CN113265488A - RPA-LFD primer, probe and kit for jointly detecting epidemic hemorrhagic disease virus and paliim serogroup virus - Google Patents

Abstract

The invention relates to an RPA-LFD primer, a probe and a kit for jointly detecting epidemic hemorrhagic disease virus and paliymella serogroup virus, belonging to the technical field of molecular biological detection of animal viruses. The invention designs a primer and an nfo probe for jointly detecting EHDV and PALV, and constructs an RPA-LFD detection kit capable of jointly detecting EHDV and PALV nucleic acids popular in China on the basis, and the kit has the advantages of specificity, sensitivity, rapidness, high efficiency, isothermal amplification, on-site rapid diagnosis and the like, and is easy to popularize and apply.

Description

RPA-LFD primer, probe and kit for jointly detecting epidemic hemorrhagic disease virus and paliim serogroup virus

Technical Field

The invention belongs to the technical field of animal virus molecular biology detection, and particularly relates to a recombinase polymerase-lateral flow chromatography test paper detection primer, a probe and a detection kit for jointly detecting epidemic hemorrhagic disease virus and paliymella serogroup virus.

Background

Epidemic Hemorrhagic Disease Virus (EHDV) and palidia serogroup virus (PALV) are members of the Reoviridae (Reoviridae) circovirus (Orbivirus), and are prevalent in tropical and subtropical regions between 49 ° north and 35 ° south latitude. EHDV and PALV are transmitted mainly by female Culicoides spp. EHDV can cause death of infected white-tailed deer, and it was previously thought that only Ibaraki strains belonging to EHDV-type 2 may cause clinical symptoms similar to bluetongue in infected cattle, but in recent years EHDV-1, -6 and-7 types of viruses have prevailed in turkey, israel and japan and caused a large reduction in milk production. EHDV has been legally reported as a cross-border animal epidemic in 2008 by the world animal health Organization (OIE). Infection with PALV mainly results in abnormal production in pregnant animals, mainly manifested as abortion, premature birth, stillbirth or the production of nakedful fetus. In 1985 to 1986, PALV-related epidemics have been outbreaks in japan, with the clinical symptoms of congenital abnormalities in newborn cattle, accompanied by malformation of the hydrologic brain and cerebellar dysplasia syndrome. Both EHDV and PALV bring enormous economic losses to animal husbandry.

The EHDV and PALV genomes are composed of 10 segments of double-stranded RNA (Seg 1-Seg 10), and encode 7 structural proteins (VP 1-VP 7) and 4 non-structural proteins (NS 1-NS 3 and NS3 a). EHDV and PALV have a double-layer capsid structure, the outer capsid is composed of VP2 and VP5 encoded by Seg-2 and Seg-6, the inner capsid is composed of VP3 and VP7 encoded by Seg-3 and Seg-7, and VP1, VP4 and VP6 encoded by Seg-1, Seg-4 and Seg-9 and the viral genome together constitute the viral core. There are 9 EHDV serotypes worldwide, EHDV-1, -2, -4, -5, -6, -7, -8, -9, and-10 types, respectively. China currently has a prevalence of 5 serotypes of EHDV (EHDV-1, -5, -6, -7, and-10 types). PALV also has a number of different serotypes, which for historical reasons are often named by the name of the place where the virus was first isolated, and there is a prevalence of three serotypes, the chlzan virus (CHUV), D' agarular virus (DAV) and Bunyip Creek Virus (BCV) in asia.

EHDV-5 type strains are separated and obtained in blood samples of sentinels arranged in Guangxi Zhuang autonomous region for the first time in 2013, and EHDV-1, -6, -7 and-10 type strains are separated in provinces such as Guangdong province and Yunnan province. EHDV serological survey shows that EHDV is widely popularized in southern areas of China and has obvious regional and seasonal relevance, wherein the positive rate of EHDV antibodies in bovine blood samples in Guangdong province and Yunnan province is as high as 65.08% and 68.75% respectively. CHUV is separated from sentinel cattle in Yunnan province of China for the first time in 2012, and besides, a plurality of BCVs and DAVs are separated and obtained in Yunnan province, Guangxi Zhuang autonomous region and Guangdong province in 2012 to 2018, which indicates that the PALV of various serotypes is popular in southern region of China. The CHUV serological survey shows that the CHUV is widely distributed in China, the highest positive rate of the antibodies in the cattle and sheep serum in Hainan province can reach 57.35%, and even the positive rate of the antibodies in the yak serum in Gansu province can reach 7.89%. In order to master the popularity and distribution of EHDV and PALV in China and formulate a scientific prevention and control strategy, it is very necessary to establish a field rapid diagnosis method for EHDV and PALV.

Real-time fluorescent quantitative polymerase chain reaction (qRT-PCR) and competitive ELISA (C-ELISA) methods for detecting EHDV and PALV have been developed respectively for Yangxing et al and Lizhanhong et al, but both methods have disadvantages.

(1) Disadvantages of qRT-PCR: on the one hand, this detection technique requires the configuration of expensive instrumentation (about 30 ten thousand dollars) and, on the other hand, the experimental operation by trained technicians. In addition, the qRT-PCR detection process needs to go through the variable temperature cycle processes of denaturation (95 ℃) and extension (72 ℃), and the field and on-site detection is difficult to provide stable power supply.

(2) The C-ELISA has the following defects: the method mainly detects the antibody in the blood of the animal, but the period from the animal infection of EHDV or PALV to the generation of the antibody generally takes 2-3 weeks, so the C-ELISA method cannot carry out early clinical diagnosis before the generation of the antibody.

In conclusion, no detection method integrating the advantages of specificity, sensitivity, high efficiency, convenience and the like exists at present, and particularly, a means for performing early and rapid diagnosis on clinical samples on site is lacked. Therefore, the established EHDV and PALV etiology detection method and detection kit suitable for on-site rapid diagnosis can not only make up for the defects of the prior art, but also provide technical support and knowledge reserve for diagnosis, prevention and control of EHDV and PALV in China.

In the past decades, a variety of isothermal amplification techniques have been developed, such as loop-mediated isothermal amplification (LAMP) and Recombinase Polymerase Amplification (RPA), which are currently widely used. Taking RPA as an example, the main components of the amplification technology are three proteins, one is a recombinase for unwinding double strands of DNA, one is a single-stranded DNA binding protein for stably unwinding DNA, and the third is a polymerase for synthesizing DNA. RPA only needs a pair of primers and/or a probe to be incubated at a constant temperature of 39 ℃ for 20min to complete the amplification reaction. In addition, after the amplification reaction is finished, the product can be detected by agarose gel electrophoresis, and the detection result can be directly judged by naked eyes by combining Lateral Flow Dipstick (LFD), so that the rapid diagnosis on site is greatly facilitated.

