCCAGCAGAACCCAAACCCCCGCCCACCGCGCCACGCCCCCACCCCCCAACAACAAGAGGGAGCCCCCAACCAATCCCGCCAGCATCCCCGGCGCCCGCAGGCAGACACACCAACCCCCGAGCAGACCCAGCATCCAGCCACCGGCAATCCAAGACGGGGGGGCCTTCCCAAAAAAGAGCCCCCAGTGGCCGACAGCCAGCACCACGAGGAGGCCCACCCACCCCACACACGACCACGGTAACCAAACCAAAGCCTGGACCACCCTGGGTCACCAGCCCCTAGACTCGGCCATCACCCAGAAGGCAGAAAAGGCCACAACCCGCACACCCCAGCCCCGATCCGGCGGGCAGGCCCCCAACCCGAACCGGCACCCAAGAGCGATCCCCGAAGGACCCCCAAATCCCAAAGGACACCAACATCCCACAGCCCCTCCAAGTCCCCCGATCTCATCCTCTCCTCGAAGGGACCAAAAGATCAATCCACCACACCCGACGACACTCAACTCTCCACCCTTTAAGGAGACACCGGGAATCCCAGAATCAAGACTCACCTAATGTCCATCATGGGCCTCAAGGCGAG CGTCTCTGCCATATTCATGACAGTACTGTTAACTCTCCAAACCCCCACCGGTCAAATCCATTGGGGCAATCTCTCT AAGATAGGGGTGGTAGGGATAGGAAGTGCAAGCTACAAAGTTATGACTCGCTCCAGCCACCAATCATTAGTCATAA AATTAATGCCCAATATAACCCTCCTCAACAACTGCACGAGGGTAGAGATTACAGAATACAGGAGACTACTGAGAAC AGTCCTGGAACCAATTAGGGATGCACTTAACGCAATGACCCAGAACATAAGACCGGTCCAGAGTGTAACCTCAAGT AGGAGACATAAGAGATTTGCAGGAGTGGTCCTGGCAGGTGCTGCCCTAGGCGTTGCCACGGCCGCTCAGATAACAG CTGGCATTGCACTTCACCAGTCCATGCTGAATTCTCAAGCCATTGACAATCTGAAAGTGAGCCTGGAAACTACTAA TCAGGCAATTGAGACAATCAGACAAGCAGGGCAGGAGATAATATTGGCTGTCCAGGGTGTCCAAGACTACATCAAT AATGAGCTGATACCGTCTATGAACCAACTGTCTTGTGATTTAATCGGCCAGAAGCTCGGGCTCAAATTGCTCAGAT ATTATACAGAAATCCTGTCATTATTTGGCCCCAGCTTACGGGACCCCATATCTGCGGAGATATCTATCCAGGCTTT GAGCTATGCGCTTGGAGGAGATATCAATAAAGTGTTAGAAAAGCTCGGATACAGTGGAGATGATTTACTGGGCATC TTAGAGAGCAGAGGGATAAAGGCTCGGATAACTCACGTCGACACAGAGTCCTACTTCATTGTCTTAAGTATAGCCT ATCCGACACTGTCCGAGATCAAGGGGGTCATTGTCCACCGGCTAGAGGGGGTCTCGTACAACATAGGCTCTCAAGA ATGGTATACCACTGTGCCCAAGTATGTTGCAACCCAAGGGTACCTTATCTCGAATTTTGATGAGTCATCGTGTACT TTCATGCCAGAGGGGACTGTGTGCAGCCAAAATGCCTTGTACCCGATGAGTCCTCTGCTTCAAGAATGCCTTCGGG GGTCCACTAAGTCCTGTGCTCGTACACTTGTATCCGGGTCCTTTGGGAACCGGTTCATTTTATCACAAGGGAACCT AATAGCTAATTGTGCATCAATCCTTTGCAAGTGTTACACAACAGGAACGATCATCAATCAAGACCCTGACAAGATC CTGACATACATTGCTGCCGACTACTGCCCGGTAGTCGAGGTGAACGGCGTGACCATCCAAGTCGGGAGCAGGAAGT ACCCAGATGCTGTGTACTTGCACAGAATTGACCTTGGTCCTCCCATATCATTGGAGAAGTTGGACGTAGGGACAAA CCTGGGGAATGCAGTTGCCAAGTTGGAGGATGCCAAGGAATTGTTAGAGTCATCGGACCAGATATTGAGGAGTATG AAAGGTTTGTCGAGCACTAACATAGTCTACATCCTGATTGCAGTGTGTCTTGGAGGGTTGATAGGGATTCCCACTT TAATATGTTGCTGCAGGGGGCGTTGTAACAAAAAGGGAGGACAGGTTGGTATGTCAAGACCAGGCCTAAAGCCTGA TCTGACAGGAACATCAAAATCCTATGTAAGGTCGCTCTGATCCTCTACTACTCCTGAAACACAAATGTCCCACAAGTCTCCCCTTCGTCATCAAGCAATCACTGCATCCAGCATCACTCCCACTTGAAATTATCTCTGGCTTCCTTCTGGCCGAATACGATCGGTCATTAATAAAAA (SEQ ID NO:3, wherein the underlined part is the gene encoding the F protein of the H1a genotype measles virus)
Replaced F gene in the genome of a genotype measles virus:
agggccaaggaacatacacacccaacagaacccagaccccggcccacggcgccgcgcccccaacccccgacaaccagagggagcccccaaccaatcccgccggctcccccggtgcccacaggcagggacaccaacccccgaacagacccagcacccaaccatcgacaatccaagacgggggggcccccccaaaaaaaggcccccaggggccgacagccagcaccgcgaggaagcccacccaccccacacacgaccacggcaaccaaaccagaacccagaccaccctgggccaccagctcccagactcggccatcaccccgcagaaaggaaaggccacaacccgcgcaccccagccccgatccggcggggagccacccaacccgaaccagcacccaagagcgatccccgaaggacccccgaaccgcaaaggacatcagtatcccacagcctctccaagtcccccggtctcctcctcttctcgaagggaccaaaagatcaatccaccacacccgacgacactcaactccccacccctaaaggagacaccgggaatcccagaatcaagactcatccaatgtccatcatgggtctcaaggtgaacgtctctgccatattcatggcagtactgttaactctccaaacacccaccggtcaaatccattggggcaatctctctaagataggggtggtaggaataggaagtgcaagctacaaagttatgactcgttccagccatcaatcattagtcataaaattaatgcccaatataactctcctcaataactgcacgagggtagagattgcagaatacaggagactactgagaacagttttggaaccaattagagatgcacttaatgcaatgacccagaatataagaccggttcagagtgtagcttcaagtaggagacacaagagatttgcgggagtagtcctggcaggtgcggccctaggcgttgccacagctgctcagataacagccggcattgcacttcaccagtccatgctgaactctcaagccatcgacaatctgagagcgagcctggaaactactaatcaggcaattgagacaatcagacaagcagggcaggagatgatattggctgttcagggtgtccaagactacatcaataatgagctgataccgtctatgaaccaactatcttgtgatttaatcggccagaagctcgggctcaaattgctcagatactatacagaaatcctgtcattatttggccccagtttacgggaccccatatctgcggagatatctatccaggctttgagctatgcgcttggaggagacatcaataaggtgttagaaaagctcggatacagtggaggtgatttactgggcatcttagagagcggaggaataaaggcccggataactcacgtcgacacagagtcctacttcattgtcctcagtatagcctatccgacgctgtccgagattaagggggtgattgtccaccggctagagggggtctcgtacaacataggctctcaagagtggtataccactgtgcccaagtatgttgcaacccaagggtaccttatctcgaattttgatgagtcatcgtgtactttcatgccagaggggactgtgtgcagccaaaatgccttgtacccgatgagtcctctgctccaagaatgcctccgggggtacaccaagtcctgtgctcgtacactcgtatccgggtcttttgggaaccggttcattttatcacaagggaacctaatagccaattgtgcatcaatcctttgcaagtgttacacaacaggaacgatcattaatcaagaccctgacaagatcctaacatacattgctgccgatcactgcccggtagtcgaggtgaacggcgtgaccatccaagtcgggagcaggaggtatccagacgctgtgtacttgcacagaattgacctcggtcctcccatatcattggagaggttggacgtagggacaaatctggggaatgcaattgctaagttggaggatgccaaggaattgttggagtcatcggaccagatattgaggagtatgaaaggtttatcgagcactagcatagtctacatcctgattgcagtgtgtcttggagggttgatagggatccccgctttaatatgttgctgcagggggcgttgtaacaaaaagggagaacaagttggtatgtcaagaccaggcctaaagcctgatcttacgggaacatcaaaatcctatgtaaggtcgctctgatcctctacaactcttgaaacacaaatgtcccacaagtctcctcttcgtcatcaagcaaccaccgcacccagcatcaagcccacctgaaattatctccggcttccctctggccgaacaatatcggtagttaatcaaaa(SEQ ID NO:6)
preferably, the genomic sequence from the N gene to the L gene of the wild type A genotype measles virus is represented by SEQ ID NO 4, whereas the genomic sequence from the N gene to the L gene of the chimeric measles virus of the invention has the following nucleotide sequence: 5, wherein the F gene sequence shown as SEQ ID NO 6 in the genome of the wild type A genotype measles virus is replaced by the nucleotide sequence of the H1a genotype measles virus F gene shown as SEQ ID NO 3.
Furthermore, the present invention provides derivative virus strains derived from the attenuated strains of the chimeric measles viruses of the invention.
The attenuated strains of the chimeric measles viruses or derived strains thereof according to the invention have one or more of the following characteristics:
(a) high replication capacity: the replication capacity and the preservation number are CCTCC NO: measles virus rMV/F (H1a) of V202101 was comparably replication competent in vitro; wherein, the equivalent replication capacity means that the replication rate is the rate of the nucleic acid with the preservation number of CCTCC NO: the replication rate of measles virus rMV/F (H1a) of V202101 is 80% or more, preferably 90% or more, more preferably 100% or more;
(b) high immunogenicity: immunogenicity and preservation number are CCTCC NO: the immunogenicity of measles virus rMV/F (H1a) of V202101 was comparable; wherein, the immunogenicity is equivalent, namely the titer of the induced neutralizing antibody is the value of CCTCC NO: the titer of neutralizing antibodies induced by measles virus rMV/F (H1a) of V202101 is 80% or more, preferably 90% or more, more preferably 100% or more;
(c) the F gene in the genome was replaced by the F gene derived from H1a genotype measles virus compared to the wild type a genotype measles virus vaccine strain.
The replication capacity of the derivative virus strain provided by the invention is obviously higher than that of a wild type A genotype measles virus vaccine strain. Wherein, the replication capacity is significantly higher than that of the derivative virus strain, which means that the replication rate of the derivative virus strain is more than or equal to 10 times, preferably more than or equal to 100 times, and more preferably more than or equal to 1000 times of that of the wild type A genotype measles virus vaccine strain.
Wherein said replication comprises in vivo and in vitro replication of the virus. Preferably, said replication is replication in a host cell. The host cell is selected from the group consisting of: vero cells, Vero-Slam cells, CEF cells, BHK cells and BSR cells; preferably Vero-Slam cells and Vero cells.
In another embodiment, the derived virus strains of the invention are significantly more immunogenic than wild-type a genotype measles virus vaccine strains. Wherein, the immunogenicity is significantly higher than that of the derivative virus strain, which means that the titer of the neutralizing antibody induced by the derivative virus strain is more than or equal to 1.5 times, preferably more than or equal to 2 times, and more preferably more than or equal to 2.5 times of the titer of the neutralizing antibody induced by the wild type A genotype measles virus vaccine strain.
The neutralizing capacity of the derivative virus strain of the invention to H1a virus is higher than or equal to that of H1a genotype virus to H1a genotype virus; preferably, the neutralizing titer of the derivative virus strain against H1a virus is greater than or equal to 90%, preferably greater than or equal to 100%, more preferably greater than or equal to 120% of the neutralizing titer of H1a genotype virus against H1a genotype virus.
Preferably, the nucleotide sequence from the N gene to the L gene in the genome of the derivative virus strain is selected from the group consisting of: the sequence identity to the nucleotide sequence depicted in SEQ ID NO. 5 is not less than 85%, preferably not less than 90%, more preferably not less than 95% (e.g., not less than 85%, not less than 86%, not less than 87%, not less than 88%, not less than 89%, not less than 90%, not less than 91%, not less than 92%, not less than 93%, not less than 94%, not less than 95%, not less than 96%, not less than 97%, not less than 98% or not less than 99%).
