CN113278691B

CN113278691B - Long non-coding RNA and application thereof in diagnosis/treatment of rheumatoid arthritis

Info

Publication number: CN113278691B
Application number: CN202110503038.0A
Authority: CN
Inventors: 戴冽; 马剑达; 荆俊; 吴滔
Original assignee: Sun Yat Sen Memorial Hospital Sun Yat Sen University
Current assignee: Sun Yat Sen Memorial Hospital Sun Yat Sen University
Priority date: 2021-05-08
Filing date: 2021-05-08
Publication date: 2023-04-07
Anticipated expiration: 2041-05-08
Also published as: CN113278691A

Abstract

The invention discloses a long non-coding RNA (lncRNA) and application thereof in diagnosis/treatment of Rheumatoid Arthritis (RA). The invention relates to an application of lncRNA (lncRNA) RP1-90J20.8 in evaluating RA (rheumatoid arthritis) joint inflammation and joint destruction severity and treating target medicaments; the reagent for detecting lncRNA RP1-90J20.8 can assist RA diagnosis and evaluation and judge joint erosion damage; the target silencing of the lncRNA RP1-90J20.8 gene can inhibit joint destruction and assist in the treatment of RA. The application defines the biological function and clinical significance of lncRNA RP1-90J20.8 in RA, provides a sufficient theoretical basis for lncRNA RP1-90J20.8 serving as a marker for RA auxiliary diagnosis and RA prognosis prediction and a new treatment target, and has great significance and application prospect in the aspects of RA auxiliary diagnosis, prognosis evaluation and treatment medicine development.

Description

Long non-coding RNA and application thereof in diagnosis/treatment of rheumatoid arthritis

Technical Field

The invention belongs to the technical field of biological medicines. More particularly, it relates to a long non-coding RNA and its application in diagnosis/treatment of rheumatoid arthritis.

Background

Rheumatoid Arthritis (RA) is a chronic inflammatory autoimmune disease characterized by progressive joint destruction, the main pathological manifestations of which are synovitis and pannus formation, leading to destruction of the articular cartilage and bone, and eventually joint deformity and loss of function.

The currently effective treatment is to apply disease-modifying antirheumatic drugs (DMARDs) as soon as possible after the diagnosis of RA patients. However, although targeted therapeutic drugs such as biological DMARDs and small molecule targeted synthetic DMARDs significantly improve the RA therapeutic effect, their expensive cost limits the application in RA patients in our country. A queue research in China shows that the utilization rate of biological DMARDs in RA in China is only 8.3 percent and is far lower than that in European and American countries. Meanwhile, long-term application of conventional DMARDs such as methotrexate and the like and biological agents can also cause adverse reactions such as infection, hepatotoxicity, myelosuppression, lymphatic system tumor and the like, and further limit the application thereof, so that development of new, high-efficiency and low-toxicity RA targeted therapeutic drugs in clinic is urgently needed.

Fibroblast-like synoviocytes (FLS) are the key effector cells that cause RA synovitis and joint cartilage and bone destruction. RA-FLS has biological characteristics similar to those of tumors, including hyperproliferation, stronger anti-apoptosis capacity, enhanced capacity of secreting inflammatory factors and adhesion molecules, migration and invasiveness and the like. The continuous proliferation of RA-FLS leads to synovial hyperplasia and pannus formation, the secretion of a large amount of inflammatory factors promotes the continuous occurrence of arthritis, and the secretion of adhesion molecules and Matrix Metalloproteinases (MMPs) and the migration and invasiveness of cells cause erosion of bones and cartilages, eventually causing joint destruction, resulting in disability. Therefore, treatment with RA-FLS is of great importance for alleviating RA conditions and inhibiting RA joint destruction.

The long noncoding RNA (lncRNA) refers to a noncoding RNA subclass of which the transcript length is more than 200 nucleotides and does not code protein, can be used as an inducing molecule, a bait molecule, a scaffold molecule and the like to regulate and control gene expression and functions at multiple levels such as chromatin reconstruction, gene transcription and translation, protein modification and the like through interaction with biological macromolecules such as DNA, protein, mRNA, microRNA and the like, and plays a key regulation and control role in life activities. Currently, there is insufficient research on the role of lncRNA in the biological function of RA-FLS.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a novel target point and scheme for RA diagnosis, evaluation and treatment.