LAMP visual detection methods aiming at EHDV and PALV have been developed by Lizhanhong and the like, but the method has certain defects. Although LAMP and RPA are isothermal amplification techniques, and the detection result can be determined by naked eyes, the technique needs at least two pairs of primers to complete one amplification reaction. Since primer dimers are easily formed between pairs of primers to cause non-specific amplification, LAMP is difficult to be used for detection of two or more pathogens, and the detection efficiency is seriously reduced.

RPA has been applied to the detection of various pathogens including viruses and bacteria, has the advantages of strong characteristics, high sensitivity, high detection speed, isothermal amplification and the like, and more importantly, the technology can be used for the detection of clinical samples, but no RPA-LFD method for jointly detecting EHDV and PALV is available at present.

Disclosure of Invention

The invention aims to solve the defects of the prior art, and provides two pairs of primers and two specific nfo probes for jointly detecting EHDV and PALV nucleic acids and a detection kit containing the primers and the nfo probes so as to realize the on-site rapid diagnosis of EHDV and PALV prevalent in China, thereby making up the defects of the prior art.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

RPA-LFD primers for jointly detecting epidemic hemorrhagic disease virus and Palyema serogroup virus comprise an RPA-LFD detection primer of EHDV and an RPA-LFD detection primer of PALV;

the RPA-LFD detection primer of the EHDV comprises an upstream primer EHDV _ F and a downstream primer EHDV _ R;

an upstream primer EHDV _ F: tggattgcctgttttacatgattcaacttggga, respectively; (SEQ ID NO.1)

Downstream primer EHDV _ R: bio-taacgcttgacgaacgatgacataactttcacccctaaac; (SEQ ID NO.2)

The RPA-LFD detection primer of the PALV comprises an upstream primer PALV _ F and a downstream primer PALV _ R;

the upstream primer PALV _ F: tactaaaatttcaagagggttttctcataaattgg, respectively; (SEQ ID NO.3)

The downstream primer PALV _ R: bio-ggtcataactatattaagcgattcataataagcccc. (SEQ ID NO.4)

The invention also provides an nfo probe matched with the primer for use, wherein the nucleotide sequences of the nfo probe are respectively as follows: EHDV _ Probe: DIG-tttattgaacaaagagcgaagaacgaaatg [ THF ] aaatatatggagaca [ C3-spacer ] (SEQ ID NO: 5) and PALV _ Probe: FITC-tgaggatggttttactatgtatttaattcg [ THF ] gatccattgtgtgct [ C3-spacer ]. (SEQ ID NO.6)

The invention also provides a detection kit containing the primer and/or the nfo probe.

Further, it is preferable that the method further comprises: a negative control template, a positive control template, a reverse transcription reagent, an amplification reagent and a PCRD Nucleic Acid Detector;

the negative control template is RNase-free water;

the positive control template is a DNA fragment of EHDV and PALV gene segment 1 (Seg-1);

further, preferably, the copy number of the positive control template is: EHDV Seg-1DNA fragment 7.1X 10¹³Copy/. mu.L, 6.8X 10 of the PALV Seg-1DNA fragment¹³Copies/. mu.L.

Further, it is preferable that the reverse transcription reagent comprises 5 XPrimeScript RT Master Mix (Perfect read Time) and RNase-free water.

Further, preferably, the reverse transcription system of the kit is as follows:

5×PrimeScript RT Master Mix，2.0μL；

extracted total RNA, 5.0 μ L;

RNase-free water, 3.0. mu.L;

total 10.0. mu.L.

Further, preferably, the reverse transcription procedure of the kit is as follows:

reverse transcription at 37 deg.C for 15min for 1 cycle; inactivation of reverse transcriptase was 85 ℃ for 5s for 1 cycle.

Further, preferably, the amplification system of the kit is:

nfo Kit RPA amplification reagent freeze-dried powder, 1 tube;

Primer free rehydration buffer，29.5μL；

upstream primer EHDV _ F (10. mu. mol/L), 2.1. mu.L;

downstream primer EHDV _ R (10. mu. mol/L), 2.1. mu.L;

the upstream primer PALV _ F (10. mu. mol/L), 2.1. mu.L;

the downstream primer PALV _ R (10. mu. mol/L), 2.1. mu.L;

nfo Probe EHDV _ Probe (10. mu. mol/L), 0.6. mu.L;

nfo Probe PALV _ Probe (10. mu. mol/L), 0.6. mu.L;

1.0 μ L of cDNA template for reverse transcription;

RNase-free water, 7.4. mu.L;

Magnesium acetate(280mmol/L)，2.5μL；

a total of 50.0. mu.L.

Further, preferably, the kit comprises an amplification program:

39℃，20min。

further, preferably, the detection system of the kit is:

RPA amplification product, 6. mu.L;

PCRD extraction buffer，84μL；

90.0 mu L in total;

add 75. mu.L of the above mixture to the PCRD wells.

Further, preferably, the detection procedure of the kit is as follows:

room temperature, 10 min.

The invention provides a method for rapidly detecting EHDV and PALV on site by labeling the 5' end of a downstream primer with a biotin group (Bio). The 5 'end of the EHDV nfo probe is labeled by a digoxigenin group (DIG), and the 5' end of the PALV nfo probe is labeled by a fluorescein isothiocyanate group (FITC); blocking groups (C3-spacer) are added at the 3' ends of the nfo probes; all of the nfo probes were Tetrahydrofuran (THF) at position 31.

The invention provides a primer, an nfo probe and a detection kit for jointly detecting EHDV and PALV, which can achieve the aim of accurately detecting EHDV and PALV nucleic acids in a sample to be detected by extracting total RNA of the sample to be detected for reverse transcription and combining with an RPA-LFD technology. The primer, the nfo probe and the detection kit provided by the invention can be used for on-site rapid diagnosis of EHDV and PALV, and can play an important role in the prevention and control work of EHDV and PALV in China.

