CN113265451B - Method for improving real-time fluorescence quantitative PCR specificity - Google Patents
Method for improving real-time fluorescence quantitative PCR specificity Download PDFInfo
- Publication number
- CN113265451B CN113265451B CN202010094899.3A CN202010094899A CN113265451B CN 113265451 B CN113265451 B CN 113265451B CN 202010094899 A CN202010094899 A CN 202010094899A CN 113265451 B CN113265451 B CN 113265451B
- Authority
- CN
- China
- Prior art keywords
- graphene oxide
- oxide quantum
- quantum dots
- weight
- parts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a method for improving real-time fluorescence quantitative PCR specificity based on graphene oxide quantum dots, which comprises the following steps: the method comprises the steps of preprocessing a real-time fluorescent quantitative PCR primer by using graphene oxide quantum dots, and then applying the primer to the real-time fluorescent quantitative PCR. The invention has the advantages that: the comprehensive optimization effect of optimizing the real-time fluorescent quantitative PCR by using the graphene oxide quantum dots is better, and the yield and the specificity of the real-time fluorescent quantitative PCR amplification product can be effectively improved. And the dosage of the graphene oxide quantum dots required by optimization is low. In addition, the preparation steps of the graphene oxide quantum dots are simple, and the graphene oxide quantum dots are convenient to store.
Description
Technical Field
The invention belongs to the field of biomolecule detection, and particularly relates to a method for improving real-time fluorescence quantitative PCR specificity based on graphene oxide quantum dots.
Background
Graphene Oxide Quantum Dots (GOQDs) are zero-dimensional carbon nano materials, and the surfaces of the graphene oxide quantum dots contain rich oxygen-containing functional groups; GOQDs can be prepared using the Photo Fenton method (Photo-Fenton reaction). Since GOQDs have good structure and physicochemical properties, GOQDs are widely used in various fields of biological medicine. For example: the study shows that the GOQDs prepared by the Photo Fenton method can form a complex with copper ions so as to cut a DNA chain, and provides possibility for further application of the GOQDs in biological and medical studies such as tumor treatment (Photo-Fenton reaction of graphene oxide: a new strategy to prepare graphene quantum dots for DNA cleavage, ACS Nano,2012,6, 6592-6599.). GOQDs prepared by the photo-Fenton method realize the degradation of graphene oxide, and have a wide application range in the aspects of environmental protection and the like (Insight into the Mechanism of Graphene Oxide Degradation via the Photo-Fenton Reaction, journal of Physical Chemistry C Nanomaterials & Interfaces,2014, 118, 10519).
The real-time fluorescent quantitative PCR (qRT-PCR) is to detect the change of the amplified product quantity of each cycle in the PCR amplification reaction in real time by utilizing the change of a fluorescent signal, and quantitatively analyze the copy number of an initial template in a sample by analyzing a cycle threshold and a standard curve.
When the template content is too low, qRT-PCR is easy to generate false positive results and nonspecific amplification, so that the quantification is inaccurate. In recent years, studies have been aimed at improving the performance of qRT-PCR to obtain more accurate results. For example: studies have reported that the use of C60 can improve the performance of qRT-PCR (C60 affects DNA replication in vitro by decreasing the melting temperature of DNA templates,2009,47, 1457-1465); however, the manufacturing steps of the C60 are extremely complex, the price of the finished product C60 is extremely high, and the C60 is difficult to popularize in qRT-PCR application. There are also patent reports that applying Graphene Quantum Dots (GQDs) to the conventional PCR can improve the specificity of the conventional PCR and improve the comprehensive optimization effect of the conventional PCR (patent publication No. CN 103773757A); GQDs can improve PCR specificity due to its surface all being sp 2 The conjugated region can adsorb single-stranded DNA through pi-pi conjugation, so that the occurrence of nonspecific amplification in the PCR process is reduced; however, qRT-PCR requires more stringent requirements than conventional PCR because the fluorescent dye molecules (or groups) themselves and sp used in qRT-PCR 2 Pi-pi conjugation can be formed between the regions so as to quench fluorescence of fluorescent dye molecules, which can lead to no fluorescence signal detected by qRT-PCR, thus the GQDs are difficult to directly apply to qRT-PCR.
At present, no related technology for applying graphene oxide quantum dots to qRT-PCR has been reported.
Disclosure of Invention
The invention aims to provide a method for improving the sensitivity and specificity of real-time fluorescence PCR based on graphene oxide.
The technical scheme of the invention comprises the following steps:
a fluorescent quantitative PCR primer pretreatment method comprises the steps of mixing graphene oxide quantum dots with a primer, and incubating for 30+/-5 min at 15-35 ℃.
The pretreatment method as described above, wherein the temperature is 35℃and/or the incubation time is 30min.
According to the pretreatment method, before the graphene oxide quantum dots are mixed with the primer, the graphene oxide quantum dots are subjected to ultrasonic treatment for 30min.