The invention aims to provide application of lncRNA as a target for RA diagnosis or treatment.

The invention also aims to provide application of the marker for identifying the lncRNA in preparing products for diagnosing or treating RA.

The invention also aims to provide application of the lncRNA inhibitor in preparing RA diagnosis products.

The above purpose of the invention is realized by the following technical scheme:

to study the role of lncRNA in the development of RA, we analyzed and detected lncRNA differentially expressed in synovial FLS (n = 5) of RA patients (n = 5) and normal control patients, and the results showed that lncRNARP1-90J20.8 (lncRNA RP1-90J20.8 is a long lncRNA with a length of 408nt, which is located on human chromosome chr6 (p 25.2)) in RA-FLS is 11.84 times higher than synovial FLS of normal control patients, indicating that lncRNA RP1-90J20.8 plays an important role in the development of rheumatoid arthritis and can be used as a molecular target for diagnosis, disease evaluation and treatment. In addition, cell functional experiments show that the expression of lncRNA RP1-90J20.8 knocked down in RA-FLS inhibits the proliferation, migration and invasion capabilities of RA-FLS and promotes RA-FLS apoptosis.

The comprehensive experiment results show that: the lncRNA RP1-90J20.8 is highly expressed in RA-FLS and promotes the activation of RA-FLS, so that RA joints are damaged, and the application prospect of serving as a molecular marker for RA diagnosis and treatment is realized. Therefore, the invention provides a new medicine target, namely LncRNA RP1-90J20.8, for assisting in diagnosing RA and evaluating and judging the erosive destruction condition of joints and treating RA.

The lncRNA RP1-90J20.8 is positioned on a human chromosome chr6 (p 25.2), the gene length is 408bp, and the nucleotide sequence is shown as SEQ ID NO: 1:

tcctttgtgagatgccactatcgggggaaaccggatggcttcacagaaaaagttcgtttaaaggaaaatggtttaaggccaaggaaatacctagaaaacggaaagtcttgaaaccagagccggaaaaagaatgcctgtgtttcgaagttccttcttaggacgaaaccagctgaagctggcgaaatccaagatggcgcctctgaagagcctctggctttatcatcatcctgttctcatgctaaacaacatgtcgccatgacaacgactggaagagaccaagaagggacagaaaaaaaggggtttcttgattccgggaaaaatctccgttctttcccaaggaaagcacgaatattcccccccgtgctcttaatgcccagccccttcattaaagacaccctacctctgaaa

accordingly, the invention claims:

1. the lncRNA (lncRNA RP 1-90J20.8) is applied to the aspect of serving as an RA diagnosis target point and the aspect of serving as a rheumatoid arthritis treatment target point.

2. The marker for identifying the lncRNA (lncRNA RP 1-90J20.8) is applied to the preparation of RA diagnosis products, products for evaluating/judging joint erosion damage conditions or treatment products.

Such markers include, but are not limited to:

(1) A primer/primer group combined with lncRNA RP1-90J20.8 or a probe combined with lncRNA RP1-90J20.8 and marked by fluorescence;

(2) A small molecule compound which is combined with lncRNA RP 1-90J20.8;

(3) A biomacromolecule that binds lncRNA RP1-90j20.8, including but not limited to: an antibody or functional fragment of an antibody, a fluorescently labeled antibody or functional fragment of an antibody, an RNA-binding protein or functional fragment thereof, a fluorescently labeled RNA-binding protein or functional fragment thereof.

As an alternative preferred embodiment, the markers are primer sets RP1-90J20.8 (F) and RP1-90J20.8 (R) which bind to the lncRNA, and the nucleotide sequences SEQ ID No.2 and 3 show:

RP1-90J20.8(F)：SEQ ID NO.2：TCCCTCTCAGACATTTATTGGTTCA

RP1-90J20.8(R)：SEQ ID NO.3：CAGTGCACCTTAGGATGGGG

the products comprise reagents, kits and the like.

3. The application of the inhibitor for inhibiting the lncRNA (lncRNA RP 1-90J20.8) in the preparation of RA treatment medicines.