More preferably, the sequence of the F gene in the genome of said wild type A genotype measles virus, corresponding to that shown in SEQ ID NO 6, is replaced by the nucleotide sequence of the F gene of the H1a genotype measles virus, shown in SEQ ID NO 3.
In the present invention, there is also provided a method for preparing the attenuated strain of the chimeric measles virus according to the invention, comprising the steps of:
(i) constructing a chimeric measles virus recombinant plasmid comprising a nucleotide sequence selected from the group consisting of: the F gene corresponding to the nucleotide sequence shown as SEQ ID NO 6 of the genome of the wild type A genotype measles virus is replaced by the nucleotide sequence shown as SEQ ID NO 3; or a nucleotide sequence having a sequence identity of not less than 85%, preferably not less than 90%, more preferably not less than 95% (e.g., not less than 85%, not less than 86%, not less than 87%, not less than 88%, not less than 89%, not less than 90%, not less than 91%, not less than 92%, not less than 93%, not less than 94%, not less than 95%, not less than 96%, not less than 97%, not less than 98% or not less than 99%) to the nucleotide sequence shown in SEQ ID NO. 5;
(ii) obtaining three helper plasmids respectively containing the N gene, the P gene and the L gene in the measles virus; and
(iii) (ii) co-transfecting host cells with the recombinant plasmid obtained in (i) and the three helper plasmids, respectively, culturing for 2-4 days (preferably 3 days), lysing the cells, inoculating to new cells, and culturing until cytopathy is observed, thereby obtaining the attenuated strain of the chimeric measles virus.
Preferably, the host cell is selected from the group consisting of: BSR-T7 cells, 293T cells, Vero cells, Slam/Vero cells, or combinations thereof.
Vaccine composition
In the present invention, there is provided a method of preparing a vaccine composition comprising the steps of:
(i) the preservation number is CCTCC NO: passaging or culturing measles virus rMV/F (H1a) of V202101 or a derivative strain of the virus of claim 2 to produce an attenuated vaccine strain;
(ii) (ii) mixing said attenuated vaccine strain prepared in step (i) with an immunologically acceptable carrier to thereby produce a vaccine composition.
The vaccine composition provided by the invention comprises:
(i) an attenuated strain of a chimeric measles virus according to the first aspect of the invention, a derivative virus strain according to the second aspect of the invention, or a virus-like particle according to the third aspect of the invention; and
(ii) a vaccine acceptable carrier.
Preferably, the carrier is a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutically acceptable carrier comprises a liquid, preferably water, saline or a buffer.
The carrier also contains auxiliary substances, preferably fillers, lubricants, glidants, wetting or emulsifying agents, pH buffering substances and the like. In a preferred embodiment, the vector further comprises a cell transfection reagent.
The vaccine composition of the present invention may be a bivalent vaccine or a multiple vaccine. Preferably, the vaccine composition further comprises a vaccine component derived from one or more pathogens selected from the group consisting of: mumps, rubella, encephalitis B, hepatitis A, chickenpox, polio, or combinations thereof.
In one embodiment, the vaccine components include inactivated strains, attenuated strains, or proteins, nucleic acids, and the like.
In the present invention, the vaccine composition further comprises an adjuvant. Preferably, the adjuvant comprises: particulate and non-particulate adjuvants. In a preferred embodiment, the particulate adjuvant is selected from the group consisting of: an aluminum salt, a water-in-oil emulsion, an oil-in-water emulsion, a nanoparticle, a microparticle, a liposome, an immunostimulatory complex, or a combination thereof. In another preferred embodiment, the non-particulate adjuvant is selected from the group consisting of: muramyl dipeptide and its derivatives, saponin, lipid A, cytokine, derivative polysaccharide, bacterial toxin, microorganism and its product such as mycobacteria (Mycobacterium tuberculosis, Bacillus Calmette-Guerin), Bacillus pumilus, Bordetella pertussis, propolis, or combinations thereof.
In the present invention, preferably, the dose of the virus in each dose of the vaccine composition is not less than 3.5lgCCID 50. In a more preferred embodiment, the vaccine composition of the present invention is in an injectable dosage form.
Viral strain preservation
As used herein, "chimeric measles virus attenuated strain" and "measles virus rMV/F (H1 a)" of the present invention are used interchangeably and have been deposited at the chinese culture collection center (CCTCC) at 12/24 th of 2020 at the addresses: china, wuhan university. The preservation number of the virus strain is CCTCC NO: and V202101.
Use and vaccination methods of the chimeric measles virus attenuated strains of the invention
The attenuated strain of a chimeric measles virus according to the first aspect of the invention, the derivative virus strain according to the second aspect of the invention or the virus-like particle according to the third aspect of the invention has the use for the preparation of a vaccine composition for the prevention of measles.
Preferably, the measles are measles of genotype A.
In addition, the present invention provides an inoculation method for preventing measles, comprising the steps of: a subject in need thereof is vaccinated with an attenuated strain of a chimeric measles virus according to the first aspect of the invention, a derivative virus strain according to the second aspect of the invention, a virus-like particle according to the third aspect of the invention, or a vaccine composition according to the fourth aspect of the invention.
Preferably, the subject is susceptible to measles of 8 months or more.
In a preferred embodiment, the inoculation mode comprises subcutaneous injection inoculation. Preferably, the vaccination dose is 0.3-0.7mL (preferably 0.4-0.6mL, more preferably 0.5mL) and the viral load is not less than 3.5lgCCID50。
The main advantages of the invention include:
1) compared with the existing measles vaccine strains in the market, the chimeric virus has stronger replication capacity and better immunogenicity.
2) The invention utilizes a reverse genetic operation system, can obtain corresponding candidate vaccine strains in a short time, and has high research and development and production efficiency.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.
Example 1: construction and identification of full-length cDNA of chimeric virus
As shown in FIG. 1, the framework of the chimeric measles virus is shown.
Using cDNA reverse transcription of MV-1 measles virus nucleic acid as a template, using specific primers MV-F-F and MV-F-R in Table 1 to amplify an F gene fragment (containing F gene 5 'UTR and F gene 3' UTR) by a PCR method, using an S191 full-length plasmid as a template, using specific primers TY-HN-F and FH-ZL-R to amplify an F gene deletion vector by a PCR method, and then obtaining a target plasmid by a one-step homologous recombination method.
The success of cloning the full-length cDNA of the chimeric virus is determined by enzyme digestion identification, and the result is shown in FIG. 2.
TABLE 1 specific detection primers for chimeric viruses
Example 2: chimeric virus rescue
Experimental methods and procedures:
the cells are inoculated in a 6-well plate, when the cells grow to about 80 percent, the full-length plasmids PAC-S-191, PAC-S-191-F and the related auxiliary plasmids pcDNA3.1-N, pcDNA3.1-P and pcDNA3.1-L, pCAGGS-T7 are co-transfected into 293T cells. After 6 hours, the culture medium is discarded, a culture medium containing 2% FBS fetal bovine serum is added, after 4 days of culture, the cells are passaged according to the ratio of 1:3, and an equal amount of Vero-SLAM cells are added until the cells are fused, and virus supernatant is collected.
Extracting pMV full-length clone and helper plasmid in large quantity; it was co-transfected into cells for viral rescue.
293T cells were seeded in six-well plates for overnight culture, and wells with 80-90% cell confluence were selected for virus rescue.
The specific process is as follows: the full-length plasmid pMV or pMV/F (H1a) (4. mu.g), helper plasmids pcDNA3.1-N (1.5. mu.g), pcDNA3.1-P (0.2. mu.g), pcDNA3.1-L (1.0. mu.g), pCAGGS-T7 (1.0. mu.g) and Lipofectamine TM 2000 transfection reagent (12. mu.L) were mixed in 500. mu.L DMEM medium and incubated at 37 ℃ for 20 min; cells were washed 3 times with PBS, and then the plasmid transfection reagent mixture was added to the cell wells and incubated for 6h at 37 ℃. Washing with PBS for 3 times, changing into DMEM medium containing 2% fetal calf serum and 1% antibiotics, and culturing at 37 deg.C for 3-4 days; and (3) carrying out passage on the cells according to the ratio of 1:3, simultaneously adding an equal amount of Vero-Slam cells, continuously culturing until the cells have a fusogenic lesion, collecting cell supernatants and identifying.
Success of chimeric virus rescue was determined using sequencing and electron microscopy, respectively.
Cell supernatants with cell fusion were collected and inoculated with new cells to the cell fusion lesions, 200ul of cell supernatants were taken for total RNA extraction, then DNA was removed with a DNA removal kit, specific fragments were amplified with specific primers F-C-F and F-C-R (as in Table 1) respectively and sequenced.
The results are shown in FIG. 3. The F gene in the recombinant virus is confirmed to be the F gene of the H1a genotype virus, which indicates that the replacement is successful.
Meanwhile, the virus was grown, the virus supernatant was collected, clarified by centrifugation and concentrated 100-fold, and viral particles of the chimeric virus, which had a particle size equivalent to that of the parent virus rMV, were clearly observed by transmission electron microscopy, as shown in FIG. 4.
Example 3: in vitro characterization of chimeric viruses
To evaluate the growth characteristics of chimeric viruses in vitro, in this example, multistep growth curves of chimeric viruses and their parental viruses were studied in two cell lines, Vero and Vero-Slam, respectively.
First, a cell suspension was prepared so that the cell concentration was 1.0X 105-5.0×105Between cells, cells were arranged at 2X 105Individual cells/well were seeded in 12-well plates.
The next day, when the cells are full of about 90%, washing the cells with PBS, inoculating 1ml of virus at 0.01MOI, incubating at 37 ℃ for 1h, discarding virus solution, rinsing with PBS for 2 times, and changing the maintenance solution. Samples were then taken every 24 hours for 5 consecutive days. Subsequently, the virus titer was examined by the micro-cell pathology method.
As shown in FIG. 5, in Vero cells, the titer of the chimeric virus rMV/F (H1a) was slightly higher than that of the parent virus from the second day after infection, and was 10-fold higher than that of the parent virus at the third day after infection.
Similarly, as shown in FIG. 6, in Vero-Slam cells, the difference in titer between the two was even 1000-fold at 3 days post-infection.
This indicates that the F gene replacement significantly improved the replication ability of the chimeric virus.
Example 4: evaluation of immunogenicity of chimeric viruses
To assess whether the enhancement of the replication capacity of the chimeric virus affects its immunogenicity, in this example, it was evaluated on a BALB/c mouse model.
5 weeks old female BALB/c mice were randomly divided into 6 groups of 10 mice each, and each immunized group of mice was intraperitoneally injected with 500ul of 1.0X 10 mice5CCID50The virus suspension was/ml, and the control group was injected with an equal volume of DMEM. Each group was immunized twice 28 days after the first immunization and orbital blood was collected 14 days after the second immunization. After centrifugation at 3000rpm for 10 minutes at 4 ℃ overnight, serum was collected. The serum was inactivated at 56 ℃ for 30 minutes. Add 50. mu.L of dilution sample to 96-well plate; diluting with a 96-well plate (2-fold dilution), and mixing in parallel with 4 wells (50 uL of sample dilution and 50uL of serum to be detected) at a ratio of 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, 1:512, 1:1024 and 1: 2048; diluting the serum to be detected to 2048 as a negative control (50 muL diluted sample +50 muL serum to be detected), replacing the virus with the diluted sample, and mixing uniformly. Adding 50ul of 1000CCID50/mL virus into each well of the test group of serum to be detected with different dilutions, adding samples from high concentration to low concentration, and mixing uniformly. Preparing Vero-SLAM cell suspension with cell concentration of 1.0X 105-5.0×105Between each, 100. mu.L/well was added to a 96-well plate mixed with serum and virus.
Cytopathic effects were observed on day 7 and recorded.
At the end of day 10 ED50 was calculated using the Reed/Muench method.
The results are shown in FIG. 7. After the F gene is replaced, the chimeric virus integrally keeps the characteristics of the A genotype vaccine strain, namely the neutralizing capacity of the A genotype virus is obviously higher than that of the H1a genotype virus. However, at the same immunization level, the neutralizing antibody titers induced by the chimeric viruses were significantly higher than the parental virus rMV. And the neutralizing capacity to H1a virus is even higher than that to H1a genotype virus by H1a genotype virus.
The results show that the F gene replacement is an excellent strategy for constructing vaccine strains with high immunogenicity.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Shanghai Qingsai Biotechnology Co., Ltd
Beijing saierfusen Biotechnology Co.,Ltd.