The kit of the invention provides RNase-free water as a negative control template, an EHDV Seg-1DNA fragment and a PALV Seg-1DNA fragment as positive control templates. When the RPA amplification system is reacted by using a negative control template, the template is RNase-free water; when the RPA amplification system reacts with a positive control template, the template is an EHDV Seg-1DNA fragment and/or a PALV Seg-1DNA fragment; when the RPA amplification system is reacted by using a sample template to be detected, the template is cDNA reverse transcribed by total RNA extracted from EHDV and PALV culture solution, animal tissues suspected of being infected by EHDV and/or PALV or blood. The primer and the nfo probe provided by the invention are used for respectively carrying out RPA amplification on a negative control template, a positive control template and a sample template to be detected, and then, a PCRD Nucleic Acid Detector is used for detecting an amplification product. If the black control line and the black detection line similar to the positive control template appear on the PCRD Nucleic Acid Detector control band (C) and the detection band (1 and/or 2) at the same time, the detection band is positive, namely the black control line (C) and the detection line No.1 (1) appear at the same time, the detection line is EHDV positive, the black control line (C) and the detection line No.2 (2) appear at the same time, the detection line is PALV positive, and the detection lines (C), No.1 and No.2 (1 and 2) appear at the same time, the detection lines are EHDV and PALV positive; the control strip (C) is negative when a black control line appears but no black detection line appears on the corresponding detection strip (1 and/or 2); the absence of a black control line on the control band (C) results in an invalid result and requires a new test.

The specific principle of the invention is that specific primers and nfo probes for RPA-LFD detection are designed aiming at EHDV and PALV Seg-1 sequences popular in China, and 5' ends of EHDV downstream primers and PALV downstream primers are marked by a Bio group; labeling 5' ends of the EHDV nfo probe and the PALV nfo probe with DIG and FITC groups respectively; to prevent mis-extension during amplification, blocking groups C3-spacer were added to the 3' end of both EHDV nfo probe and PALV nfo probe; both the EHDV nfo probe and the PALV nfo probe are THF at position 31. Taking cDNA or positive control as a template to carry out RPA amplification reaction,

the E.coli nuclease in the nfo Kit RPA amplification reagent lyophilized powder recognizes THF in the nfo probe, and cleaves the phosphodiester bond linked to THF to expose the free hydroxyl end.

Polymerase in the nfo Kit RPA amplification reagent freeze dry powder continues to synthesize DNA by taking the cut-off nfo probe as a primer, and a labeling group is continuously doped into an amplification product along with the amplification process. The specific membrane-carried antibody on the PCRD Nucleic Acid Detector is used for identifying an amplification product containing Bio and DIG groups and/or Bio and FITC groups, and a black control line and a black detection line appear on the control band (C) and the corresponding detection band (1 and/or 2).

And (3) amplifying and recovering a purified EHDV Seg-1DNA fragment and a PALV Seg-1DNA fragment as positive control templates by using the EHDV and the PALV genome cDNA as templates. The amplification primers were as follows:

EHDV Seg-1 F：5’-aaaatgcaatggtcgcaattaccgt-3’(SEQ ID NO.7)；

EHDV Seg-1 R：5’-tttttcacccacgcacgtcc-3’(SEQ ID NO.8)；

PALV Seg-1 F：5’-gtcatattgcttctgcttcaa-3’(SEQ ID NO.9)；

PALV Seg-1 R：5’-ccttacccgtgtgctcatcc-3’(SEQ ID NO.10)。

the lengths of the amplified products are 1174bp of EHDV Seg-1DNA fragment and 959bp of PALV Seg-1DNA fragment.

The amplification system was as follows:

Q5 High-Fidelity 2×Master Mix，12.5μL；

upstream primer (10. mu. mol/L), 1.25. mu.L;

downstream primer (10. mu. mol/L), 1.25. mu.L;

viral genome cDNA template, 1.0 μ L; (ii) a

Water, 9.0 μ L;

total 25.0. mu.L.

The amplification procedure was as follows:

pre-denaturation at 98 ℃ for 30s for 1 cycle; denaturation 98 ℃, 10s, annealing 55.5 ℃ (EHDV)/53.0 ℃ (PALV), 20s, extension 72 ℃, 30s, for 35 cycles; after extension at 72 ℃ for 2 min.

Finally, an RPA-LFD primer, an nfo probe and a detection kit suitable for jointly and rapidly detecting EHDV and PALV on site are constructed.

Compared with the prior art, the invention has the beneficial effects that:

(1) the invention designs a primer and an nfo probe for jointly detecting EHDV and PALV, and constructs an RPA-LFD detection kit capable of jointly detecting EHDV and PALV nucleic acids popular in China on the basis, and the kit has the advantages of specificity, sensitivity, rapidness, high efficiency, isothermal amplification, rapid on-site diagnosis and the like.

(2) The RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV have strong specificity. As shown in FIG. 1, the primers and nfo probes according to the present invention only produced specific black detection lines (1 or 2) for EHDV or PALV, but did not cross-react with other viruses, including African Horse Sickness Virus (AHSV) inactivated vaccine, bluetongue virus (BTV), Guangxi Orbivirus (GXOV), Tibet Orbivirus (TIBOV) and Yunnan Orbivirus (Yuuov).

(3) The animal infects EHDV and PALV early stage, the virus content in blood is lower, and the RPA-LFD detection kit for jointly detecting EHDV and PALV has good detection sensitivity, and is suitable for the detection of early clinical samples. The sensitivity test result shows that the RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV have the lower detection limits of 7.1 copies/. mu.L and 6.8 copies/. mu.L respectively (figure 2).

(4) Although there are group-specific qRT-PCR detection methods designed for EHDV Seg-9 and PALV Seg-7 reported by Maan et al and lie zhanhong et al, since the qRT-PCR detection requires expensive equipment (about 30 ten thousand yuan), a professional technician is required for an experimental operation process, and the qRT-PCR detection process requires variable temperature cycle processes such as denaturation (95 ℃) and extension (72 ℃) and has a high requirement on stable power supply, it is difficult to apply the qRT-PCR detection method to rapid field diagnosis. The RPA-LFD primer and the nfo probe detection kit for jointly detecting EHDV and PALV, which are disclosed by the invention, can complete amplification reaction under the environment of low temperature and isothermality (39 ℃), and have high detection speed, and the whole detection process (including reverse transcription, RPA amplification and PCRD Nucleic Acid dest reactor detection) can be completed within 1 hour; in addition, the detection kit does not need to be provided with expensive instruments and equipment, and can directly judge the detection result by naked eyes, thereby greatly facilitating the on-site rapid detection.