Such inhibitors include, but are not limited to:

(1) siRNA, shRNA or small interfering RNA with similar functions for inhibiting lncRNA RP 1-90J20.8;

(2) A small molecule compound for inhibiting lncRNA RP 1-90J20.8:

(3) Biomacromolecules that inhibit lncRNA RP1-90J20.8, including but not limited to: an antibody or functional fragment of an antibody, an enzyme with high substrate specificity or a functional fragment thereof.

As an alternative preferred scheme, the inhibitor is siRNA for inhibiting lncRNA RP1-90J20.8, and the nucleotide sequence of the siRNA is as follows: GGCCAAGGAAAUACCUGATT and UCUAGGUAUUUCCUUGGCCTT.

In addition, drugs or pharmaceutical compositions for treating RA, which contain the lncRNA (lncRNA RP 1-90J20.8) inhibitor, are also within the scope of the present invention.

In addition, the application of lncRNA (lncRNA RP 1-90J20.8) in screening of RA therapeutic drugs is also within the protection scope of the invention.

The invention has the following beneficial effects:

the invention finds that lncRNA RP1-90J20.8 plays a key regulation and control role in RA-FLS expression abnormality and joint damage caused by lncRNA RP1-90J20.8 expression abnormality from the key clinical problem of RA joint damage as an entry point for the first research. RA is a chronic disabling disease and there is currently a lack of effective therapeutic agents to inhibit the progression of RA joint destruction. FLS are key effector cells for RA synovial inflammation and joint destruction. The lncRNA has an important regulation and control function in the biological function of the RA-FLS, and promotes the migration and invasion of the RA-FLS. While RA-FLS migration and invasion may directly or indirectly lead to articular cartilage/bone destruction. Research and development of drugs that inhibit activation of RA-FLS may become key to controlling RA inflammation and joint destruction. Therefore, the invention has great significance and application prospect.

The patent defines the biological function and clinical significance of lncRNA RP1-90J20.8 in RA, and provides a sufficient theoretical basis for lncRNA RP1-90J20.8 serving as a marker for RA auxiliary diagnosis and RA prognosis prediction and a new treatment target.

Drawings

FIG. 1 shows the detection of differentially expressed lncRNA in RA-FLS (n = 5) and control groups; wherein, the A.Arraystar Human lncRNA chip detects lncRNA which is expressed differently in RA-FLS (n = 5) and control group Orth.A-FLS (n = 5) in high throughput (Fold change is more than or equal to 1.5, P < -0.05); b, screening the front 8 lncRNA with the difference multiple more than or equal to 3 times by the Arraystar Human lncRNA chip in high throughput; qpcr detection indicated lncRNA RP1-90j20.8 was significantly higher expressed in RA-FLS (n = 20) than orth.a-FLS (n = 11).

Fig. 2 shows the qPCR assay for RNA expression of lncRNA RP1-90j20.8 after siRNA transfection of RA-FLS, n =6 and P <0.001.

Fig. 3 shows CCK-8 tests the effect of downregulation of lncRNA RP1-90j20.8 on RA-FLS cell activity at different time points, n =6, P <0.05, P <0.01.

Fig. 4 is a flow cytometry assay to detect the effect of down-regulating lncRNA RP1-90j20.8 on RA-FLS apoptosis, n =6, P <0.01.

Figure 5 shows EdU fluorescence staining assay for the effect of down-regulating lncRNA RP1-90j20.8 on RA-FLS cell proliferation, n =6, P <0.05.

Fig. 6 is a Transwell migration experiment to examine the effect of down-regulating lncRNA RP1-90j20.8 on the migration of RA-FLS cells, n =6, P <0.001.

Fig. 7 is a Transwell invasion assay to examine the effect of down-regulating lncRNA RP1-90j20.8 on RA-FLS cell invasion, n =6, P <0.01.

Detailed Description

The invention is further described with reference to the drawings and specific examples, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Example 1

1. Experimental procedures and methods

According to the invention, high-expression lncRNA in RA-FLS is screened out through an expression profile chip in a high-throughput manner, and lncRNA RP1-90J20.8 related to RA joint destruction is found for the first time through clinical analysis.