<120> construction of a chimeric measles attenuated strain with F Gene substitution
<130> P2020-2296
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 550
<212> PRT
<213> Measles virus (Measles virus)
<400> 1
Met Gly Leu Lys Val Asn Val Ser Ala Ile Phe Met Ala Val Leu Leu
1 5 10 15
Thr Leu Gln Thr Pro Thr Gly Gln Ile His Trp Gly Asn Leu Ser Lys
20 25 30
Ile Gly Val Val Gly Ile Gly Ser Ala Ser Tyr Lys Val Met Thr Arg
35 40 45
Ser Ser His Gln Ser Leu Val Ile Lys Leu Met Pro Asn Ile Thr Leu
50 55 60
Leu Asn Asn Cys Thr Arg Val Glu Ile Ala Glu Tyr Arg Arg Leu Leu
65 70 75 80
Arg Thr Val Leu Glu Pro Ile Arg Asp Ala Leu Asn Ala Met Thr Gln
85 90 95
Asn Ile Arg Pro Val Gln Ser Val Ala Ser Ser Arg Arg His Lys Arg
100 105 110
Phe Ala Gly Val Val Leu Ala Gly Ala Ala Leu Gly Val Ala Thr Ala
115 120 125
Ala Gln Ile Thr Ala Gly Ile Ala Leu His Gln Ser Met Leu Asn Ser
130 135 140
Gln Ala Ile Asp Asn Leu Arg Ala Ser Leu Glu Thr Thr Asn Gln Ala
145 150 155 160
Ile Glu Ala Ile Arg Gln Ala Gly Gln Glu Met Ile Leu Ala Val Gln
165 170 175
Gly Val Gln Asp Tyr Ile Asn Asn Glu Leu Ile Pro Ser Met Asn Gln
180 185 190
Leu Ser Cys Asp Leu Ile Gly Gln Lys Leu Gly Leu Lys Leu Leu Arg
195 200 205
Tyr Tyr Thr Glu Ile Leu Ser Leu Phe Gly Pro Ser Leu Arg Asp Pro
210 215 220
Ile Ser Ala Glu Ile Ser Ile Gln Ala Leu Ser Tyr Ala Leu Gly Gly
225 230 235 240
Asp Ile Asn Lys Val Leu Glu Lys Leu Gly Tyr Ser Gly Gly Asp Leu
245 250 255
Leu Gly Ile Leu Glu Ser Arg Gly Ile Lys Ala Arg Ile Thr His Val
260 265 270
Asp Thr Glu Ser Tyr Phe Ile Val Leu Ser Ile Ala Tyr Pro Thr Leu
275 280 285
Ser Glu Ile Lys Gly Val Ile Val His Arg Leu Glu Gly Val Ser Tyr
290 295 300
Asn Ile Gly Ser Gln Glu Trp Tyr Thr Thr Val Pro Lys Tyr Val Ala
305 310 315 320
Thr Gln Gly Tyr Leu Ile Ser Asn Phe Asp Glu Ser Ser Cys Thr Phe
325 330 335
Met Pro Glu Gly Thr Val Cys Ser Gln Asn Ala Leu Tyr Pro Met Ser
340 345 350
Pro Leu Leu Gln Glu Cys Leu Arg Gly Ser Thr Lys Ser Cys Ala Arg
355 360 365
Thr Leu Val Ser Gly Ser Phe Gly Asn Arg Phe Ile Leu Ser Gln Gly
370 375 380
Asn Leu Ile Ala Asn Cys Ala Ser Ile Leu Cys Lys Cys Tyr Thr Thr
385 390 395 400
Gly Thr Ile Ile Asn Gln Asp Pro Asp Lys Ile Leu Thr Tyr Ile Ala
405 410 415
Ala Asp His Cys Pro Val Val Glu Val Asn Gly Val Thr Ile Gln Val
420 425 430
Gly Ser Arg Arg Tyr Pro Asp Ala Val Tyr Leu His Arg Ile Asp Leu
435 440 445
Gly Pro Pro Ile Ser Leu Glu Arg Leu Asp Val Gly Thr Asn Leu Gly
450 455 460
Asn Ala Ile Ala Lys Leu Glu Asp Ala Lys Glu Leu Leu Glu Ser Ser
465 470 475 480
Asp Gln Ile Leu Arg Ser Met Lys Gly Leu Ser Ser Thr Ser Ile Val
485 490 495
Tyr Ile Leu Ile Ala Val Cys Leu Gly Gly Leu Ile Gly Ile Pro Ala
500 505 510
Leu Ile Cys Cys Cys Arg Gly Arg Cys Asn Lys Lys Gly Glu Gln Val
515 520 525
Gly Met Ser Arg Pro Gly Leu Lys Pro Asp Leu Thr Gly Thr Ser Lys
530 535 540
Ser Tyr Val Arg Ser Leu
545 550
<210> 2
<211> 550
<212> PRT
<213> Measles virus (Measles virus)
<400> 2
Met Gly Leu Lys Ala Ser Val Ser Ala Ile Phe Met Thr Val Leu Leu
1 5 10 15
Thr Leu Gln Thr Pro Thr Gly Gln Ile His Trp Gly Asn Leu Ser Lys
20 25 30
Ile Gly Val Val Gly Ile Gly Ser Ala Ser Tyr Lys Val Met Thr Arg
35 40 45
Ser Ser His Gln Ser Leu Val Ile Lys Leu Met Pro Asn Ile Thr Leu
50 55 60
Leu Asn Asn Cys Thr Arg Val Glu Ile Thr Glu Tyr Arg Arg Leu Leu
65 70 75 80
Arg Thr Val Leu Glu Pro Ile Arg Asp Ala Leu Asn Ala Met Thr Gln
85 90 95
Asn Ile Arg Pro Val Gln Ser Val Thr Ser Ser Arg Arg His Lys Arg
100 105 110
Phe Ala Gly Val Val Leu Ala Gly Ala Ala Leu Gly Val Ala Thr Ala
115 120 125
Ala Gln Ile Thr Ala Gly Ile Ala Leu His Gln Ser Met Leu Asn Ser
130 135 140
Gln Ala Ile Asp Asn Leu Lys Val Ser Leu Glu Thr Thr Asn Gln Ala
145 150 155 160
Ile Glu Thr Ile Arg Gln Ala Gly Gln Glu Ile Ile Leu Ala Val Gln
165 170 175
Gly Val Gln Asp Tyr Ile Asn Asn Glu Leu Ile Pro Ser Met Asn Gln
180 185 190
Leu Ser Cys Asp Leu Ile Gly Gln Lys Leu Gly Leu Lys Leu Leu Arg
195 200 205
Tyr Tyr Thr Glu Ile Leu Ser Leu Phe Gly Pro Ser Leu Arg Asp Pro
210 215 220
Ile Ser Ala Glu Ile Ser Ile Gln Ala Leu Ser Tyr Ala Leu Gly Gly
225 230 235 240
Asp Ile Asn Lys Val Leu Glu Lys Leu Gly Tyr Ser Gly Asp Asp Leu
245 250 255
Leu Gly Ile Leu Glu Ser Arg Gly Ile Lys Ala Arg Ile Thr His Val
260 265 270
Asp Thr Glu Ser Tyr Phe Ile Val Leu Ser Ile Ala Tyr Pro Thr Leu
275 280 285
Ser Glu Ile Lys Gly Val Ile Val His Arg Leu Glu Gly Val Ser Tyr
290 295 300
Asn Ile Gly Ser Gln Glu Trp Tyr Thr Thr Val Pro Lys Tyr Val Ala
305 310 315 320
Thr Gln Gly Tyr Leu Ile Ser Asn Phe Asp Glu Ser Ser Cys Thr Phe
325 330 335
Met Pro Glu Gly Thr Val Cys Ser Gln Asn Ala Leu Tyr Pro Met Ser
340 345 350
Pro Leu Leu Gln Glu Cys Leu Arg Gly Ser Thr Lys Ser Cys Ala Arg
355 360 365
Thr Leu Val Ser Gly Ser Phe Gly Asn Arg Phe Ile Leu Ser Gln Gly
370 375 380
Asn Leu Ile Ala Asn Cys Ala Ser Ile Leu Cys Lys Cys Tyr Thr Thr
385 390 395 400
Gly Thr Ile Ile Asn Gln Asp Pro Asp Lys Ile Leu Thr Tyr Ile Ala
405 410 415
Ala Asp Tyr Cys Pro Val Val Glu Val Asn Gly Val Thr Ile Gln Val
420 425 430
Gly Ser Arg Lys Tyr Pro Asp Ala Val Tyr Leu His Arg Ile Asp Leu
435 440 445
Gly Pro Pro Ile Ser Leu Glu Lys Leu Asp Val Gly Thr Asn Leu Gly
450 455 460
Asn Ala Val Ala Lys Leu Glu Asp Ala Lys Glu Leu Leu Glu Ser Ser
465 470 475 480
Asp Gln Ile Leu Arg Ser Met Lys Gly Leu Ser Ser Thr Asn Ile Val
485 490 495
Tyr Ile Leu Ile Ala Val Cys Leu Gly Gly Leu Ile Gly Ile Pro Thr
500 505 510
Leu Ile Cys Cys Cys Arg Gly Arg Cys Asn Lys Lys Gly Gly Gln Val
515 520 525
Gly Met Ser Arg Pro Gly Leu Lys Pro Asp Leu Thr Gly Thr Ser Lys
530 535 540
Ser Tyr Val Arg Ser Leu
545 550
<210> 3
<211> 2373
<212> DNA
<213> Measles virus (Measles virus)
<400> 3
agggccaagg aacacacaca cccagcagaa cccaaacccc cgcccaccgc gccacgcccc 60
caccccccaa caacaagagg gagcccccaa ccaatcccgc cagcatcccc ggcgcccgca 120
ggcagacaca ccaacccccg agcagaccca gcatccagcc accggcaatc caagacgggg 180
gggccttccc aaaaaagagc ccccagtggc cgacagccag caccacgagg aggcccaccc 240
accccacaca cgaccacggt aaccaaacca aagcctggac caccctgggt caccagcccc 300
tagactcggc catcacccag aaggcagaaa aggccacaac ccgcacaccc cagccccgat 360
ccggcgggca ggcccccaac ccgaaccggc acccaagagc gatccccgaa ggacccccaa 420
atcccaaagg acaccaacat cccacagccc ctccaagtcc cccgatctca tcctctcctc 480
gaagggacca aaagatcaat ccaccacacc cgacgacact caactctcca ccctttaagg 540
agacaccggg aatcccagaa tcaagactca cctaatgtcc atcatgggcc tcaaggcgag 600
cgtctctgcc atattcatga cagtactgtt aactctccaa acccccaccg gtcaaatcca 660
ttggggcaat ctctctaaga taggggtggt agggatagga agtgcaagct acaaagttat 720
gactcgctcc agccaccaat cattagtcat aaaattaatg cccaatataa ccctcctcaa 780
caactgcacg agggtagaga ttacagaata caggagacta ctgagaacag tcctggaacc 840
aattagggat gcacttaacg caatgaccca gaacataaga ccggtccaga gtgtaacctc 900
aagtaggaga cataagagat ttgcaggagt ggtcctggca ggtgctgccc taggcgttgc 960
cacggccgct cagataacag ctggcattgc acttcaccag tccatgctga attctcaagc 1020
cattgacaat ctgaaagtga gcctggaaac tactaatcag gcaattgaga caatcagaca 1080
agcagggcag gagataatat tggctgtcca gggtgtccaa gactacatca ataatgagct 1140
gataccgtct atgaaccaac tgtcttgtga tttaatcggc cagaagctcg ggctcaaatt 1200
gctcagatat tatacagaaa tcctgtcatt atttggcccc agcttacggg accccatatc 1260
tgcggagata tctatccagg ctttgagcta tgcgcttgga ggagatatca ataaagtgtt 1320
agaaaagctc ggatacagtg gagatgattt actgggcatc ttagagagca gagggataaa 1380
ggctcggata actcacgtcg acacagagtc ctacttcatt gtcttaagta tagcctatcc 1440
gacactgtcc gagatcaagg gggtcattgt ccaccggcta gagggggtct cgtacaacat 1500
aggctctcaa gaatggtata ccactgtgcc caagtatgtt gcaacccaag ggtaccttat 1560
ctcgaatttt gatgagtcat cgtgtacttt catgccagag gggactgtgt gcagccaaaa 1620
tgccttgtac ccgatgagtc ctctgcttca agaatgcctt cgggggtcca ctaagtcctg 1680
tgctcgtaca cttgtatccg ggtcctttgg gaaccggttc attttatcac aagggaacct 1740
aatagctaat tgtgcatcaa tcctttgcaa gtgttacaca acaggaacga tcatcaatca 1800
agaccctgac aagatcctga catacattgc tgccgactac tgcccggtag tcgaggtgaa 1860
cggcgtgacc atccaagtcg ggagcaggaa gtacccagat gctgtgtact tgcacagaat 1920
tgaccttggt cctcccatat cattggagaa gttggacgta gggacaaacc tggggaatgc 1980
agttgccaag ttggaggatg ccaaggaatt gttagagtca tcggaccaga tattgaggag 2040
tatgaaaggt ttgtcgagca ctaacatagt ctacatcctg attgcagtgt gtcttggagg 2100
gttgataggg attcccactt taatatgttg ctgcaggggg cgttgtaaca aaaagggagg 2160
acaggttggt atgtcaagac caggcctaaa gcctgatctg acaggaacat caaaatccta 2220