The pretreatment method is characterized in that the dosage ratio of the graphene oxide quantum dots to the forward primer or the reverse primer is 1.5-11 mug to 0.01 mug, preferably 2.2-11 mug to 0.01 mug; further preferably, it is 5.3 to 11. Mu.g:0.01. Mu. Mol; still more preferably, it is 5.3. Mu.g:0.01. Mu. Mol.
A method for optimizing fluorescent quantitative PCR (polymerase chain reaction) is characterized in that the pretreatment method is adopted, and graphene oxide quantum dots are used for treating primers to prepare a fluorescent quantitative PCR reaction system for fluorescent quantitative PCR.
As in the previous method, the real-time fluorescent quantitative PCR is TaqMan probe method.
The preparation method of the graphene oxide quantum dot comprises the following steps of:
1) Placing 1 part by weight of graphite in 40-50 parts by volume of concentrated H 2 SO 4 Adding 0.8 to 1.2 weight parts of NaNO 3 Obtaining a system A;
2) MnO is added to 3 + Adding the mixture into the system A in batches, wherein the single addition amount is according to MnO 3 + Adding 3.5-4.0 parts by weight of MnO in an amount of not more than 0.15 parts by weight 3 + Obtaining manganese-embedded graphite through reaction;
3) Adding water into manganese-embedded graphite to prepare suspension, adding 500-1200mL of 30% hydrogen peroxide and 1-2g of zero-valent iron into each 10g of manganese-embedded graphite, and continuously boiling for 6min;
4) Dialyzing the product in the step 3) in deionized water for 7 days to obtain graphene oxide quantum dot aqueous solution;
when the volume part is mL, the weight part is g;
preferably, in step 1) concentrated H 2 SO 4 44-48 parts by volume, and/or NaNO 3 0.9 to 1.1 parts by weight.
Further, mnO in step 2) of the preparation method of graphene oxide quantum dots 3 + The preparation method of the solution comprises the following steps:
5 to 10 weight portions of KMnO 4 Adding 140-150 parts by volume of concentrated H 2 SO 4 And 1 part by weight of NaNO is added 3 Formation of MnO 3 + ；
Preferably, 5 to 6 parts by weight of KMnO 4 Adding 144-148 parts by volume of concentrated H 2 SO 4 And 1 part by weight of NaNO is added 3 Formation of MnO 3 + 。
The application of graphene oxide quantum dots in improving the specificity of real-time fluorescence quantitative PCR.
A fluorescent quantitative PCR kit, which contains a component for improving the specificity of fluorescent quantitative PCR;
the component for improving the specificity of the fluorescent quantitative PCR is graphene oxide quantum dots.
Like GQDs, GOQDs also exhibit sp 2 The region can adsorb part of the single-stranded DNA through pi-pi conjugation to inhibit non-specific amplification. As a rule, GOQDs are also inferred by sp 2 The presence of the region quenches fluorescence by pi-pi conjugation. However, GOQDs are rich in oxygen-containing functional groups on their surface and have a large number of sp 3 Region sp 3 The region can weaken pi-pi conjugation between the fluorescent group and the graphene oxide quantum dot, so that the fluorescent group is far away from the surface of the graphene oxide quantum dot, and fluorescence quenching is reduced.
The method of the invention applies GOQDs to fluorescent quantitative PCR, can enhance the specificity of PCR, ensures that the fluorescent signal intensity is maintained at a higher level, is suitable for detecting complex samples or highly similar samples, and has higher application value.
In a preferred embodiment of the present invention, the modified Fenton method is used to prepare GOQDs, and the proportion of hydroxyl oxygen-containing functional groups on the surface of GOQDs is theoretically increased and the proportion of carboxyl groups is relatively reduced compared with the photo-Fenton method. Experiments prove that compared with the GOQDs obtained by the optical Fenton method, the GOQDs obtained by the preparation method of the GOQDs are more beneficial to enhancing the specificity of fluorescence quantitative PCR and reducing fluorescence signal quenching.
In addition, because of sp 2 The region has adsorption effect on single-stranded DNA, when DNAWhen the template amount is low, target DNA and specific amplified products generated in the previous qPCR amplification cycles are adsorbed in a large proportion, and finally the template amount actually participating in qPCR is possibly too small; however, it is known in the art that too small an amount of template may result in poor qPCR detection accuracy. Unexpectedly, however, at an initial template copy number of 10 4 -10 10 In the range of copies/. Mu.l, the Ct value of the invention is linear with the logarithm of the initial template copy number, indicating that the invention is useful in low template concentrations (10 4 copies/. Mu.l) is still accurate.
It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.
The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.
Drawings
FIG. 1 shows the effect of GOQDs on the specificity of fluorescent quantitative PCR products.
FIG. 2 shows the effect of different concentrations of GOQDs on the specificity of fluorescent quantitative PCR products.
FIG. 3 shows the detection of the sensitivity of the fluorescent quantitative PCR method with the addition of GOQDs.
Detailed Description
The reagents and equipment used in the embodiments of the invention are all known products and are obtained by purchasing commercially available products.