Specifically, the Arraystar Human lncRNA chip is used for detecting lncRNA which is differentially expressed in synovial FLS (n = 5) of RA patients (n = 5) and normal control group patients (n = 5) in a high-throughput manner, and the result shows that the expression of lncRNA RP1-90J20.8 in the RA-FLS is 11.84 times higher than that of the synovial FLS of the normal control group patients, which indicates that the lncRNA RP1-90J20.8 plays an important role in the occurrence and development process of RA and can be a molecular target for diagnosis, disease evaluation and treatment.

We further expand the sample size, and the expression difference of lncRNA RP1-90J20.8 in 20 cases of RA-FLS and 11 cases of Orth.A-FLS is detected by qPCR, which proves that lncRNA RP1-90J20.8 is remarkably highly expressed in RA-FLS, and suggests that the highly expressed lncRNA RP1-90J20.8 plays an important role in the occurrence and development process of RA diseases.

Then, we select RA-FLS of primary culture as an experimental research object, design an interference sequence of lncRNA RP1-90J20.8, and transfer the interference sequence into cells by taking lip3000 as a transfection vector. By detecting the functions of the cell, such as proliferation, apoptosis, migration, invasion and the like, after the interference sequence is transferred into the cell. Therefore, after the expression of lncRNA RP1-90J20.8 is down-regulated in RA-FLS, the proliferation, migration and invasion capabilities of RA-FLS are obviously weakened and the apoptosis is increased, so that RA joints are damaged. Also suggests that lncRNA RP1-90J20.8 plays an important regulation role in RA joint destruction through the abnormal activation of RA-FLS.

Tissue collection

RA synovial membrane specimens were obtained from patients in the rheumatological department of immunology at the university of Zhongshan, sun-Yi Xian Hospital, sun-Yi Xian, from 1 month of 2016 to 12 months of 2019, by performing Parker-Pearson fine needle biopsy on the knee joint. Criteria for enrollment of RA patients: (1) the age is more than or equal to 18 years old; (2) the diagnosis of all RA patients met the RA classification criteria revised by the American rheumatology Association (ACR) in 1987 or the early RA classification criteria established by the European Rheumatism Association (EULAR League age Rheumatism, EULAR) by ACR in 2010; (3) disease activity score DAS28-CRP is greater than or equal to 3.2. Exclusion criteria: (1) the age is more than or equal to 65 years old; (2) eliminating diabetes, obesity, viral infection, and malignant tumor; severe respiratory diseases, psychiatric diseases and pregnancy or lactation; (3) in combination with other autoimmune diseases (e.g., systemic lupus erythematosus, scleroderma, inflammatory myopathy, polyarteritis nodosa, cryoglobulinemia, glomerulonephritis, etc.). All patients signed informed consent prior to enrollment and the study protocol had been approved by the ethical committee of the grand impatience commemorative hospital, grand society, grand university.

Cell culture

(1) Transferring fresh synovial membrane obtained by puncture biopsy into a sterile 1.5ml EP tube, shearing the tissue with a sterile ophthalmic scissors, and adding 1mg/ml collagenase type I;

(2) Placing the EP tube containing the synovial tissue in a constant temperature shaking table at 37 ℃ and digesting for 1h at 100 rpm;

(3) Taking out the EP tube, and centrifuging at 1000rpm for 5min;

(4) Discarding the supernatant, adding an appropriate amount of DMEM medium containing 10% FBS to the pellet for resuspension, transferring to a cell culture flask, spreading the tissue mass uniformly, and culturing in a 5% CO2 incubator at 37 ℃;

(5) Observing that spindle-shaped fibroblast-like synovial cells climb out and are more in number around the tissue block, digesting the cells by using pancreatin, centrifuging and transferring the cells to a new culture bottle to purify the cells;

(6) Culturing and subculturing reasonably, and taking 3-6 generations of RA-FLS for experiment.

CCK-8 experiment

(1) Digesting and collecting cells, counting the cells, and inoculating the cells into a 96-well plate at 5000 cells/well;

(2) After the cells adhere to the wall, absorbing the culture medium, washing for 2 times by using PBS buffer solution, arranging 3 multiple holes in each group, and placing in an incubator for incubation for 24 hours;

(3) After the incubation was completed, 10. Mu.l of CCK-8 reagent was added to each well, and after further incubation in the incubator for 2 hours, absorbance (OD) was measured at a wavelength of 450nm using a microplate reader. The inhibition rate of RA-FLS activity was calculated.