tgtaaggtcg ctctgatcct ctactactcc tgaaacacaa atgtcccaca agtctcccct 2280
tcgtcatcaa gcaatcactg catccagcat cactcccact tgaaattatc tctggcttcc 2340
ttctggccga atacgatcgg tcattaataa aaa 2373
<210> 4
<211> 15894
<212> DNA
<213> Measles virus (Measles virus)
<400> 4
accaaacaaa gttgggtaag gatagttcaa tcaatgatca tcttctagtg cacttaggat 60
tcaagatcct attatcaggg acaagagcag gattagggat atccgagatg gccacacttt 120
taaggagctt agcattgttc aaaagaaaca aggacaaacc acccattaca tcaggatccg 180
gtggagccat cagaggaatc aaacacatta ttatagtacc aatccctgga gattcctcaa 240
ttaccactcg atccagactt ctggaccggt tggtgaggtt aattggaaac ccggatgtga 300
gcgggcccaa actaacaggg gcactaatag gtatattatc cttatttgtg gagtctccag 360
gtcaattgat tcagaggatc accgatgacc ctgacgttag cataaggctg ttagaggttg 420
tccagagtga ccagtcacaa tctggcctta ccttcgcatc aagaggtacc aacatggagg 480
atgaggcgga ccaatacttt tcacatgatg atccaattag tagtgatcaa tccaggttcg 540
gatggttcgg gaacaaggaa atctcagata ttgaagtgca agaccctgag ggattcaaca 600
tgattctggg taccatccta gcccaaattt gggtcttgct cgcaaaggcg gttacggccc 660
cagacacggc agctgattcg gagctaagaa ggtggataaa gtacacccaa caaagaaggg 720
tagttggtga atttagattg gagagaaaat ggttggatgt ggtgaggaac aggattgccg 780
aggacctctc cttacgccga ttcatggtcg ctctaatcct ggatatcaag agaacacccg 840
gaaacaaacc caggattgct gaaatgatat gtgacattga tacatatatc gtagaggcag 900
gattagccag ttttatcctg actattaagt ttgggataga aactatgtat cctgctcttg 960
gactgcatga atttgctggt gagttatcca cacttgagtc cttgatgaac ctttaccagc 1020
aaatggggga aactgcaccc tacatggtaa tcctggagaa ctcaattcag aacaagttca 1080
gtgcaggatc ataccctctg ctctggagct atgccatggg agtaggagtg gaacttgaaa 1140
actccatggg aggtttgaac tttggccgat cttactttga tccagcatat tttagattag 1200
ggcaagagat ggtaaggagg tcagctggaa aggtcagttc cacattggca tctgaactcg 1260
gtatcactgc cgaggatgca aggcttgttt cagagattgc aatgcatact actgaggaca 1320
agatcagtag agcggttgga cccagacaag cccaagtatc atttctacac ggtgatcaaa 1380
gtgagaatga gctaccgaga ttggggggca aggaagatag gagggtcaaa cagagtcgag 1440
gagaagccag ggagagctac agagaaaccg ggcccagcag agcaagtgat gcgagagctg 1500
cccatcttcc aaccggcaca cccctagaca ttgacactgc aacggagtcc agccaagatc 1560
cgcaggacag tcgaaggtca gctgacgccc tgcttaggct gcaagccatg gcaggaatct 1620
cggaagaaca aggctcagac acggacaccc ctatagtgta caatgacaga aatcttctag 1680
actaggtgcg agaggccgag ggccagaaca acatccgcct accatccatc attgttataa 1740
aaaacttagg aaccaggtcc acacagccgc cagcccatca accatccact cccacgattg 1800
gagccaatgg cagaagagca ggcacgccat gtcaaaaacg gactggaatg catccgggct 1860
ctcaaggccg agcccatcgg ctcactggcc atcgaggaag ctatggcagc atggtcagaa 1920
atatcagaca acccaggaca ggagcgagcc acctgcaggg aagagaaggc aggcagttcg 1980
ggtctcagca aaccatgcct ctcagcaatt ggatcaactg aaggcggtgc acctcgcatc 2040
cgcggtcagg gacctggaga gagcgatgac gacgctgaaa ctttgggaat ccccccaaga 2100
aatctccagg catcaagcac tgggttacag tgttattacg tttatgatca cagcggtgaa 2160
gcggttaagg gaatccaaga tgctgactct atcatggttc aatcaggcct tgatggtgat 2220
agcaccctct caggaggaga caatgaatct gaaaacagcg atgtggatat tggcgaacct 2280
gataccgagg gatatgctat cactgaccgg ggatctgctc ccatctctat ggggttcagg 2340
gcttctgatg ttgaaactgc agaaggaggg gagatccacg agctcctgag actccaatcc 2400
agaggcaaca actttccgaa gcttgggaaa actctcaatg ttcctccgcc cccggacccc 2460
ggtagggcca gcacttccgg gacacccatt aaaaagggca cagacgcgag attagcctca 2520
tttggaacgg agatcgcgtc tttattgaca ggtggtgcaa cccaatgtgc tcgaaagtca 2580
ccctcggaac catcagggcc aggtgcacct gcggggaatg tccccgagtg tgtgagcaat 2640
gccgcactga tacaggagtg gacacccgaa tctggtacca caatctcccc gagatcccag 2700
aataatgaag aagggggaga ctattatgat gatgagctgt tctctgatgt ccaagatatt 2760
aaaacagcct tggccaaaat acacgaggat aatcagaaga taatctccaa gctagaatca 2820
ctgctgttat tgaagggaga agttgagtca attaagaagc agatcaacag gcaaaatatc 2880
agcatatcca ccctggaagg acacctctca agcatcatga tcgccattcc tggacttggg 2940
aaggatccca acgaccccac tgcagatgtc gaaatcaatc ccgacttgaa acccatcata 3000
ggcagagatt caggccgagc actggccgaa gttctcaaga aacccgttgc cagccgacaa 3060
ctccaaggaa tgacaaatgg acggaccagt tccagaggac agctgctgaa ggaatttcag 3120
ctaaagccga tcgggaaaaa gatgagctca gccgtcgggt ttgttcctga caccggccct 3180
gcatcacgca gtgtaatccg ctccattata aaatccagcc ggctagagga ggatcggaag 3240
cgttacctga tgactctcct tgatgatatc aaaggagcca atgatcttgc caagttccac 3300
cagatgctga tgaagataat aatgaagtag ctacagctca acttacctgc caaccccatg 3360
ccagtcgacc caactagtac aacctaaatc cattataaaa aacttaggag caaagtgatt 3420
gcctcccaag gtccacaatg acagagacct acgacttcga caagtcggca tgggacatca 3480
aagggtcgat cgctccgata caacccacca cctacagtga tggcaggctg gtgccccagg 3540
tcagagtcat agatcctggt ctaggcgaca ggaaggatga atgctttatg tacatgtttc 3600
tgctgggggt tgttgaggac agcgattccc tagggcctcc aatcgggcga gcatttgggt 3660
tcctgccctt aggtgttggc agatccacag caaagcccga aaaactcctc aaagaggcca 3720
ctgagcttga catagttgtt agacgtacag cagggctcaa tgaaaaactg gtgttctaca 3780
acaacacccc actaactctc ctcacacctt ggagaaaggt cctaacaaca gggagtgtct 3840
tcaacgcaaa ccaagtgtgc aatgcggtta atctgatacc gctcgatacc ccgcagaggt 3900
tccgtgttgt ttatatgagc atcacccgtc tttcggataa cgggtattac accgttccta 3960
gaagaatgct ggaattcaga tcggtcaatg cagtggcctt caacctgctg gtgaccctta 4020
ggattgacaa ggcgataggc cctgggaaga tcatcgacaa tacagagcaa cttcctgagg 4080
caacatttat ggtccacatc gggaacttca ggagaaagaa gagtgaagtc tactctgccg 4140
attattgcaa aatgaaaatc gaaaagatgg gcctggtttt tgcacttggt gggatagggg 4200
gcaccagtct tcacattaga agcacaggca aaatgagcaa gactctccat gcacaactcg 4260
ggttcaagaa gaccttatgt tacccgctga tggatatcaa tgaagacctt aatcgattac 4320
tctggaggag cagatgcaag atagtaagaa tccaggcagt tttgcagcca tcagttcctc 4380
aagaattccg catttacgac gacgtgatca taaatgatga ccaaggacta ttcaaagttc 4440
tgtagaccgt agtgcccagc aatgcccgaa aacgaccccc ctcacaatga cagccagaag 4500
gcccggacaa aaaagccccc tccgaaagac tccacggacc aagcgagagg ccagccagca 4560
gccgacggca agcgcgaaca ccaggcggcc ccagcacaga acagccctga cacaaggcca 4620
ccaccagcca ccccaatctg catcctcctc gtgggacccc cgaggaccaa cccccaaggc 4680
tgcccccgat ccaaaccacc aaccgcatcc ccaccacccc cgggaaagaa acccccagca 4740
attggaaggc ccctccccct cttcctcaac acaagaactc cacaaccgaa ccgcacaagc 4800
gaccgaggtg acccaaccgc aggcatccga ctccctagac agatcctctc tccccggcaa 4860
actaaacaaa acttagggcc aaggaacata cacacccaac agaacccaga ccccggccca 4920
cggcgccgcg cccccaaccc ccgacaacca gagggagccc ccaaccaatc ccgccggctc 4980
ccccggtgcc cacaggcagg gacaccaacc cccgaacaga cccagcaccc aaccatcgac 5040
aatccaagac gggggggccc ccccaaaaaa aggcccccag gggccgacag ccagcaccgc 5100
gaggaagccc acccacccca cacacgacca cggcaaccaa accagaaccc agaccaccct 5160
gggccaccag ctcccagact cggccatcac cccgcagaaa ggaaaggcca caacccgcgc 5220
accccagccc cgatccggcg gggagccacc caacccgaac cagcacccaa gagcgatccc 5280
cgaaggaccc ccgaaccgca aaggacatca gtatcccaca gcctctccaa gtcccccggt 5340
ctcctcctct tctcgaaggg accaaaagat caatccacca cacccgacga cactcaactc 5400
cccaccccta aaggagacac cgggaatccc agaatcaaga ctcatccaat gtccatcatg 5460
ggtctcaagg tgaacgtctc tgccatattc atggcagtac tgttaactct ccaaacaccc 5520
accggtcaaa tccattgggg caatctctct aagatagggg tggtaggaat aggaagtgca 5580
agctacaaag ttatgactcg ttccagccat caatcattag tcataaaatt aatgcccaat 5640
ataactctcc tcaataactg cacgagggta gagattgcag aatacaggag actactgaga 5700
acagttttgg aaccaattag agatgcactt aatgcaatga cccagaatat aagaccggtt 5760
cagagtgtag cttcaagtag gagacacaag agatttgcgg gagtagtcct ggcaggtgcg 5820
gccctaggcg ttgccacagc tgctcagata acagccggca ttgcacttca ccagtccatg 5880
ctgaactctc aagccatcga caatctgaga gcgagcctgg aaactactaa tcaggcaatt 5940
gagacaatca gacaagcagg gcaggagatg atattggctg ttcagggtgt ccaagactac 6000
atcaataatg agctgatacc gtctatgaac caactatctt gtgatttaat cggccagaag 6060
ctcgggctca aattgctcag atactataca gaaatcctgt cattatttgg ccccagttta 6120
cgggacccca tatctgcgga gatatctatc caggctttga gctatgcgct tggaggagac 6180
atcaataagg tgttagaaaa gctcggatac agtggaggtg atttactggg catcttagag 6240
agcggaggaa taaaggcccg gataactcac gtcgacacag agtcctactt cattgtcctc 6300
agtatagcct atccgacgct gtccgagatt aagggggtga ttgtccaccg gctagagggg 6360
gtctcgtaca acataggctc tcaagagtgg tataccactg tgcccaagta tgttgcaacc 6420
caagggtacc ttatctcgaa ttttgatgag tcatcgtgta ctttcatgcc agaggggact 6480
gtgtgcagcc aaaatgcctt gtacccgatg agtcctctgc tccaagaatg cctccggggg 6540
tacaccaagt cctgtgctcg tacactcgta tccgggtctt ttgggaaccg gttcatttta 6600
tcacaaggga acctaatagc caattgtgca tcaatccttt gcaagtgtta cacaacagga 6660
acgatcatta atcaagaccc tgacaagatc ctaacataca ttgctgccga tcactgcccg 6720