(5) As the Seg-1 sequences of EHDV and PALV have high conservation, the invention designs the primer aiming at the Seg-1 sequences of the EHDV and PALV strains which are epidemic in China. In the application example A, the RPA-LFD detection kit related by the invention is used for detecting EHDV and PALV strains which are popular in China, and the coincidence rate of the detection result and the virus separation identification result is 100% (table 2), which shows that the detection kit related by the invention can effectively detect all serotype EHDV and PALV strains separated in China; in the application example B, the blood samples of EHDV and PALV strains separated from 2014 to 2019 are detected by using the RPA-LFD detection kit, and the coincidence rate of the detection result and the result of the qRT-PCR detection method of EHDV and PALV is 96.2% (table 3); in the application example C, the RPA-LFD detection kit related by the invention is utilized to carry out retrospective detection on the blood samples of sentinels infected with EHDV and PALV in 2020, and the detection result is totally coincident with the qRT-PCR detection method results of EHDV and PALV (attached figures 3 and 4); in the application example D, 96 bovine blood samples are detected by using the RPA-LFD detection kit, the result coincidence rate with the qRT-PCR detection method of EHDV and PALV is 94.8% (table 4), which shows that the RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV, which are disclosed by the invention, can be used for clinical sample detection, have good sensitivity, specificity and reliability, and can be used for on-site rapid diagnosis of EHD and PALV related epidemic diseases.

(6) Although the RPA amplification product can be detected by agarose gel electrophoresis, the lower limit of detection by the PCRD Nucleic Acid Detector is 0.005ng DNA, while the lower limit of detection by GoldView II is 0.1ng DNA. In application example C, although part of the sample was detected by the PCRD nucleic Acid Detector, no band appeared in the corresponding lane by agarose gel electrophoresis (FIGS. 3 and 4). Therefore, the combination of RPA amplification and LFD detection technology can greatly improve the detection sensitivity.

(7) Compared with the C-ELISA method, the RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV have the advantage of being capable of carrying out early clinical diagnosis. The C-ELISA method is mainly used for detecting the antibody generated by the infected animal, and the time from the infection of EHDV or PALV to the generation of the detectable antibody generally needs 2-3 weeks, but the detection kit provided by the invention can carry out on-site rapid diagnosis before the generation of the antibody.

(8) The visual LAMP detection method of EHDV and PALV related to Lizhanhong and the like can also realize the on-site rapid diagnosis of EHDV and PALV. Compared with the EHDV and PALV visual LAMP detection method, the RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV have the advantages of realizing joint detection of EHDV and PALV and improving the working efficiency by one time.

Drawings

FIG. 1 is a specific assay for the RPA-LFD detection kit of the present invention; from left to right: performing RPA-LFD specificity analysis by respectively taking genome cDNA of EHDV-1, -2, -5, -6, -7, -8, -10 type strains, BCV, CHUV, DAV, AHSV inactivated vaccine, BTV-1, -16 type strains, GXOV, TIBOV and YUOV and negative control as templates; from left to right: the result of the agarose gel electrophoresis detection of the RPA amplification product, M: DNA Marker (DL 5000);

FIG. 2 shows the sensitivity test of the RPA-LFD detection kit according to the present invention; from left to right: at a concentration of 7.1X 10 respectively⁵Copy/. mu.L-7.1X 10⁰Copies/. mu.L of EHDV Positive control and 6.8X 10⁵Copy/. mu.L-6.8X 10⁰Performing sensitivity analysis by taking the copied/mu L of PALV positive control and negative control as templates; from left to right: the result of the agarose gel electrophoresis detection of the RPA amplification product, M: DNA Marker (DL 5000);

FIG. 3 is a retrospective detection of a blood sample of a sentinel cow infected with EHDV with the RPA-LFD detection kit according to the present invention; from left to right: respectively carrying out RPA-LFD detection on blood samples of sentinels infected with EHDV and negative control templates collected from one sentinels infected with EHDV in 7-10 months in 2020; from left to right: the result of qRT-PCR detection on the blood sample is expressed by Cycle Threshold (CT); from left to right: agarose gel electrophoresis detection of RPA amplification products of the blood sample and negative control template, M: DNA Marker (DL 5000);

FIG. 4 is a retrospective examination of a blood sample of a sentinel cow infected with PALV with the RPA-LFD detection kit of the present invention; from left to right: respectively carrying out RPA-LFD detection on blood samples of sentinel cattle infected with PALV and a negative control template collected from one sentinel in 2020 from 5 months to 7 months; from left to right: the result of qRT-PCR detection is carried out on the blood sample, and the result is expressed by CT value; from left to right: agarose gel electrophoresis detection of RPA amplification products of the blood sample and negative control template, M: DNA Marker (DL 5000).

Detailed Description

The present invention will be described in further detail with reference to examples.

It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The materials or equipment used are not indicated by manufacturers, and all are conventional products available by purchase.