Edu proliferation assay

(1) Digesting and collecting cells, counting the cells, and inoculating into 24-well plates at 20000 cells/well;

(2) After the cells adhere to the wall, the culture medium is sucked off, the cells are washed for 2 times by PBS buffer solution, a complete culture medium containing 0.05 percent DMSO is added into a control group, and the cells are incubated for 24 hours;

(3) The medium was aspirated, edu solution (1;

(4) The culture medium is sucked off, washed for 2 times by PBS buffer solution and fixed for 15min by 4 percent paraformaldehyde at room temperature;

(5) Removing paraformaldehyde fixing solution, washing with PBS buffer solution for 2 times, adding 0.3% Triton X-100 membrane permeation solution into each well, and incubating at room temperature for 15min;

(6) Removing the membrane permeation liquid, washing with PBS buffer solution for 2 times, adding 100 μ l Apollo staining reaction solution into each hole, and incubating for 30min at room temperature in a dark place;

(7) Removing the staining reaction solution, washing with PBS buffer solution for 2 times, adding DAPI diluent (1;

(8) The fluorescence pictures were observed and taken under an inverted fluorescence microscope. The cell nucleus in the proliferation stage emits green fluorescence under 488nm excitation light.

Cell cycle analysis and apoptosis assay

(1) By 1 × 10 ⁵ The cells of (4) were seeded into 6-well culture plates per well. After adherence, incubating for 24h;

(2) Digesting the cells by using pancreatin, collecting, centrifuging at 1000rpm multiplied by 5min, discarding the supernatant, resuspending by using a PBS buffer solution, centrifuging again at 1000rpm multiplied by 5min, discarding the supernatant;

(3) For cell cycle analysis, the cell pellet was resuspended in 200. Mu.l of PBS buffer, 2ml of 70% ethanol pre-cooled at 4 ℃ was added, and fixed overnight at 4 ℃. After overnight, cells were washed again with PBS and resuspended in 200. Mu.l PI/RNase staining buffer, incubated at room temperature for 30min, and then detected and analyzed on a BD FACS Calibre flow cytometer.

(4) When detecting apoptosis, 200 mul of binding buffer solution is used for resuspending cells, then 5 mul of Annexin V-FITC reagent is added for incubation for 15min in a dark place at room temperature, 10 mul of PI staining agent is added after incubation, and the cells are immediately detected and analyzed on a machine.

Cell scratch test

(1) Taking a sterile 6-well plate, before cell plating, drawing three parallel lines with equal spacing in the transverse direction at the bottom of the plate according to the center of each well by using a marker pen for positioning according to the 1.5 multiplied by 10 ⁵ Seeding each well with cells;

(2) Observing cell adherence and when the fusion degree reaches about 80%, replacing complete culture medium according to groups, and incubating for 24h;

(3) Scratching is carried out by using a sterilized 200 mul of gun head vertical to the positioning line;

(4) Absorbing the culture medium, washing for 3 times by using PBS buffer solution to remove dead cells and cell fragments formed by scratches and possible drug residues, and adding a serum-free DMEM culture medium to avoid the influence of cell proliferation; (ii) a

(5) The scratches are photographed at two time points of 0h and 12h after the scratches respectively, and images are obtained at the same position of each time point according to the positioning lines.

(6) The lateral migration distance of the cells after scratching was analyzed with ImageJ software.

Transwell migration experiment

(1) After 24h of pretreatment of RA-FLS, cells were trypsinized, collected and centrifuged, and the cell pellet was resuspended in an appropriate amount of serum-free DMEM medium, adjusting the cell density of each group to 1X 10 ⁵ /ml；

(2) Adding 200 μ l of the above cell suspension into the upper chamber of Transwell, adding 700 μ l of DMEM medium containing 10% FBS into the lower chamber, and gently transferring the culture plate to an incubator for culture;

(3) After 12h of incubation, the Transwell chamber was removed, the medium in the upper layer was aspirated, and then placed in a well with 700. Mu.l of 4% paraformaldehyde added, and fixed for 30min;

(4) Transferring the small chamber to a staining solution added with 0.1% crystal violet for staining for 30min;

(5) After staining, the chamber was rinsed in clear water to remove excess stain, and the non-migrated cells on the upper layer of the chamber were gently wiped off with a cotton swab, and after drying, 5 fields were randomly selected under an upright microscope (x 100) for photographing and counting.