gtagtcgagg tgaacggcgt gaccatccaa gtcgggagca ggaggtatcc agacgctgtg 6780
tacttgcaca gaattgacct cggtcctccc atatcattgg agaggttgga cgtagggaca 6840
aatctgggga atgcaattgc taagttggag gatgccaagg aattgttgga gtcatcggac 6900
cagatattga ggagtatgaa aggtttatcg agcactagca tagtctacat cctgattgca 6960
gtgtgtcttg gagggttgat agggatcccc gctttaatat gttgctgcag ggggcgttgt 7020
aacaaaaagg gagaacaagt tggtatgtca agaccaggcc taaagcctga tcttacggga 7080
acatcaaaat cctatgtaag gtcgctctga tcctctacaa ctcttgaaac acaaatgtcc 7140
cacaagtctc ctcttcgtca tcaagcaacc accgcaccca gcatcaagcc cacctgaaat 7200
tatctccggc ttccctctgg ccgaacaata tcggtagtta atcaaaactt agggtgcaag 7260
atcatccaca atgtcaccac aacgagaccg gataaatgcc ttctacaaag ataaccccca 7320
tcccaaggga agtaggatag tcattaacag agaacatctt atgattgata gaccttatgt 7380
tttgctggct gttctgtttg tcatgtttct gagcttgatc gggttgctag ccattgcagg 7440
cattagactt catcgggcag ccatctacac cgcagagatc cataaaagcc tcagcaccaa 7500
tctagatgta actaactcaa tcgagcatca ggtcaaggac gtgctgacac cactcttcaa 7560
aatcatcggt gatgaagtgg gcctgaggac acctcagaga ttcactgacc tagtgaaatt 7620
aatctctgac aagattaaat tccttaatcc ggatagggag tacgacttca gagatctcac 7680
ttggtgtatc aacccgccag agagaatcaa attggattat gatcaatact gtgcagatgt 7740
ggctgctgaa gagctcatga atgcattggt gaactcaact ctactggaga ccagaacaac 7800
caatcagttc ctagctgtct caaagggaaa ctgctcaggg cccactacaa tcagaggtca 7860
attctcaaac atgtcgctgt ccctgttaga cttgtattta ggtcgaggtt acaatgtgtc 7920
atctatagtc actatgacat cccagggaat gtatggggga acttacctag tggaaaagcc 7980
taatctgagc agcaaaaggt cagagttgtc acaactgagc atgtaccgag tgtttgaagt 8040
aggtgttatc agaaatccgg gtttgggggc tccggtgttc catatgacaa actatcttga 8100
gcaaccagtc agtaatgatc tcagcaactg tatggtggct ttgggggagc tcaaactcgc 8160
agccctttgt cacggggaag attctatcac aattccctat cagggatcag ggaaaggtgt 8220
cagcttccag ctcgtcaagc taggtgtctg gaaatcccca accgacatgc aatcctgggt 8280
ccccttatca acggatgatc cagtgataga caggctttac ctctcatctc acagaggtgt 8340
tatcgctgac aatcaagcaa aatgggctgt cccgacaaca cgaacagatg acaagttgcg 8400
aatggagaca tgcttccaac aggcgtgtaa gggtaaaatc caagcactct gcgagaatcc 8460
cgagtgggca ccattgaagg ataacaggat tccttcatac ggggtcttgt ctgttgatct 8520
gagtctgaca gttgagctta aaatcaaaat tgcttcggga ttcgggccat tgatcacaca 8580
cggttcaggg atggacctat acaaatccaa ccacaacaat gtgtattggc tgactatccc 8640
gccaatgaag aacctagcct taggtgtaat caacacattg gagtggatac cgagattcaa 8700
ggttagtccc tacctcttca ctgtcccaat taaggaagca ggcgaagact gccatgcccc 8760
aacataccta cctgcggagg tggatggtga tgtcaaactc agttccaatc tggtgattct 8820
acctggtcaa gatctccaat atgttttggc aacctacgat acttccaggg ttgaacatgc 8880
tgtggtttat tacgtttaca gcccaagccg ctcattttct tacttttatc cttttaggtt 8940
gcctataaag ggggtcccca tcgaattaca agtggaatgc ttcacatggg accaaaaact 9000
ctggtgccgt cacttctgtg tgcttgcgga ctcagaatct ggtggacata tcactcactc 9060
tgggatggtg ggcatgggag tcagctgcac agtcacccgg gaagatggaa ccaatcgcag 9120
atagggctgc tagtgaacca atcacatgat gtcacccaga catcaggcat acccactagt 9180
gtgaaataga catcagaatt aagaaaaacg tagggtccaa gtggttcccc gttatggact 9240
cgctatctgt caaccagatc ttataccctg aagttcacct agatagcccg atagttacca 9300
ataagatagt agccatcctg gagtatgctc gagtccctca cgcttacagc ctggaggacc 9360
ctacactgtg tcagaacatc aagcaccgcc taaaaaacgg attttccaac caaatgatta 9420
taaacaatgt ggaagttggg aatgtcatca agtccaagct taggagttat ccggcccact 9480
ctcatattcc atatccaaat tgtaatcagg atttatttaa catagaagac aaagagtcaa 9540
cgaggaagat ccgtgaactc ctcaaaaagg ggaattcgct gtactccaaa gtcagtgata 9600
aggttttcca atgcttaagg gacactaact cacggcttgg cctaggctcc gaattgaggg 9660
aggacatcaa ggagaaagtt attaacttgg gagtttacat gcacagctcc cagtggtttg 9720
agccctttct gttttggttt acagtcaaga ctgagatgag gtcagtgatt aaatcacaaa 9780
cccatacttg ccataggagg agacacacac ctgtattctt cactggtagt tcagttgagt 9840
tgctaatctc tcgtgacctt gttgctataa tcagtaaaga gtctcaacat gtatattacc 9900
tgacatttga actggttttg atgtattgtg atgtcataga ggggaggtta atgacagaga 9960
ccgctatgac tattgatgct aggtatacag agcttctagg aagagtcaga tacatgtgga 10020
aactgataga tggtttcttc cctgcactcg ggaatccaac ttatcaaatt gtagccatgc 10080
tggagcctct ttcacttgct tacctgcagc tgagggatat aacagtagaa ctcagaggtg 10140
ctttccttaa ccactgcttt actgaaatac atgatgttct tgaccaaaac gggttttctg 10200
atgaaggtac ttatcatgag ttaactgaag ctctagatta cattttcata actgatgaca 10260
tacatctgac aggggagatt ttctcatttt tcagaagttt cggccacccc agacttgaag 10320
cagtaacggc tgctgaaaat gttaggaaat acatgaatca gcctaaagtc attgtgtatg 10380
agactctgat gaaaggtcat gccatatttt gtggaatcat aatcaacggc tatcgtgaca 10440
ggcacggagg cagttggcca ccgctgaccc tccccctgca tgctgcagac acaatccgga 10500
atgctcaagc ttcaggtgaa gggttaacac atgagcagtg cgttgataac tggaaatctt 10560
ttgctggagt gaaatttggc tgctttatgc ctcttagcct ggatagtgat ctgacaatgt 10620
acctaaagga caaggcactt gctgctctcc aaagggaatg ggattcagtt tacccgaaag 10680
agttcctgcg ttacgaccct cccaagggaa ccgggtcacg gaggcttgta gatgttttcc 10740
ttaatgattc gagctttgac ccatatgatg tgataatgta tgttgtaagt ggagcttacc 10800
tccatgaccc tgagttcaac ctgtcttaca gcctgaaaga aaaggagatc aaggaaacag 10860
gtagactttt tgctaaaatg acttacaaaa tgagggcatg ccaagtgatt gctgaaaatc 10920
taatctcaaa cgggattggc aaatatttta aggacaatgg gatggccaag gatgagcacg 10980
atttgactaa ggcactccac actctagctg tctcaggagt ccccaaagat ctcaaagaaa 11040
gtcacagggg ggggccagtc ttaaaaacct actcccgaag cccagtccac acaagtacca 11100
ggaacgtgag agcagcaaaa gggtttatag ggttccctca agtaattcgg caggaccaag 11160
acactgatca tccggagaat atggaagctt acgagacagt cagtgcattt atcacgactg 11220
atctcaagaa gtactgcctt aattggagat atgagaccat cagcttgttt gcacagaggc 11280
taaatgagat ttacggattg ccctcatttt tccagtggct gcataagagg cttgagacct 11340
ctgtcctgta tgtaagtgac cctcattgcc cccccgacct tgacgcccat atcccgttat 11400
ataaagtccc caatgatcaa atcttcatta agtaccctat gggaggtata gaagggtatt 11460
gtcagaagct gtggaccatc agcaccattc cctatctata cctggctgct tatgagagcg 11520
gagtaaggat tgcttcgtta gtgcaagggg acaatcagac catagccgta acaaaaaggg 11580
tacccagcac atggccctac aaccttaaga aacgggaagc tgctagagta actagagatt 11640
actttgtaat tcttaggcaa aggctacatg atattggcca tcacctcaag gcaaatgaga 11700
caattgtttc atcacatttt tttgtctatt caaaaggaat atattatgat gggctacttg 11760
tgtcccaatc actcaagagc atcgcaagat gtgtattctg gtcagagact atagttgatg 11820
aaacaagggc agcatgcagt aatattgcta caacaatggc taaaagcatc gagagaggtt 11880
atgaccgtta ccttgcatat tccctgaacg tcctaaaagt gatacagcaa attctgatct 11940
ctcttggctt cacaatcaat tcaaccatga cccgggatgt agtcataccc ctcctcacaa 12000
acaacgacct cttaataagg atggcactgt tgcccgctcc tattgggggg atgaattatc 12060
tgaatatgag caggctgttt gtcagaaaca tcggtgatcc agtaacatca tcaattgctg 12120
atctcaagag aatgattctc gcctcactaa tgcctgaaga gaccctccat caagtaatga 12180
cacaacaacc gggggactct tcattcctag actgggctag cgacccttac tcagcaaatc 12240
ttgtatgtgt ccagagcatc actagactcc tcaagaacat aactgcaagg tttgtcctga 12300
tccatagtcc aaacccaatg ttaaaaggat tattccatga tgacagtaaa gaagaggacg 12360
agggactggc ggcattcctc atggacaggc atattatagt acctagggca gctcatgaaa 12420
tcctggatca tagtgtcaca ggggcaagag agtctattgc aggcatgctg gataccacaa 12480
aaggcttgat tcgagccagc atgaggaagg gggggttaac ctctcgagtg ataaccagat 12540
tgtccaatta tgactatgaa caattcagag cagggatggt gctattgaca ggaagaaaga 12600
gaaatgtcct cattgacaaa gagtcatgtt cagtgcagct ggcgagagct ctaagaagcc 12660
atatgtgggc gaggctagct cgaggacggc ctatttacgg ccttgaggtc cctgatgtac 12720
tagaatctat gcgaggccac cttattcggc gtcatgagac atgtgtcatc tgcgagtgtg 12780
gatcagtcaa ctacggatgg ttttttgtcc cctcgggttg ccaactggat gatattgaca 12840
aggaaacatc atccttgaga gtcccatata ttggttctac cactgatgag agaacagaca 12900
tgaagcttgc cttcgtaaga gccccaagtc gatccttgcg atctgctgtt agaatagcaa 12960
cagtgtactc atgggcttac ggtgatgatg atagctcttg gaacgaagcc tggttgttgg 13020
ctaggcaaag ggccaatgtg agcctggagg agctaagggt gatcactccc atctcaactt 13080
cgactaattt agcgcatagg ttgagggatc gtagcactca agtgaaatac tcaggtacat 13140
cccttgtccg agtggcgagg tataccacaa tctccaacga caatctctca tttgtcatat 13200
cagataagaa ggttgatact aactttatat accaacaagg aatgcttcta gggttgggtg 13260
ttttagaaac attgtttcga ctcgagaaag ataccggatc atctaacacg gtattacatc 13320
ttcacgtcga aacagattgt tgcgtgatcc cgatgataga tcatcccagg atacccagct 13380
cccgcaagct agagctgagg gcagagctat gtaccaaccc attgatatat gataatgcac 13440
ctttaattga cagagatgca acaaggctat acacccagag ccataggagg caccttgtgg 13500
aatttgttac atggtccaca ccccaactat atcacatttt agctaagtcc acagcactat 13560
ctatgattga cctggtaaca aaatttgaga aggaccatat gaatgaaatt tcagctctca 13620