(1) Experimental Material

EHDV-1 type strain is described in 2013-2019, separation and genetic characterization of serous 1 type strain of chinese epidemic hemorrhagic disease virus, plum Zhujian, Wujian Ming, Zhujian Bo, Wangjinping, Lu Ming, Shao Lei, Yang Shao xing, Li Hua Chun, Liao Defang, Yang Heng, south agriculture Commission (southern agricultural science) 2021, stage 8; the EHDV-5 type strain is recorded in the separation and genetic characteristic analysis of the Chinese epidemic hemorrhagic disease virus serous type 5 in 2013-2016, and has the characteristics of Yangxing, Lizhanhong, Wangjinping, Xiaolei, Kouzing, Zhujiabo, Liaode Fang, Lihuachun, Yanheng, the report of viral science 2020 and the 36 th stage; the EHDV-6 type strain is recorded in the isolation and genetic characteristics of an epidemic hemorrhagic disease virus serum 6 type strain (EHDV-6) in Yunnan and Guangdong provinces, Lizhanhong, Yangxing, Linhuixian, Lvxina, Share, Kouzelin, Liaode Fang, Zhujiangbo, Yangheng, Lihuachun, the university of south China, the proceedings of agriculture 2020, 4 th stage; EHDV-7 type strain is described in the first isolation and identification of Epidemic Hemorrhagic Disease Virus (EHDV) serotype 7 strain in china, yangxing, mengxin, xiaoliao, zhujiabo, laodafang, gaolin, lie zhanhong, yangheng, li huachun, veterinary article for livestock "2019, stage 50; the EHDV-10 type strain is described in the isolation and identification of bovine derived Epidemic Hemorrhagic Disease Virus (EHDV) serotype 10 strain in China, Lizhanhong, Sharey, Yangxing, Mengjinxin, Liaode Fang, Gaolin, Lihuachun, Yanheng, the Virus institute "2019, 35 th period, the EHDV serotype strain is publicly available from animal husbandry and veterinary academy in Yunnan province. The isolation and sequence characterization of strains of the PALV chev serotypes, BCV serotypes and DAV serotypes are described in 2012-2016 in southern china in the isolation of palinura serogroup viruses, yanheng, xiarley, lissaho, menjinxin, yangxing, lominana, linhui, laodefang, niu baosheng, li huachun, proceedings of veterinary medicine in livestock husbandry, 2018, 49 th, publicly available from the veterinary academy of sciences of livestock veterinary medicine in Yunnan province. Bluetongue Virus (BTV) serotype 1 (BTV-1) and 16 (BTV-16) are described in Sequence compliance of the L2 and S10genes of bluetongue vi from the United States and the Pen' S Republic of China, Bon neau KR, Zhuang N, Zhu J, Zhuang F, Maclachlan NJ, Virus Research 1999, No. 61, publicly available from animal veterinary academy of sciences in Yunnan province; guangxi circovirus (GXOV) describes the isolation and whole genome sequence analysis of a novel strain of circovirus in bovine blood, Yangxi, Lizhuhong, Zhang Yixuan, Gaolin, Xieirui, Lidofang, Wujiamin, Lihuachun, Prov. Virus (Prov. Rev.) 2018, No. 34, publicly available from animal husbandry and veterinary academy of sciences, Yunnan province; tibet circovirus (TIBOV) is described in Isolation of Tibet Orbivirus from microorganisms and associated infections in livestock in Yunnan, China, Wang J, Li H, He Y, Zhou Y, Xin A, Liao D, Meng J, Virology Journal 2017, 14 th, publicly available from the animal husbandry and veterinary academy of sciences of Yunnan province; yunan circovirus (YuOV) is described in Yunan Orbivirus, a new Orbivirus species isolated from Culex tritaineniorhynchus mosquitoes in China, Attoui H, Journal of General Virology 2005, 86 publicly available from the animal husbandry veterinary academy of Yunnan province. EHDV-2, -8 type reference strains and African Horse Sickness Virus (AHSV) inactivated vaccines were kindly given by the world animal health Organization (OIE) reference laboratory majorse, illinisha, agricultural research institute. The EHDV Seg-1DNA fragment and the PALVSeg-1 DNA fragment were prepared by the method of the present invention using an internal positive control template, by the national institute of veterinary sciences, Yunnan province.

(2) Reagent and apparatus

MagMAX^TM96Viral RNA Isolation Kit from Thermo Fisher Scientific;

vral DNA/RNA Kit was purchased from TransGen Biotech; prime Script^TMRT Master Mix and DNA Marker (DL5000) were purchased from TaKaRa;

nfo Kit and PCRD Nucleic Acid Detector were purchased from Murray (Shanghai) Biotech, Inc.;

High-Fidelity 2 × Master Mix and

universal Probe qPCR Master Mix was purchased from NEB; the Universal DNA purification and recovery kit is purchased from Tiangen Biochemical technology Co., Ltd; GoldView II (100X) and agarose were purchased from Solebao.

KingFisher Flex platform (Thermo Fisher Scientific); gradient PCR instrument Veriti 96Well Thermal Cycler (ABI); real-time fluorescent quantitative PCR instrument 7500fast (abi); power Pac Basic (BIO-RAD) electrophoresis apparatus; horizontal electrophoresis system DYCP-32B (six-one beijing); ultraviolet Gel imaging system Gel Doc XR⁺(BIO-RAD); ultraviolet light splittingMeter Nano Vue Plus (GE); OSE-96 (Tiangen Biochemical technology Co., Ltd.) as a dry constant temperature metal bath; desk top centrifuge 1-14 (Sigma).

(3) Design of primers and nfo probes

Specific primers and nfo probes for RPA-LFD co-detection of EHDV and PALV are designed aiming at EHDV and PALV Seg-1 sequences popular in China. Labeling the 5' ends of the two downstream primers with a Bio group; respectively labeling 5' ends of the EHDV nfo probe and the PALV nfo probe by using DIG and FITC groups; blocking groups C3-spacer are added at the 3' ends of the two nfo probes; the 31 st positions of the two nfo probes are TH F. Primer and nfo probe sequences are shown in table 1.

TABLE 1 sequence information of primers and nfo probes used in the RPA-LFD detection kit of the present invention

(4) Preparation of Positive control template

According to the early acquired Chinese epidemic EHDV and PALV whole genome sequences, two pairs of specific primers are designed: EHDV Seg-1F: 5'-aaaatgcaatggtcgcaattaccgt-3' (SEQ ID NO. 7); EHDV Seg-1R: 5'-tttttcacccacgcacgtcc-3' (SEQ ID NO. 8); PALV Seg-1F: 5'-gtcatattgcttctgcttcaa-3' (SEQ ID NO. 9); PALV Seg-1R: 5'-ccttacccgtgtgctcatcc-3' (SEQ ID NO.10) was used for the amplification of EHDV Seg-1DNA fragment and PALV Seg-1DNA fragment, the amplification product lengths were 1174bp and 959bp, respectively. The nucleic acid sequence obtained by PCR amplification is shown in SEQ ID NO.11 and SEQ ID NO. 12.

The specific method comprises the following steps:

using viral DNA/RNA extraction kit "

The genomic RNA of EHDV and PALV isolated in China is extracted by Vral DNA/RNA Kit (Transgen Biotech), denatured at 94 ℃ for 3min, immediately ice-bathed and processed according to the "PrimeScript^TMRT Master Mix (Perfect Real Time) "(Takara) instructions reverse the viral genomic RNA described aboveRecorded as cDNA.

The reverse transcription system is as follows:

5×PrimeScript RT Master Mix，2.0μL；

5.0 microliter of extracted viral genome RNA;

RNase-free water, 3.0. mu.L;

total 10.0. mu.L.

The reverse transcription procedure was:

reverse transcription at 37 deg.C for 15min for 1 cycle; inactivation of reverse transcriptase was 85 ℃ for 5s for 1 cycle.

The EHDV Seg-1DNA fragment and the PALV Seg-1DNA fragment amplification primer pair are utilized, EHDV and PALV whole genome cDNA are taken as templates, and the method is characterized in that "

High-Fidelity 2 × Mast er Mix "(NEB) instructions amplify the EHDV Seg-1DNA fragment and the PALV Seg-1DNA fragment, respectively.

The amplification system is as follows:

Q5 High-Fidelity 2×Master Mix，12.5μL；

upstream primer (10. mu. mol/L), 1.25. mu.L;

downstream primer (10. mu. mol/L), 1.25. mu.L;

viral genomic cDNA, 1.0 μ L; (ii) a

RNase-free water, 9.0. mu.L;

total 25.0. mu.L.