Transwell invasion test

(1) Pre-paving matrix glue: diluting Matrigel gel with serum-free medium according to the concentration of 1;

(2) The cells for the invasion assay were plated, fixed, stained and counted as for the Transwell migration assay, see the Transwell migration assay procedure for details.

siRNA transfection

(1) RA-FLS is inoculated on a cell culture plate and cultured in an adherence way in a 5% CO2 incubator at 37 ℃;

(2) Preparing siRNA of lncRNA RP1-90J20.8 and negative control siRNA into a 20 mu M solution by using sterile DEPC water according to the instruction;

(3) Preparing a transfection system, taking the dosage of each hole as an example, respectively sucking 125 mu l of serum-reduced culture medium Opti-mem culture medium into 2 sterile 1.5ml EP tubes by using a pipette, sucking 5 mu l of siRNA solution, adding the siRNA solution into one of the EP tubes, uniformly blowing, sucking 5 mu l of transfection reagent Lipofectamin 3000, adding the transfection reagent Lipofectamin 3000 into the other EP tube, uniformly blowing, mixing the solutions in the two EP tubes, and standing for 10min to ensure that the siRNA and the liposome are fully combined;

(4) Taking out the cell culture plate, removing the culture medium by suction, washing with PBS for 1 time, adding 1750 μ l of fresh DMEM medium containing 10% FBS into each well, then adding the siRNA solution prepared in the step (3) in groups, adding 250 μ l of Opti-mem medium into a blank control, putting into a cell culture box for culture, observing that the cell state is good after the transfection is started, and optionally replacing the medium;

(5) And extracting cell RNA for detection and carrying out knockdown efficiency verification between 24h and 48h after transfection.

Real-time fluorescence quantitative PCR detection of RNA expression of each index

Extraction of Total RNA from cells

(1) Inoculating RA-FLS into 6-well plate, culturing adherent culture until the fusion degree reaches more than 80%, and giving control or treating with drugs according to groups;

(2) After 24h of treatment, the cell culture supernatant was aspirated away, the cells were gently washed 3 times with pre-cooled PBS, then 1ml of Trizol lysate was added to each well in a fume hood, gently shaken to cover the culture wells with lysate, and left to stand at room temperature for 15min;

(3) Blowing and beating the cells by using a 1ml enzyme-free gun head to fully crack the cells, and then transferring the liquid into an enzyme-free 1.5ml EP tube;

(4) Adding 200 μ l chloroform into each tube, shaking for 15s, mixing, standing on ice for 10min, precooling, centrifuging at 4 deg.C at 12000rpm × 15min;

(5) Carefully taking out the EP tube to avoid oscillation, wherein the liquid level in the EP tube is divided into 3 layers, the colorless and transparent upper layer is an RNA layer, the white middle layer is an protein layer, the pink bottom layer is an organic layer, and the upper layer liquid is carefully transferred into a new enzyme-free 1.5ml EP tube by using an enzyme-free 200 mul gun head;

(6) Adding isopropanol with the same volume according to the volume of the RNA solution, violently shaking for 15s, fully and uniformly mixing, standing on ice for 10min, transferring to a 4 ℃ precooled centrifuge, and centrifuging at 12000rpm multiplied by 15min;

(7) Discarding the supernatant, adding 1ml of 75% ethanol solution prepared from anhydrous ethanol and enzyme-free water, washing the precipitate, centrifuging at 12000rpm × 5min at 4 deg.C, and repeating the step twice;

(8) Discarding supernatant, pouring the EP tube on clean filter paper, ventilating and standing for 20min, observing complete volatilization of liquid in the tube, adding 20 μ l of non-enzyme water to dissolve precipitate, and measuring concentration and purity.