taggggatga cgatatcaat agtttcataa ctgagtttct gctcatagag ccaagattat 13680
tcactatcta cttgggccag tgtgcggcca tcaattgggc atttgatgta cattatcata 13740
gaccatcagg gaaatatcag atgggtgagc tgttgtcatc gttcctttct agaatgagca 13800
aaggagtgtt taaggtgctt gtcaatgctc taagccaccc aaagatctac aagaaattct 13860
ggcattgtgg tattatagag cctatccatg gtccttcact tgatgctcaa aacttgcaca 13920
caactgtgtg caacatggtt tacacatgct atatgaccta cctcgacctg ttgttgaatg 13980
aagagttaga agagttcaca tttctcttgt gtgaaagcga cgaggatgta gtaccggaca 14040
gattcgacaa catccaggca aaacacttat gtgttctggc agatttgtac tgtcaaccag 14100
ggacctgccc accaattcga ggtctaagac cggtagagaa atgtgcagtt ctaaccgacc 14160
atatcaaggc agaggctatg ttatctccag caggatcttc gtggaacata aatccaatta 14220
ttgtagacca ttactcatgc tctctgactt atctccggcg aggatcgatc aaacagataa 14280
gattgagagt tgatccagga ttcattttcg acgccctcgc tgaggtaaat gtcagtcagc 14340
caaagatcgg cagcaacaac atctcaaata tgagcatcaa ggctttcaga cccccacacg 14400
atgatgttgc aaaattgctc aaagatatca acacaagcaa gcacaatctt cccatttcag 14460
ggggcaatct cgccaattat gaaatccatg ctttccgcag aatcgggttg aactcatctg 14520
cttgctacaa agctgttgag atatcaacat taattaggag atgccttgag ccaggggagg 14580
acggcttgtt cttgggtgag ggatcgggtt ctatgttgat cacttataaa gagatactta 14640
aactaaacaa gtgcttctat aatagtgggg tttccgccaa ttctagatct ggtcaaaggg 14700
aattagcacc ctatccctcc gaagttggcc ttgtcgaaca cagaatggga gtaggtaata 14760
ttgtcaaagt gctctttaac gggaggcccg aagtcacgtg ggtaggcagt gtagattgct 14820
tcaatttcat agttagtaat atccctacct ctagtgtggg gtttatccat tcagatatag 14880
agaccttgcc tgacaaagat actatagaga agctagagga attggcagcc atcttatcga 14940
tggctctgct cctgggcaaa ataggatcaa tactggtgat taagcttatg cctttcagcg 15000
gggattttgt tcagggattt ataagttatg tagggtctca ttatagagaa gtgaaccttg 15060
tataccctag atacagcaac ttcatctcta ctgaatctta tttggttatg acagatctca 15120
aggctaaccg gctaatgaat cctgaaaaga ttaagcagca gataattgaa tcatctgtga 15180
ggacttcacc tggacttata ggtcacatcc tatccattaa gcaactaagc tgcatacaag 15240
caattgtggg agacgcagtt agtagaggtg atatcaatcc tactctgaaa aaacttacac 15300
ctatagagca ggtgctgatc aattgcgggt tggcaattaa cggacctaag ctgtgcaaag 15360
aattgatcca ccatgatgtt gcctcagggc aagatggatt gcttaattct atactcatcc 15420
tctacaggga gttggcaaga ttcaaagaca accaaagaag tcaacaaggg atgttccacg 15480
cttaccccgt attggtaagt agcaggcaac gagaacttat atctaggatc acccgcaaat 15540
tctgggggca cattcttctt tactccggga acaaaaagtt gataaataag tttatccaga 15600
atctcaagtc cggctatctg atactagact tacaccagaa tatcttcgtt aagaatctat 15660
ccaagtcaga gaaacagatt attatgacgg ggggtttgaa acgtgagtgg gtttttaagg 15720
taacagtcaa ggagaccaaa gaatggtata agttagtcgg atacagtgcc ctgattaagg 15780
actaattggt tgaactccgg aaccctaatc ctgccctagg tggttaggca ttatttgcaa 15840
tatattaaag aaaactttga aaatacgaag tttctattcc cagctttgtc tggt 15894
<210> 5
<211> 15897
<212> DNA
<213> Measles virus (Measles virus)
<400> 5
accaaacaaa gttgggtaag gatagttcaa tcaatgatca tcttctagtg cacttaggat 60
tcaagatcct attatcaggg acaagagcag gattagggat atccgagatg gccacacttt 120
taaggagctt agcattgttc aaaagaaaca aggacaaacc acccattaca tcaggatccg 180
gtggagccat cagaggaatc aaacacatta ttatagtacc aatccctgga gattcctcaa 240
ttaccactcg atccagactt ctggaccggt tggtgaggtt aattggaaac ccggatgtga 300
gcgggcccaa actaacaggg gcactaatag gtatattatc cttatttgtg gagtctccag 360
gtcaattgat tcagaggatc accgatgacc ctgacgttag cataaggctg ttagaggttg 420
tccagagtga ccagtcacaa tctggcctta ccttcgcatc aagaggtacc aacatggagg 480
atgaggcgga ccaatacttt tcacatgatg atccaattag tagtgatcaa tccaggttcg 540
gatggttcgg gaacaaggaa atctcagata ttgaagtgca agaccctgag ggattcaaca 600
tgattctggg taccatccta gcccaaattt gggtcttgct cgcaaaggcg gttacggccc 660
cagacacggc agctgattcg gagctaagaa ggtggataaa gtacacccaa caaagaaggg 720
tagttggtga atttagattg gagagaaaat ggttggatgt ggtgaggaac aggattgccg 780
aggacctctc cttacgccga ttcatggtcg ctctaatcct ggatatcaag agaacacccg 840
gaaacaaacc caggattgct gaaatgatat gtgacattga tacatatatc gtagaggcag 900
gattagccag ttttatcctg actattaagt ttgggataga aactatgtat cctgctcttg 960
gactgcatga atttgctggt gagttatcca cacttgagtc cttgatgaac ctttaccagc 1020
aaatggggga aactgcaccc tacatggtaa tcctggagaa ctcaattcag aacaagttca 1080
gtgcaggatc ataccctctg ctctggagct atgccatggg agtaggagtg gaacttgaaa 1140
actccatggg aggtttgaac tttggccgat cttactttga tccagcatat tttagattag 1200
ggcaagagat ggtaaggagg tcagctggaa aggtcagttc cacattggca tctgaactcg 1260
gtatcactgc cgaggatgca aggcttgttt cagagattgc aatgcatact actgaggaca 1320
agatcagtag agcggttgga cccagacaag cccaagtatc atttctacac ggtgatcaaa 1380
gtgagaatga gctaccgaga ttggggggca aggaagatag gagggtcaaa cagagtcgag 1440
gagaagccag ggagagctac agagaaaccg ggcccagcag agcaagtgat gcgagagctg 1500
cccatcttcc aaccggcaca cccctagaca ttgacactgc aacggagtcc agccaagatc 1560
cgcaggacag tcgaaggtca gctgacgccc tgcttaggct gcaagccatg gcaggaatct 1620
cggaagaaca aggctcagac acggacaccc ctatagtgta caatgacaga aatcttctag 1680
actaggtgcg agaggccgag ggccagaaca acatccgcct accatccatc attgttataa 1740
aaaacttagg aaccaggtcc acacagccgc cagcccatca accatccact cccacgattg 1800
gagccaatgg cagaagagca ggcacgccat gtcaaaaacg gactggaatg catccgggct 1860
ctcaaggccg agcccatcgg ctcactggcc atcgaggaag ctatggcagc atggtcagaa 1920
atatcagaca acccaggaca ggagcgagcc acctgcaggg aagagaaggc aggcagttcg 1980
ggtctcagca aaccatgcct ctcagcaatt ggatcaactg aaggcggtgc acctcgcatc 2040
cgcggtcagg gacctggaga gagcgatgac gacgctgaaa ctttgggaat ccccccaaga 2100
aatctccagg catcaagcac tgggttacag tgttattacg tttatgatca cagcggtgaa 2160
gcggttaagg gaatccaaga tgctgactct atcatggttc aatcaggcct tgatggtgat 2220
agcaccctct caggaggaga caatgaatct gaaaacagcg atgtggatat tggcgaacct 2280
gataccgagg gatatgctat cactgaccgg ggatctgctc ccatctctat ggggttcagg 2340
gcttctgatg ttgaaactgc agaaggaggg gagatccacg agctcctgag actccaatcc 2400
agaggcaaca actttccgaa gcttgggaaa actctcaatg ttcctccgcc cccggacccc 2460
ggtagggcca gcacttccgg gacacccatt aaaaagggca cagacgcgag attagcctca 2520
tttggaacgg agatcgcgtc tttattgaca ggtggtgcaa cccaatgtgc tcgaaagtca 2580
ccctcggaac catcagggcc aggtgcacct gcggggaatg tccccgagtg tgtgagcaat 2640
gccgcactga tacaggagtg gacacccgaa tctggtacca caatctcccc gagatcccag 2700
aataatgaag aagggggaga ctattatgat gatgagctgt tctctgatgt ccaagatatt 2760
aaaacagcct tggccaaaat acacgaggat aatcagaaga taatctccaa gctagaatca 2820
ctgctgttat tgaagggaga agttgagtca attaagaagc agatcaacag gcaaaatatc 2880
agcatatcca ccctggaagg acacctctca agcatcatga tcgccattcc tggacttggg 2940
aaggatccca acgaccccac tgcagatgtc gaaatcaatc ccgacttgaa acccatcata 3000
ggcagagatt caggccgagc actggccgaa gttctcaaga aacccgttgc cagccgacaa 3060
ctccaaggaa tgacaaatgg acggaccagt tccagaggac agctgctgaa ggaatttcag 3120
ctaaagccga tcgggaaaaa gatgagctca gccgtcgggt ttgttcctga caccggccct 3180
gcatcacgca gtgtaatccg ctccattata aaatccagcc ggctagagga ggatcggaag 3240
cgttacctga tgactctcct tgatgatatc aaaggagcca atgatcttgc caagttccac 3300
cagatgctga tgaagataat aatgaagtag ctacagctca acttacctgc caaccccatg 3360
ccagtcgacc caactagtac aacctaaatc cattataaaa aacttaggag caaagtgatt 3420
gcctcccaag gtccacaatg acagagacct acgacttcga caagtcggca tgggacatca 3480
aagggtcgat cgctccgata caacccacca cctacagtga tggcaggctg gtgccccagg 3540
tcagagtcat agatcctggt ctaggcgaca ggaaggatga atgctttatg tacatgtttc 3600
tgctgggggt tgttgaggac agcgattccc tagggcctcc aatcgggcga gcatttgggt 3660
tcctgccctt aggtgttggc agatccacag caaagcccga aaaactcctc aaagaggcca 3720
ctgagcttga catagttgtt agacgtacag cagggctcaa tgaaaaactg gtgttctaca 3780
acaacacccc actaactctc ctcacacctt ggagaaaggt cctaacaaca gggagtgtct 3840
tcaacgcaaa ccaagtgtgc aatgcggtta atctgatacc gctcgatacc ccgcagaggt 3900
tccgtgttgt ttatatgagc atcacccgtc tttcggataa cgggtattac accgttccta 3960
gaagaatgct ggaattcaga tcggtcaatg cagtggcctt caacctgctg gtgaccctta 4020
ggattgacaa ggcgataggc cctgggaaga tcatcgacaa tacagagcaa cttcctgagg 4080
caacatttat ggtccacatc gggaacttca ggagaaagaa gagtgaagtc tactctgccg 4140
attattgcaa aatgaaaatc gaaaagatgg gcctggtttt tgcacttggt gggatagggg 4200
gcaccagtct tcacattaga agcacaggca aaatgagcaa gactctccat gcacaactcg 4260
ggttcaagaa gaccttatgt tacccgctga tggatatcaa tgaagacctt aatcgattac 4320
tctggaggag cagatgcaag atagtaagaa tccaggcagt tttgcagcca tcagttcctc 4380
aagaattccg catttacgac gacgtgatca taaatgatga ccaaggacta ttcaaagttc 4440
tgtagaccgt agtgcccagc aatgcccgaa aacgaccccc ctcacaatga cagccagaag 4500
gcccggacaa aaaagccccc tccgaaagac tccacggacc aagcgagagg ccagccagca 4560
gccgacggca agcgcgaaca ccaggcggcc ccagcacaga acagccctga cacaaggcca 4620