The amplification procedure was:

pre-denaturation at 98 ℃ for 30s for 1 cycle; denaturation 98 ℃, 10s, annealing 55.5 ℃ (EHDV)/53.0 ℃ (PALV), 20s, extension 72 ℃, 30s, for 35 cycles; after extension at 72 ℃ for 2 min.

The amplified products were recovered and purified according to the instructions of the "Universal DNA purification recovery kit" (Tiangen Biochemical technology Co., Ltd.), and the obtained EHDV Seg-1DNA fragment and PALV Seg-1DNA fragment were positive control templates with concentrations of 91.5 ng/. mu.L and 71.3 ng/. mu.L, respectively. According to the calculation formula of the DNA copy number: copy number (copy/. mu.l) ═ DNA concentration (g/. mu.l) × 6.02 × 10²³(copy/mol)/(660 XDNA base number) EHDV was calculatedAnd the copy number of the positive control template of PALV, which are 7.1X 10¹³Copies/. mu.L and 6.8X 10¹³Copies/. mu.L.

(5) Specificity analysis

Extraction kit using viral DNA/RNA "

The Vral DNA/RNA Kit (Transgen Biotech) extracts EHDV-1, -2, -5, -6, -7, -8, -10 type strains, BCV, CHUV, DAV, AHSV inactivated vaccine, BTV-1, -16 type strains, GXOV, TIBOV and YUOV genomic RNA, and immediately ice-bathes after denaturation at 94 ℃ for 3 min. According to "PrimeScript^TMRT Master Mix (Takara) instructions reverse transcribe the viral genomic RNA described above into cDNA.

The reverse transcription system is as follows:

5×PrimeScript RT Master Mix，2.0μL；

5.0 μ L of extracted viral RNA;

RNase-free water, 3.0. mu.L;

total 10.0. mu.L.

The reverse transcription procedure was:

reverse transcription at 37 deg.C for 15min for 1 cycle; inactivation of reverse transcriptase was 85 ℃ for 5s for 1 cycle.

Using the above-mentioned viral genomic cDNA as a template "

The RPA amplification reaction was performed in the nfo Kit "(Twist) instructions.

The amplification system is as follows:

nfo Kit RPA amplification reagent freeze-dried powder, 1 tube;

Primer free rehydration buffer，29.5μL；

upstream primer EHDV _ F (10. mu. mol/L), 2.1. mu.L;

downstream primer EHDV _ R (10. mu. mol/L), 2.1. mu.L;

the upstream primer PALV _ F (10. mu. mol/L), 2.1. mu.L;

the downstream primer PALV _ R (10. mu. mol/L), 2.1. mu.L;

nfo Probe EHDV _ Probe (10. mu. mol/L), 0.6. mu.L;

nfo Probe PALV _ Probe (10. mu. mol/L), 0.6. mu.L;

viral genome cDNA template, 1.0 μ L;

RNase-free water, 7.4. mu.L;

Magnesium acetate(280mmol/L)，2.5μL；

a total of 50.0. mu.L.

The amplification procedure was:

39℃，20min。

and taking the RPA amplification reaction product to perform amplification product detection and result judgment according to the specification of a PCRD Nucleic Acid Detector (ABINGDON HEALTH).

The detection system is as follows:

RPA amplification product, 6. mu.L;

PCRD extraction buffer，84μL；

the total volume was 90.0. mu.L.

Take 75. mu.L of the above mixture. And adding a PCRD detection hole, standing at room temperature for 10min, and judging the detection result, wherein the detection result is invalid if the time exceeds 10 min.

By using the RPF-LFD detection kit for jointly detecting EHDV and PALV, 1 mu L of the cRNA of the virus genome is taken as a template to carry out RPA amplification reaction for 20min at 39 ℃, and a PCRD Nucleic Acid Detector is used for detecting amplification products and carrying out RPA-LFD specificity analysis, so that the RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV can specifically detect EHDV-1, -2, -5, -6, -7, -8 and-10 strains and BCV, CHUV and DAV, and have no cross reaction with AHSV inactivated vaccine, BTV-1 and-16 strains, GXOV, BOTIV and YUOV (figure 1).

(6) Sensitivity analysis

The RPA-LFD detection kit for jointly detecting EHDV and PALV related by the invention has the copy number of 1 mu L of 7.1 multiplied by 10 respectively⁵Copy/. mu.L, 7.1X 10⁴Copy/. mu.L, 7.1X 10³Copy/. mu.L, 7.1X 10²Copy-μL、7.1×10¹Copies/. mu.L and 7.1X 10⁰Copy/. mu.L EHDV Seg-1DNA fragment, 1. mu.L copy number 6.8X 10, respectively⁵Copy/. mu.L, 6.8X 10⁴Copy/. mu.L, 6.8X 10³Copy/. mu.L, 6.8X 10²Copy/. mu.L, 6.8X 10¹Copies/. mu.L and 6.8X 10⁰The RPA-LFD sensitivity analysis is carried out on the copied/mu L PALV Seg-1DNA fragment and a negative control template, and the detection lower limit of the RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV related by the invention is 7.1 copies/mu L of the EHDV Seg-1DNA fragment and 6.8 copies/mu L of the PALV Seg-1DNA fragment (shown in figure 2).

The amplification system is as follows:

nfo Kit RPA amplification reagent freeze-dried powder, 1 tube;

Primer free rehydration buffer，29.5μL；

upstream primer EHDV _ F (10. mu. mol/L), 2.1. mu.L;

downstream primer EHDV _ R (10. mu. mol/L), 2.1. mu.L;

the upstream primer PALV _ F (10. mu. mol/L), 2.1. mu.L;

the downstream primer PALV _ R (10. mu. mol/L), 2.1. mu.L;

nfo Probe EHDV _ Probe (10. mu. mol/L), 0.6. mu.L;

nfo Probe PALV _ Probe (10. mu. mol/L), 0.6. mu.L;

EHDV positive control template, 1.0 μ L;

PALV positive control template, 1.0 μ L;

RNase-free water, 6.4. mu.L;

Magnesium acetate(280mmol/L)，2.5μL；

a total of 50.0. mu.L.

(7) Examples of the applications

A. The RPA-LFD detection kit for jointly detecting EHDV and PALV is applied to detect EHDV and PALV strains

The RPA-LFD detection kit for jointly detecting EHDV and PALV provided by the invention is used for detecting 39 strains of EHDV and 29 strains of PALV. The RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PLAV, which are disclosed by the invention, can effectively detect all EHDV and PALV strains, and the coincidence rate of the separation and identification results of the EHDV and the PALV strains with the viruses is 100%, which is shown in Table 2.