Determination of RNA concentration and purity

(1) Starting a NanoDrop 2000 ultramicro spectrophotometer, zeroing the instrument by using enzyme-free water, sucking 1 microliter of RNA sample by using a micropipettor every time for detection to obtain absorbance values at the wavelength of 260nm and 280nm respectively, and repeatedly measuring for 3 times to obtain an average value;

(2) The formula for the RNA concentration is: RNA concentration (ng/μ l) = OD (260 nM) × dilution factor × 40;

(3) The formula for calculating the purity of RNA is: RNA purity = OD (260 nm)/OD (280 nm);

(4) OD (260 nM) represents the absorbance of nucleic acids, OD (280 nM) represents the absorbance of proteins, and the ratio of OD (260 nM)/OD (280 nM) is between 1.8 and 2.0, which is considered to be a good purity of RNA concentration, and when the ratio is less than 1.8, it is likely to be protein or phenolic contamination, and when the ratio is more than 2.0, it is suggested that there may be isothiocyanate residues.

Synthesis of cDNA

(1) A10. Mu.l reverse transcription system was used: calculate 500ng volume of RNA solution (X. Mu.l) as template, 5 XPrimeScript RT Master Mix (2. Mu.l), enzyme-free water (10. Mu.l-2. Mu.l-X. Mu.l) according to the concentrations reported above, add 3 reagents to enzyme-free 200. Mu.l EP tubes and Mix;

(2) Placing the sample into a PCR thermal cycler, and setting reverse transcription conditions: (1) 37 ℃ 15min → (2), 85 ℃ 5s → (3), 4 ℃. Infin, and the cDNA synthesized after completion of reverse transcription was used for PCR or stored in a-80 ℃ refrigerator.

Preparation of primers

The primer dry powder is prepared into a solution of 100 mu M according to the instruction of a synthesis company, and the equal amount of the sense strand primer solution and the antisense strand primer solution are absorbed, mixed well and diluted by 10 times to be used as a working solution of the real-time fluorescent quantitative PCR.

Preparation and amplification of real-time fluorescent quantitative PCR reaction system

(1) The real-time fluorescent quantitative PCR uses 10 mul reaction system, the system is prepared as shown in table 1-2, wherein cDNA is working solution diluted by 10 times;

TABLE 1 preparation of PCR reaction System

Reagent	Amount of the composition used
		2×TB Green Premix Ex Taq	5μl
Primer and method for producing the same	0.8μl
		RNase Free dH ₂ O	3.2μl
cDNA	1μl

(2) Setting 3 multiple holes for each gene of each sample, adding samples in sequence, covering a transparent film after sample addition is finished, and throwing liquid in the holes to the bottoms of the holes by using a microporous plate centrifuge;

(3) The reaction PCR plate was placed in a LightCycler 480Real time PCR apparatus for PCR reaction under the following conditions (Table 1-3):

TABLE 2 conditions of PCR reaction

PCR reaction data processing

(1) Confirmation of reasonable melting and amplification curves for the reaction, and use of reaction data 2 ^-ΔΔCq Analysis by the method, the relative expression level difference of the genes was compared, and Δ Δ Cq = (Cq) _{Target gene} -Cq _{Reference gene} ) _{Experimental group} -(Cq _{Target gene} -Cq _{Internal reference gene} ) _{Control group} . The Cq value is the number of reaction cycles required for the fluorescence signal intensity in the PCR reaction well to reach a set threshold.

2. Results of the experiment

1. Successfully screens and confirms that lncRNA RP1-90J20.8 is highly expressed in RA-FLS

We used the Arraystar Human incrna chip to high-throughput detect incrna differentially expressed in synovial FLS (n = 5) of RA patients (n = 5) and control orth.a patients, and found that 349 incrnas in RA-FLS were increased and 194 incrnas were decreased (fig. 1a, b). We further expanded the sample size and examined the expression of lncRNA RP1-90J20.8 (11.84 fold) with the highest fold difference in expression among 20 cases of RA-FLS and 11 cases of Orth.A-FLS by qPCR, confirming that lncRNA RP1-90J20.8 is significantly highly expressed in RA-FLS (FIG. 1C).