ccaccagcca ccccaatctg catcctcctc gtgggacccc cgaggaccaa cccccaaggc 4680
tgcccccgat ccaaaccacc aaccgcatcc ccaccacccc cgggaaagaa acccccagca 4740
attggaaggc ccctccccct cttcctcaac acaagaactc cacaaccgaa ccgcacaagc 4800
gaccgaggtg acccaaccgc aggcatccga ctccctagac agatcctctc tccccggcaa 4860
actaaacaaa acttctcagg gccaaggaac acacacaccc agcagaaccc aaacccccgc 4920
ccaccgcgcc acgcccccac cccccaacaa caagagggag cccccaacca atcccgccag 4980
catccccggc gcccgcaggc agacacacca acccccgagc agacccagca tccagccacc 5040
ggcaatccaa gacggggggg ccttcccaaa aaagagcccc cagtggccga cagccagcac 5100
cacgaggagg cccacccacc ccacacacga ccacggtaac caaaccaaag cctggaccac 5160
cctgggtcac cagcccctag actcggccat cacccagaag gcagaaaagg ccacaacccg 5220
cacaccccag ccccgatccg gcgggcaggc ccccaacccg aaccggcacc caagagcgat 5280
ccccgaagga cccccaaatc ccaaaggaca ccaacatccc acagcccctc caagtccccc 5340
gatctcatcc tctcctcgaa gggaccaaaa gatcaatcca ccacacccga cgacactcaa 5400
ctctccaccc tttaaggaga caccgggaat cccagaatca agactcacct aatgtccatc 5460
atgggcctca aggcgagcgt ctctgccata ttcatgacag tactgttaac tctccaaacc 5520
cccaccggtc aaatccattg gggcaatctc tctaagatag gggtggtagg gataggaagt 5580
gcaagctaca aagttatgac tcgctccagc caccaatcat tagtcataaa attaatgccc 5640
aatataaccc tcctcaacaa ctgcacgagg gtagagatta cagaatacag gagactactg 5700
agaacagtcc tggaaccaat tagggatgca cttaacgcaa tgacccagaa cataagaccg 5760
gtccagagtg taacctcaag taggagacat aagagatttg caggagtggt cctggcaggt 5820
gctgccctag gcgttgccac ggccgctcag ataacagctg gcattgcact tcaccagtcc 5880
atgctgaatt ctcaagccat tgacaatctg aaagtgagcc tggaaactac taatcaggca 5940
attgagacaa tcagacaagc agggcaggag ataatattgg ctgtccaggg tgtccaagac 6000
tacatcaata atgagctgat accgtctatg aaccaactgt cttgtgattt aatcggccag 6060
aagctcgggc tcaaattgct cagatattat acagaaatcc tgtcattatt tggccccagc 6120
ttacgggacc ccatatctgc ggagatatct atccaggctt tgagctatgc gcttggagga 6180
gatatcaata aagtgttaga aaagctcgga tacagtggag atgatttact gggcatctta 6240
gagagcagag ggataaaggc tcggataact cacgtcgaca cagagtccta cttcattgtc 6300
ttaagtatag cctatccgac actgtccgag atcaaggggg tcattgtcca ccggctagag 6360
ggggtctcgt acaacatagg ctctcaagaa tggtatacca ctgtgcccaa gtatgttgca 6420
acccaagggt accttatctc gaattttgat gagtcatcgt gtactttcat gccagagggg 6480
actgtgtgca gccaaaatgc cttgtacccg atgagtcctc tgcttcaaga atgccttcgg 6540
gggtccacta agtcctgtgc tcgtacactt gtatccgggt cctttgggaa ccggttcatt 6600
ttatcacaag ggaacctaat agctaattgt gcatcaatcc tttgcaagtg ttacacaaca 6660
ggaacgatca tcaatcaaga ccctgacaag atcctgacat acattgctgc cgactactgc 6720
ccggtagtcg aggtgaacgg cgtgaccatc caagtcggga gcaggaagta cccagatgct 6780
gtgtacttgc acagaattga ccttggtcct cccatatcat tggagaagtt ggacgtaggg 6840
acaaacctgg ggaatgcagt tgccaagttg gaggatgcca aggaattgtt agagtcatcg 6900
gaccagatat tgaggagtat gaaaggtttg tcgagcacta acatagtcta catcctgatt 6960
gcagtgtgtc ttggagggtt gatagggatt cccactttaa tatgttgctg cagggggcgt 7020
tgtaacaaaa agggaggaca ggttggtatg tcaagaccag gcctaaagcc tgatctgaca 7080
ggaacatcaa aatcctatgt aaggtcgctc tgatcctcta ctactcctga aacacaaatg 7140
tcccacaagt ctccccttcg tcatcaagca atcactgcat ccagcatcac tcccacttga 7200
aattatctct ggcttccttc tggccgaata cgatcggtca ttaataaaaa cttagggtgc 7260
aagatcatcc acaatgtcac cacaacgaga ccggataaat gccttctaca aagataaccc 7320
ccatcccaag ggaagtagga tagtcattaa cagagaacat cttatgattg atagacctta 7380
tgttttgctg gctgttctgt ttgtcatgtt tctgagcttg atcgggttgc tagccattgc 7440
aggcattaga cttcatcggg cagccatcta caccgcagag atccataaaa gcctcagcac 7500
caatctagat gtaactaact caatcgagca tcaggtcaag gacgtgctga caccactctt 7560
caaaatcatc ggtgatgaag tgggcctgag gacacctcag agattcactg acctagtgaa 7620
attaatctct gacaagatta aattccttaa tccggatagg gagtacgact tcagagatct 7680
cacttggtgt atcaacccgc cagagagaat caaattggat tatgatcaat actgtgcaga 7740
tgtggctgct gaagagctca tgaatgcatt ggtgaactca actctactgg agaccagaac 7800
aaccaatcag ttcctagctg tctcaaaggg aaactgctca gggcccacta caatcagagg 7860
tcaattctca aacatgtcgc tgtccctgtt agacttgtat ttaggtcgag gttacaatgt 7920
gtcatctata gtcactatga catcccaggg aatgtatggg ggaacttacc tagtggaaaa 7980
gcctaatctg agcagcaaaa ggtcagagtt gtcacaactg agcatgtacc gagtgtttga 8040
agtaggtgtt atcagaaatc cgggtttggg ggctccggtg ttccatatga caaactatct 8100
tgagcaacca gtcagtaatg atctcagcaa ctgtatggtg gctttggggg agctcaaact 8160
cgcagccctt tgtcacgggg aagattctat cacaattccc tatcagggat cagggaaagg 8220
tgtcagcttc cagctcgtca agctaggtgt ctggaaatcc ccaaccgaca tgcaatcctg 8280
ggtcccctta tcaacggatg atccagtgat agacaggctt tacctctcat ctcacagagg 8340
tgttatcgct gacaatcaag caaaatgggc tgtcccgaca acacgaacag atgacaagtt 8400
gcgaatggag acatgcttcc aacaggcgtg taagggtaaa atccaagcac tctgcgagaa 8460
tcccgagtgg gcaccattga aggataacag gattccttca tacggggtct tgtctgttga 8520
tctgagtctg acagttgagc ttaaaatcaa aattgcttcg ggattcgggc cattgatcac 8580
acacggttca gggatggacc tatacaaatc caaccacaac aatgtgtatt ggctgactat 8640
cccgccaatg aagaacctag ccttaggtgt aatcaacaca ttggagtgga taccgagatt 8700
caaggttagt ccctacctct tcactgtccc aattaaggaa gcaggcgaag actgccatgc 8760
cccaacatac ctacctgcgg aggtggatgg tgatgtcaaa ctcagttcca atctggtgat 8820
tctacctggt caagatctcc aatatgtttt ggcaacctac gatacttcca gggttgaaca 8880
tgctgtggtt tattacgttt acagcccaag ccgctcattt tcttactttt atccttttag 8940
gttgcctata aagggggtcc ccatcgaatt acaagtggaa tgcttcacat gggaccaaaa 9000
actctggtgc cgtcacttct gtgtgcttgc ggactcagaa tctggtggac atatcactca 9060
ctctgggatg gtgggcatgg gagtcagctg cacagtcacc cgggaagatg gaaccaatcg 9120
cagatagggc tgctagtgaa ccaatcacat gatgtcaccc agacatcagg catacccact 9180
agtgtgaaat agacatcaga attaagaaaa acgtagggtc caagtggttc cccgttatgg 9240
actcgctatc tgtcaaccag atcttatacc ctgaagttca cctagatagc ccgatagtta 9300
ccaataagat agtagccatc ctggagtatg ctcgagtccc tcacgcttac agcctggagg 9360
accctacact gtgtcagaac atcaagcacc gcctaaaaaa cggattttcc aaccaaatga 9420
ttataaacaa tgtggaagtt gggaatgtca tcaagtccaa gcttaggagt tatccggccc 9480
actctcatat tccatatcca aattgtaatc aggatttatt taacatagaa gacaaagagt 9540
caacgaggaa gatccgtgaa ctcctcaaaa aggggaattc gctgtactcc aaagtcagtg 9600
ataaggtttt ccaatgctta agggacacta actcacggct tggcctaggc tccgaattga 9660
gggaggacat caaggagaaa gttattaact tgggagttta catgcacagc tcccagtggt 9720
ttgagccctt tctgttttgg tttacagtca agactgagat gaggtcagtg attaaatcac 9780
aaacccatac ttgccatagg aggagacaca cacctgtatt cttcactggt agttcagttg 9840
agttgctaat ctctcgtgac cttgttgcta taatcagtaa agagtctcaa catgtatatt 9900
acctgacatt tgaactggtt ttgatgtatt gtgatgtcat agaggggagg ttaatgacag 9960
agaccgctat gactattgat gctaggtata cagagcttct aggaagagtc agatacatgt 10020
ggaaactgat agatggtttc ttccctgcac tcgggaatcc aacttatcaa attgtagcca 10080
tgctggagcc tctttcactt gcttacctgc agctgaggga tataacagta gaactcagag 10140
gtgctttcct taaccactgc tttactgaaa tacatgatgt tcttgaccaa aacgggtttt 10200
ctgatgaagg tacttatcat gagttaactg aagctctaga ttacattttc ataactgatg 10260
acatacatct gacaggggag attttctcat ttttcagaag tttcggccac cccagacttg 10320
aagcagtaac ggctgctgaa aatgttagga aatacatgaa tcagcctaaa gtcattgtgt 10380
atgagactct gatgaaaggt catgccatat tttgtggaat cataatcaac ggctatcgtg 10440
acaggcacgg aggcagttgg ccaccgctga ccctccccct gcatgctgca gacacaatcc 10500
ggaatgctca agcttcaggt gaagggttaa cacatgagca gtgcgttgat aactggaaat 10560
cttttgctgg agtgaaattt ggctgcttta tgcctcttag cctggatagt gatctgacaa 10620
tgtacctaaa ggacaaggca cttgctgctc tccaaaggga atgggattca gtttacccga 10680
aagagttcct gcgttacgac cctcccaagg gaaccgggtc acggaggctt gtagatgttt 10740
tccttaatga ttcgagcttt gacccatatg atgtgataat gtatgttgta agtggagctt 10800
acctccatga ccctgagttc aacctgtctt acagcctgaa agaaaaggag atcaaggaaa 10860
caggtagact ttttgctaaa atgacttaca aaatgagggc atgccaagtg attgctgaaa 10920
atctaatctc aaacgggatt ggcaaatatt ttaaggacaa tgggatggcc aaggatgagc 10980
acgatttgac taaggcactc cacactctag ctgtctcagg agtccccaaa gatctcaaag 11040
aaagtcacag gggggggcca gtcttaaaaa cctactcccg aagcccagtc cacacaagta 11100
ccaggaacgt gagagcagca aaagggttta tagggttccc tcaagtaatt cggcaggacc 11160
aagacactga tcatccggag aatatggaag cttacgagac agtcagtgca tttatcacga 11220
ctgatctcaa gaagtactgc cttaattgga gatatgagac catcagcttg tttgcacaga 11280
ggctaaatga gatttacgga ttgccctcat ttttccagtg gctgcataag aggcttgaga 11340
cctctgtcct gtatgtaagt gaccctcatt gcccccccga ccttgacgcc catatcccgt 11400
tatataaagt ccccaatgat caaatcttca ttaagtaccc tatgggaggt atagaagggt 11460
attgtcagaa gctgtggacc atcagcacca ttccctatct atacctggct gcttatgaga 11520