TABLE 2 results of EHDV and PALV strains tested by the RPA-LFD test kit of the present invention

B. The blood sample for separating EHDV and PALV is detected by using the RPA-LFD detection kit

According to "MagMAX^TMTotal RNA from blood samples of EHDV and PALV was isolated in 2014 to 2019 under the instruction of-96 Viral RNA Isolation Kit (Thermo Fisher scientific c), denatured at 94 ℃ for 3min and immediately ice-washed. According to "PrimeScript^TMRT Master Mix (Perfect Real Time) "(Takara) instructions reverse transcribe total RNA to cDNA. Taking 1. mu.L of cDNA as a template, according to "

The RPA amplification reaction was performed with nfo Kit "(Twist) instructions and the amplification product was detected with a" PCRD Nucleic Acid Detector "(ABINGDON hearth). EHDV qRT-PCR and PALV qRT-PCR primers and probes reported by Maan et al and Lizhanhong et al simultaneously "

The above blood samples were tested simultaneously according to the Universal Probe qPCR Master Mix "(NEB) instructions, and the results are expressed as CT value ranges. The RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV, which are disclosed by the invention, can effectively detect and separate blood samples of EHDV and PALV, and the coincidence rate with the qRT-PCR detection result is 96.2%, which is specifically shown in Table 3.

TABLE 3 results of the detection of isolated EHDV and PALV blood samples using the RPA-LFD detection kit and the qRT-PCR method according to the present invention

C. The RPA-LFD detection kit related by the invention is used for carrying out backtracking detection on the sentinel bovine blood sample

24 blood samples of EHDV-infected and PALV sentinel cattle collected from 5 to 10 months of 2020 were taken for RPA-LFD testing, 12 blood samples of EHDV-infected and 12 blood samples of PALV-infected. The blood samples were simultaneously tested with EHDV qRT-PCR and PALV qRT-PCR primers and probes reported by Maan et al and Lizhanhong et al (FIGS. 3 and 4). The RPA-LFD detection result shows that no positive detection line appears in a blood sample collected from 14 days of PaLV sentinel cattle infected 5 months in 2020, but the CT value of the sample is 39.3, and the copy number of the PALV is only 0.39 copies/. mu.L by calculation according to a PALV qRT-PCR regression equation, which indicates that the qRT-PCR detection result of the sample is negative. Therefore, the result of retrospective detection of blood samples of sentinel cattle infected with EHDV and PALV by using the RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV related to the invention is consistent with the result of qRT-PCR detection.

D. The RPA-LFD detection kit provided by the invention is used for detecting clinical blood samples

The total amount of collected bovine blood samples is 96 parts, and the blood samples are jointly detected by EHDV and PALV by using the RPA-LFD detection kit provided by the invention. Simultaneously, EHDV qRT-PCR and PALV qRT-PCR primers and probes reported by Maan et al and Lizhanhong et al are used for simultaneously detecting the blood samples. The RPA-LFD detection kit provided by the invention can effectively detect blood samples infected with EHDV or PALV and co-infected with EHDV and PALV, and the coincidence rate with the qRT-PCR detection result is 94.8%, which is shown in Table 4. In conclusion, the RPA-LFD primer, the nfo probe and the detection kit for jointly detecting EHDV and PALV have good sensitivity and reliability.

TABLE 4 results of clinical blood samples tested using the RPA-LFD assay kit and qRT-PCR method of the present invention

Primer sequences and nfo probe sequences derived from the primer pairs and nfo probes of the invention are also within the scope of the invention. The derivative sequence is a primer sequence obtained by substitution, deletion or addition of one to ten bases on the basis of SEQ ID NO.1 to SEQ ID NO. 6.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

SEQ ID NO.11

SEQ ID NO.12

Sequence listing

<110> department of sciences of animal husbandry and veterinary science of Yunnan province

<120> RPA-LFD primer, probe and kit for jointly detecting epidemic hemorrhagic disease virus and paliymenia serogroup virus

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 33

<212> DNA

<213> Artificial sequence ()

<400> 1

tggattgcct gttttacatg attcaacttg gga 33

<210> 2

<211> 40

<212> DNA

<213> Artificial sequence ()

<400> 2

taacgcttga cgaacgatga cataactttc acccctaaac 40

<210> 3

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 3

tactaaaatt tcaagagggt tttctcataa attgg 35

<210> 4

<211> 36

<212> DNA

<213> Artificial sequence ()

<400> 4

ggtcataact atattaagcg attcataata agcccc 36

<210> 5

<211> 45

<212> DNA

<213> Artificial sequence ()

<400> 5

tttattgaac aaagagcgaa gaacgaaatg aaatatatgg agaca 45

<210> 6

<211> 45

<212> DNA

<213> Artificial sequence ()

<400> 6

tgaggatggt tttactatgt atttaattcg gatccattgt gtgct 45

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 7

aaaatgcaat ggtcgcaatt accgt 25

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 8

tttttcaccc acgcacgtcc 20

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 9

gtcatattgc ttctgcttca a 21

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 10

ccttacccgt gtgctcatcc 20

<210> 11

<211> 1174

<212> DNA

<213> Artificial sequence ()

<400> 11

aaaatgcaat ggtcgcaatt accgtgcaag gtgcacagct cattaaacga gtggttgaaa 60

gaatatatca aggaataaca ttcgagttag ataatggcat cacagagttt tataaatttt 120

cagaacatat caggcgcata agagaaaaac acggagtgat atataagaga aaagcagaag 180

agatagagca caacattaaa atgaggaagg aacaactgtt tggattgcct gttttacatg 240

attcagcttg ggaagaaatc tttaatattg actataaaga tgatagtgtt ttacaggtgt 300

acatgaattc agtgctacgc cagggagaat tggatccgga ggaagagttc ctgcgaaatt 360

ataaggtgca aggcgagcat gctgggttga cgcaatttat tgaacaaaga gcgaagaacg 420

aaatgcaaat atatggagac ataccaatca aagtttgggc cgcatttcta attgaattgg 480

attcagaagt taaccaccag agtttagggg tgaaagttat gtcatcgttc gtcaagcgct 540

atggagagcc cttccatcag ggttttcgag atttatcgaa cttagaaagg tttaacgtat 600

catactcaac gccgctgttg tttgaaatgt gttgtatgga atcaatatta gagcataata 660

ttataatgcg catgaaggag gaggggatac acaatttgga gtttggggat gagaaaattg 720

atccgatagc gttgctgcgc gaattgttta ttatatgttt gcctcatccg aagaaaatta 780

ataatatgtt aagatcgcca tattcatggt ttgttaaatt atggggggtg ggcgctgacc 840

aagttacagt attgacgtcg ggtgcaggcg acgatcgtaa ttcgaaagac gttttttatg 900

acaaatatca gacaaatgca aatcgttacg tcaacatttt taaatgtaaa ttttataccg 960

aatcgcagaa atcgaattcg gagaaggttg aagaggcgat cttatattca caagagctcg 1020

gaatgcatca ttatagctta cccgtgtttc aatcaatgtt acgaaatgta tatacaaggc 1080

ccttttatcc gttcaaacag agcaatttga tgttggcatc attcttgcta agcttacagg 1140

taataacagg ttacggacgt gcgtgggtga aaaa 1174

<210> 12

<211> 959

<212> DNA

<213> Artificial sequence ()