2. Verification of siRNA knockdown RA-FLS LncRNA RP1-90J20.8

In order to adopt siRNA to down-regulate the expression of lncRNA RP1-90J20.8 in RA-FLS, the expression change of the RNA of lncRNA RP1-90J20.8 in RA-FLS after siRNA transfection needs to be detected firstly. The qPCR results showed that siRNA against lncRNA RP1-90j20.8 could significantly inhibit RNA expression of lncRNA RP1-90j20.8, decreased by 71.78% respectively compared to the negative control group (fig. 2, n =6, p < -0.05), the above results suggested that the knockdown efficiency of siRNA-1 sequence was better, and therefore, siRNA-1 was selected for transfection of RA-FLS for knock-down of lncRNA RP1-90j20.8 in subsequent experiments.

3. CCK-8 method for detecting influence of lncRNA RP1-90J20.8 on RA-FLS cell activity

The CCK-8 method detects the cell activities of RA-FLS for 24h, 48h and 72h after lncRNA RP1-90J20.8 is down-regulated, and the results show that the cell activities of lncRNA RP1-90J20.8 at different time points within 72h are remarkably reduced compared with those of an empty vector group (figure 3, the P is more than 0.05, and figure 3).

4. Effect of lncRNA RP1-90J20.8 on apoptosis of RA-FLS cells

Flow cytometry results showed that the proportion of apoptotic cells was significantly increased after lncRNA RP1-90j20.8 was downregulated for 24h compared to the empty vector group (downregulated lncRNA RP1-90j20.8 group was 12.02% ± 3.18% compared to 3.26% ± 1.24% compared to the empty vector group, n =6, p <0.05, fig. 4).

5. Effect of lncRNA RP1-90J20.8 on proliferation in RA-FLS

The influence of down-regulating lncRNA RP1-90J20.8 on the proliferation of RA-FLS cells is further determined by an Edu proliferation experiment. The results show that the cell proliferation ratio is significantly reduced after 24h treatment with lncRNA RP1-90j20.8 down-regulated compared to the empty vector group (with lncRNA RP1-90j20.8 versus empty vector group, the relative proliferation ratio was 11.82% ± 3.07% versus 22.02% ± 2.84, n =6, p < -0.05, fig. 5).

6. Effect of lncRNA RP1-90J20.8 on RA-FLS migration

After lncRNA RP1-90J20.8 is down-regulated and treated for 24 hours, RA-FLS migration capacity is detected by a Transwell migration experiment, and the experiment result shows that: after 12h, the number of cells penetrating into the lower layer was significantly reduced in the lncRNA RP1-90j20.8 group compared to the empty vector group (0.48 ± 0.20 to 0.95 ± 0.04, n =6, p-bundle 0.05, fig. 6).

7. Influence of lncRNA RP1-90J20.8 on RA-FLS invasion

After lncRNA RP1-90J20.8 is reduced and treated for 24 hours, the RA-FLS invasion capacity is detected by a Transwell invasion experiment, and the experiment result shows that: after 24h, the number of cells penetrating into the lower layer was significantly reduced in the lncRNA RP1-90j20.8 group compared to the empty vector group (0.51 ± 0.34 to 1.12 ± 0.15, n =6, p-bundle 0.05, fig. 7).

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Claims

1. The application of the reagent for quantitatively detecting the expression level of lncRNA RP1-90J20.8 in preparing rheumatoid arthritis diagnosis products is disclosed, wherein the sequence of lncRNA RP1-90J20.8 is shown as SEQ ID NO. 1;

the reagent for quantitatively detecting the expression level of lncRNA RP1-90J20.8 comprises: a primer pair combined with lncRNA RP1-90J20.8 and a probe combined with lncRNA RP1-90J20.8 and marked by fluorescence.

The application of the lncRNA RP1-90J20.8 inhibitor in preparing rheumatoid arthritis treatment products is disclosed, wherein the lncRNA RP1-90J20.8 has a sequence shown in SEQ ID NO.1, and the inhibitor is siRNA or shRNA for inhibiting the expression level of lncRNA RP1-90J20.8.

3. The application of an inhibitor for inhibiting lncRNA RP1-90J20.8 in preparing a medicament for treating rheumatoid arthritis is disclosed, wherein the sequence of lncRNA RP1-90J20.8 is shown as SEQ ID NO. 1; the inhibitor is siRNA for inhibiting the expression level of lncRNA RP1-90J20.8, and the nucleotide sequence of the inhibitor is GGCCAAGGAAAUACCUGATT and UCUAGGUAUUCCUUGGCCTT.