gcggagtaag gattgcttcg ttagtgcaag gggacaatca gaccatagcc gtaacaaaaa 11580
gggtacccag cacatggccc tacaacctta agaaacggga agctgctaga gtaactagag 11640
attactttgt aattcttagg caaaggctac atgatattgg ccatcacctc aaggcaaatg 11700
agacaattgt ttcatcacat ttttttgtct attcaaaagg aatatattat gatgggctac 11760
ttgtgtccca atcactcaag agcatcgcaa gatgtgtatt ctggtcagag actatagttg 11820
atgaaacaag ggcagcatgc agtaatattg ctacaacaat ggctaaaagc atcgagagag 11880
gttatgaccg ttaccttgca tattccctga acgtcctaaa agtgatacag caaattctga 11940
tctctcttgg cttcacaatc aattcaacca tgacccggga tgtagtcata cccctcctca 12000
caaacaacga cctcttaata aggatggcac tgttgcccgc tcctattggg gggatgaatt 12060
atctgaatat gagcaggctg tttgtcagaa acatcggtga tccagtaaca tcatcaattg 12120
ctgatctcaa gagaatgatt ctcgcctcac taatgcctga agagaccctc catcaagtaa 12180
tgacacaaca accgggggac tcttcattcc tagactgggc tagcgaccct tactcagcaa 12240
atcttgtatg tgtccagagc atcactagac tcctcaagaa cataactgca aggtttgtcc 12300
tgatccatag tccaaaccca atgttaaaag gattattcca tgatgacagt aaagaagagg 12360
acgagggact ggcggcattc ctcatggaca ggcatattat agtacctagg gcagctcatg 12420
aaatcctgga tcatagtgtc acaggggcaa gagagtctat tgcaggcatg ctggatacca 12480
caaaaggctt gattcgagcc agcatgagga agggggggtt aacctctcga gtgataacca 12540
gattgtccaa ttatgactat gaacaattca gagcagggat ggtgctattg acaggaagaa 12600
agagaaatgt cctcattgac aaagagtcat gttcagtgca gctggcgaga gctctaagaa 12660
gccatatgtg ggcgaggcta gctcgaggac ggcctattta cggccttgag gtccctgatg 12720
tactagaatc tatgcgaggc caccttattc ggcgtcatga gacatgtgtc atctgcgagt 12780
gtggatcagt caactacgga tggttttttg tcccctcggg ttgccaactg gatgatattg 12840
acaaggaaac atcatccttg agagtcccat atattggttc taccactgat gagagaacag 12900
acatgaagct tgccttcgta agagccccaa gtcgatcctt gcgatctgct gttagaatag 12960
caacagtgta ctcatgggct tacggtgatg atgatagctc ttggaacgaa gcctggttgt 13020
tggctaggca aagggccaat gtgagcctgg aggagctaag ggtgatcact cccatctcaa 13080
cttcgactaa tttagcgcat aggttgaggg atcgtagcac tcaagtgaaa tactcaggta 13140
catcccttgt ccgagtggcg aggtatacca caatctccaa cgacaatctc tcatttgtca 13200
tatcagataa gaaggttgat actaacttta tataccaaca aggaatgctt ctagggttgg 13260
gtgttttaga aacattgttt cgactcgaga aagataccgg atcatctaac acggtattac 13320
atcttcacgt cgaaacagat tgttgcgtga tcccgatgat agatcatccc aggataccca 13380
gctcccgcaa gctagagctg agggcagagc tatgtaccaa cccattgata tatgataatg 13440
cacctttaat tgacagagat gcaacaaggc tatacaccca gagccatagg aggcaccttg 13500
tggaatttgt tacatggtcc acaccccaac tatatcacat tttagctaag tccacagcac 13560
tatctatgat tgacctggta acaaaatttg agaaggacca tatgaatgaa atttcagctc 13620
tcatagggga tgacgatatc aatagtttca taactgagtt tctgctcata gagccaagat 13680
tattcactat ctacttgggc cagtgtgcgg ccatcaattg ggcatttgat gtacattatc 13740
atagaccatc agggaaatat cagatgggtg agctgttgtc atcgttcctt tctagaatga 13800
gcaaaggagt gtttaaggtg cttgtcaatg ctctaagcca cccaaagatc tacaagaaat 13860
tctggcattg tggtattata gagcctatcc atggtccttc acttgatgct caaaacttgc 13920
acacaactgt gtgcaacatg gtttacacat gctatatgac ctacctcgac ctgttgttga 13980
atgaagagtt agaagagttc acatttctct tgtgtgaaag cgacgaggat gtagtaccgg 14040
acagattcga caacatccag gcaaaacact tatgtgttct ggcagatttg tactgtcaac 14100
cagggacctg cccaccaatt cgaggtctaa gaccggtaga gaaatgtgca gttctaaccg 14160
accatatcaa ggcagaggct atgttatctc cagcaggatc ttcgtggaac ataaatccaa 14220
ttattgtaga ccattactca tgctctctga cttatctccg gcgaggatcg atcaaacaga 14280
taagattgag agttgatcca ggattcattt tcgacgccct cgctgaggta aatgtcagtc 14340
agccaaagat cggcagcaac aacatctcaa atatgagcat caaggctttc agacccccac 14400
acgatgatgt tgcaaaattg ctcaaagata tcaacacaag caagcacaat cttcccattt 14460
cagggggcaa tctcgccaat tatgaaatcc atgctttccg cagaatcggg ttgaactcat 14520
ctgcttgcta caaagctgtt gagatatcaa cattaattag gagatgcctt gagccagggg 14580
aggacggctt gttcttgggt gagggatcgg gttctatgtt gatcacttat aaagagatac 14640
ttaaactaaa caagtgcttc tataatagtg gggtttccgc caattctaga tctggtcaaa 14700
gggaattagc accctatccc tccgaagttg gccttgtcga acacagaatg ggagtaggta 14760
atattgtcaa agtgctcttt aacgggaggc ccgaagtcac gtgggtaggc agtgtagatt 14820
gcttcaattt catagttagt aatatcccta cctctagtgt ggggtttatc cattcagata 14880
tagagacctt gcctgacaaa gatactatag agaagctaga ggaattggca gccatcttat 14940
cgatggctct gctcctgggc aaaataggat caatactggt gattaagctt atgcctttca 15000
gcggggattt tgttcaggga tttataagtt atgtagggtc tcattataga gaagtgaacc 15060
ttgtataccc tagatacagc aacttcatct ctactgaatc ttatttggtt atgacagatc 15120
tcaaggctaa ccggctaatg aatcctgaaa agattaagca gcagataatt gaatcatctg 15180
tgaggacttc acctggactt ataggtcaca tcctatccat taagcaacta agctgcatac 15240
aagcaattgt gggagacgca gttagtagag gtgatatcaa tcctactctg aaaaaactta 15300
cacctataga gcaggtgctg atcaattgcg ggttggcaat taacggacct aagctgtgca 15360
aagaattgat ccaccatgat gttgcctcag ggcaagatgg attgcttaat tctatactca 15420
tcctctacag ggagttggca agattcaaag acaaccaaag aagtcaacaa gggatgttcc 15480
acgcttaccc cgtattggta agtagcaggc aacgagaact tatatctagg atcacccgca 15540
aattctgggg gcacattctt ctttactccg ggaacaaaaa gttgataaat aagtttatcc 15600
agaatctcaa gtccggctat ctgatactag acttacacca gaatatcttc gttaagaatc 15660
tatccaagtc agagaaacag attattatga cggggggttt gaaacgtgag tgggttttta 15720
aggtaacagt caaggagacc aaagaatggt ataagttagt cggatacagt gccctgatta 15780
aggactaatt ggttgaactc cggaacccta atcctgccct aggtggttag gcattatttg 15840
caatatatta aagaaaactt tgaaaatacg aagtttctat tcccagcttt gtctggt 15897
<210> 6
<211> 2373
<212> DNA
<213> Measles virus (Measles virus)
<400> 6
agggccaagg aacatacaca cccaacagaa cccagacccc ggcccacggc gccgcgcccc 60
caacccccga caaccagagg gagcccccaa ccaatcccgc cggctccccc ggtgcccaca 120
ggcagggaca ccaacccccg aacagaccca gcacccaacc atcgacaatc caagacgggg 180
gggccccccc aaaaaaaggc ccccaggggc cgacagccag caccgcgagg aagcccaccc 240
accccacaca cgaccacggc aaccaaacca gaacccagac caccctgggc caccagctcc 300
cagactcggc catcaccccg cagaaaggaa aggccacaac ccgcgcaccc cagccccgat 360
ccggcgggga gccacccaac ccgaaccagc acccaagagc gatccccgaa ggacccccga 420
accgcaaagg acatcagtat cccacagcct ctccaagtcc cccggtctcc tcctcttctc 480
gaagggacca aaagatcaat ccaccacacc cgacgacact caactcccca cccctaaagg 540
agacaccggg aatcccagaa tcaagactca tccaatgtcc atcatgggtc tcaaggtgaa 600
cgtctctgcc atattcatgg cagtactgtt aactctccaa acacccaccg gtcaaatcca 660
ttggggcaat ctctctaaga taggggtggt aggaatagga agtgcaagct acaaagttat 720
gactcgttcc agccatcaat cattagtcat aaaattaatg cccaatataa ctctcctcaa 780
taactgcacg agggtagaga ttgcagaata caggagacta ctgagaacag ttttggaacc 840
aattagagat gcacttaatg caatgaccca gaatataaga ccggttcaga gtgtagcttc 900
aagtaggaga cacaagagat ttgcgggagt agtcctggca ggtgcggccc taggcgttgc 960
cacagctgct cagataacag ccggcattgc acttcaccag tccatgctga actctcaagc 1020
catcgacaat ctgagagcga gcctggaaac tactaatcag gcaattgaga caatcagaca 1080
agcagggcag gagatgatat tggctgttca gggtgtccaa gactacatca ataatgagct 1140
gataccgtct atgaaccaac tatcttgtga tttaatcggc cagaagctcg ggctcaaatt 1200
gctcagatac tatacagaaa tcctgtcatt atttggcccc agtttacggg accccatatc 1260
tgcggagata tctatccagg ctttgagcta tgcgcttgga ggagacatca ataaggtgtt 1320
agaaaagctc ggatacagtg gaggtgattt actgggcatc ttagagagcg gaggaataaa 1380
ggcccggata actcacgtcg acacagagtc ctacttcatt gtcctcagta tagcctatcc 1440
gacgctgtcc gagattaagg gggtgattgt ccaccggcta gagggggtct cgtacaacat 1500
aggctctcaa gagtggtata ccactgtgcc caagtatgtt gcaacccaag ggtaccttat 1560
ctcgaatttt gatgagtcat cgtgtacttt catgccagag gggactgtgt gcagccaaaa 1620
tgccttgtac ccgatgagtc ctctgctcca agaatgcctc cgggggtaca ccaagtcctg 1680
tgctcgtaca ctcgtatccg ggtcttttgg gaaccggttc attttatcac aagggaacct 1740
aatagccaat tgtgcatcaa tcctttgcaa gtgttacaca acaggaacga tcattaatca 1800
agaccctgac aagatcctaa catacattgc tgccgatcac tgcccggtag tcgaggtgaa 1860
cggcgtgacc atccaagtcg ggagcaggag gtatccagac gctgtgtact tgcacagaat 1920
tgacctcggt cctcccatat cattggagag gttggacgta gggacaaatc tggggaatgc 1980
aattgctaag ttggaggatg ccaaggaatt gttggagtca tcggaccaga tattgaggag 2040
tatgaaaggt ttatcgagca ctagcatagt ctacatcctg attgcagtgt gtcttggagg 2100
gttgataggg atccccgctt taatatgttg ctgcaggggg cgttgtaaca aaaagggaga 2160
acaagttggt atgtcaagac caggcctaaa gcctgatctt acgggaacat caaaatccta 2220
tgtaaggtcg ctctgatcct ctacaactct tgaaacacaa atgtcccaca agtctcctct 2280
tcgtcatcaa gcaaccaccg cacccagcat caagcccacc tgaaattatc tccggcttcc 2340
ctctggccga acaatatcgg tagttaatca aaa 2373
<210> 7
<211> 45
<212> DNA
<213> Artificial sequence (artificial sequence)
<220>