<400> 12

gtcatattgc ttctgcttca aaaacaatca tagctccctt ttccgttgag aagacgcaaa 60

cacatgctaa acaaggaata tatatacccc aggatagaat gatgttgatc tcgtctgaaa 120

gacgaaagga tattgaggat gtccgaggct atcttaaatc acaagttcaa actttgacta 180

ctaaaatttc aagagggttt tctcataaat tggcgagaat gattttaatg ttgaaaacat 240

cattagttgg ctttcggaaa ttgaaacgga ctatttttgc cgacggagtg tatagggata 300

gacgctttga ttctgatgat gaggatggtt ttactatgta tttaattcga gatccattgt 360

gtgcttttct cccagttgaa tggaatggag ttggggctta ttatgaatcg cttaatatag 420

ttatgaccga agatatattc ttagatctct tacaaacggg aaatgagttt gttcgacacc 480

tagctggttt tattaatggt actttaccgt tttggaatga aacagaagcg gataaacggc 540

agataggtac tgatgcgaag atgagtttct ttaccaagat ggcaagaccc gctgttcaaa 600

gcgtgctgaa tagcgacgaa ctaacagatt tagtgaaaca attaccgtta ggagattata 660

gtccaacgaa catatcgaaa actatgatgc attcagcttt attgaaagag tcgtcagcgc 720

gtagcatatt gacgccaact tatgaatcgg aatatcagcg actcctgaat gtccgggagg 780

aaaaaagttt caaaatgttt agtcacgatc tagaactgag tacgaactac attaaaatgt 840

ttgacgttca gtattcgtct ggggtgcagc gccattttta ttttccagat caaaatttat 900

cgccttcttt tttcttacag aagaatttat tagggccaag gatgagcaca cgggtaagg 959

Claims (10)

1. The RPA-LFD primer for jointly detecting the epidemic hemorrhagic disease virus and the Palima serogroup virus is characterized by comprising an RPA-LFD detection primer of EHDV and an RPA-LFD detection primer of PALV;

the RPA-LFD detection primer of EHDV comprises an upstream primer EHDV _ F and a downstream primer EHDV _ R, and the nucleotide sequence is as follows:

an upstream primer EHDV _ F: tggattgcctgttttacatgattcaacttggga, respectively; (SEQ ID NO. 1);

downstream primer EHDV _ R: bio-taacgcttgacgaacgatgacataactttcacccctaaac; (SEQ ID NO. 2);

the RPA-LFD detection primer of the PALV comprises an upstream primer PALV _ F and a downstream primer PALV _ R, and the nucleotide sequence is as follows:

the upstream primer PALV _ F: tactaaaatttcaagagggttttctcataaattgg, respectively; (SEQ ID NO. 3);

the downstream primer PALV _ R: bio-ggtcataactatattaagcgattcataataagcccc; (SEQ ID NO. 4).

2. The probe used in combination with the primer of claim 1, wherein the nucleotide sequences of the nfo probe are:

EHDV_Probe：DIG-tttattgaacaaagagcgaagaacgaaatg[THF]aaatatatggagaca[C3-spacer]；（SEQ ID NO.5）；

PALV_Probe：FITC-tgaggatggttttactatgtatttaattcg[THF]gatccattgtgtgct[C3-spacer]；（SEQ ID NO.6）。

3. a kit comprising the primer of claim 1 and/or the probe of claim 2.

4. The kit of claim 3, further comprising: a negative control template, a positive control template, a reverse transcription reagent, an amplification reagent and a PCRD Nucleic Acid Detector.

5. The kit of claim 4, wherein the negative control template is RNase-free water; the positive control template is EHDV and PALV Seg-1DNA fragments.

6. The kit of claim 5, wherein the number of copies of the positive control template is: EHDV Seg-1DNA fragment 7.1X 10¹³Copy/. mu.L, 6.8X 10 of the PALV Seg-1DNA fragment¹³Copies/. mu.L.

7. The kit of claim 4, wherein the reverse transcription reagent comprises 5 XPrimeScript RT Master Mix and RNase-free water.

8. The kit of claim 7, wherein the reverse transcription system of the kit is: 5 XPrimeScript RT Master Mix, 2.0. mu.L;

total RNA, 5.0. mu.L;

RNase-free water, 3.0. mu.L;

a total of 10.0. mu.L;

the reverse transcription procedure was: reverse transcription at 37 deg.C for 15min for 1 cycle; inactivation of reverse transcriptase was 85 ℃ for 5s for 1 cycle.

9. The kit of claim 4, wherein:

the amplification system of the kit is as follows:

TwistAmp

nfo Kit RPA amplification reagent freeze-dried powder, 1 tube;

Primer free rehydration buffer，29.5 μL；

the upstream primer EHDV _ F is 10 mu mol/L and 2.1 mu L;

downstream primer EHDV _ R, 10. mu. mol/L, 2.1. mu.L;

the upstream primer PALV _ F, 10. mu. mol/L, 2.1. mu.L;

the downstream primer PALV _ R is 10 mu mol/L and 2.1 mu L;

nfo Probe EHDV _ Probe, 10. mu. mol/L, 0.6. mu.L;

nfo Probe PALV _ Probe, 10. mu. mol/L, 0.6. mu.L;

1.0 μ L of cDNA template for reverse transcription;

RNase-free water, 7.4. mu.L;

Magnesium acetate，280 mmol/L，2.5 μL；

a total of 50.0. mu.L;

the amplification procedure was: at 39 ℃ for 20 min.

10. The kit of claim 4, wherein:

the detection system of the kit is as follows:

RPA amplification product, 6. mu.L;

PCRD extraction buffer，84 μL；

90.0 mu L in total;

adding 75 mu L of the mixed solution into a PCRD detection hole for detection;

the detection procedure is as follows: room temperature, 10 min.

Images