Example 1 GOQDs improvement of TaqMan Probe method real-time fluorescence quantitative PCR product specificity
1. Method of
Experimental reagents and materials:
primer 1:5'-CTGCTTCGGCAGCACA-3' (SEQ ID NO. 1), 10. Mu.M;
primer 2:5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO. 2), 10. Mu.M;
and (3) probe: 5'-6-FAM-CCATGCTAATCTTCTCTGTATCGTTCCA-BHQ1-3' (SEQ ID NO. 3), 10. Mu.M;
a DNA template: the PCR amplified DNA template is U6 plasmid, and the sequence of U6 is: 5'-GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT-3' (SEQ ID NO. 4) at a concentration of 10 7 copies/μl。
GOQDs group: GOQDs aqueous solution (5.3. Mu.g/ml), sonicated for 30min at room temperature before use, 0.5. Mu.l mixed with primers (containing 0.5. Mu.l each of primers 1 and 2, 10. Mu.M each before mixing) in PCR tubes and incubated for 30min at 35 ℃.
Control group: the PCR tube was added with 0.5. Mu.l of each of primer 1 and primer 2, and incubated at 35℃for 30min.
qRT-PCR system: the PCR tubes of the GOQDs group and the control group were supplemented with: 2 XProbe mix 12.5. Mu.l, DNA template 1. Mu.l, probe 0.5. Mu.l, and sterile water was added to make up the volume to 25. Mu.l.
qRT-PCR conditions: (1) pre-denaturation at 94℃for 30s, (2) denaturation at 94℃for 5s, (3) annealing at 60℃for 30s, steps (2) to (3) were repeated for 40 cycles.
And (3) detecting the amplified DNA product by agarose gel electrophoresis.
2. Results
The real-time fluorescent quantitative PCR results and the electrophoresis results are shown in FIG. 1.
The fluorescence quantitative PCR result shows that the Ct value of the GOQDs group is equivalent to that of the control group, and the amplification efficiency is equivalent; the fluorescence signal intensity of GOQDs group has small attenuation, but does not influence detection.
The electrophoresis result shows that the GOQDs group has single amplified band, which indicates that the nonspecific amplified product is not generated and the specificity is higher than that of the control group.
3. Conclusion(s)
GOQDs can improve the specificity of fluorescent quantitative PCR.
Example 2 real-time fluorescent quantitative PCR of GOQDs at different concentrations
1. Method of
The first step: and preparing an aqueous solution of graphene oxide quantum dots.
The graphene oxide aqueous solution is synthesized by an improved Fenton method. The method comprises the following specific steps:
(1) Preparation of a mixture containing purple manganese-intercalated graphite 0.5g of graphite was placed in 20-25ml of concentrated H at room temperature 2 SO 4 In the presence of 0.5g NaNO 3 In addition, KMnO 4 Adding 70-75ml of concentrated H 2 SO 4 And 0.5g NaNO was added 3 Formation of MnO 3 + (Mn0 3 + The concentration of (2) is 0.03-0.06 g/ml), and 4ml MnO is taken every 18-22 minutes 3 + (70-75 ml in total) is added into a mixed system of graphite, concentrated sulfuric acid and sodium nitrate to prepare the manganese-embedded graphite.
(2) And (3) placing the mixture solution containing the purple manganese-embedded graphite in a dark environment at room temperature for sealing and storing, and waiting for natural sedimentation of the manganese-embedded graphite.
(3) Taking the settled manganese-embedded graphite, properly reversing and uniformly mixing, taking 10g of the uniformly mixed manganese-embedded graphite, adding 500-1200ml of hydrogen peroxide (30% w/w) and 1-2g of zero-valent iron, and continuously boiling for 6min.
(4) And (3) dialyzing the product (pH2.0, 1000 Da) in the step (3) in deionized water for 7 days to obtain a pure graphene oxide quantum dot aqueous solution.
And a second step of: concentration optimization
Experimental group: the graphene oxide quantum dot solution (1.5-11. Mu.g/ml) was sonicated for 30min at normal temperature before use, 0.5. Mu.l of the mixture was mixed with the primers (containing 0.5. Mu.l of each of primers 1 and 2, 10. Mu.M before mixing) in a PCR tube, and incubated for 30min at 35 ℃.
Control group: the PCR tube was added with 0.5. Mu.l of each of primer 1 and primer 2, and incubated at 35℃for 30min.
qRT-PCR system: the PCR tubes of the GOQDs group and the control group were supplemented with: 2 XProbe mix 12.5. Mu.l, DNA template 1. Mu.l, probe 0.5. Mu.l, and sterile water was added to make up the volume to 25. Mu.l (probe, primer, template, sequence of template, concentration as in example 1).
qRT-PCR conditions: (1) pre-denaturation at 94℃for 30s, (2) denaturation at 94℃for 5s, (3) annealing at 60℃for 30s, steps (2) to (3) were repeated for 40 cycles.
And a third step of: programming DNA amplification on a real-time fluorescent quantitative PCR instrument
The PCR conditions and the various procedures can be carried out in a conventional manner. Reagents and materials used in PCR are commercially available or can be prepared by conventional methods. The fluorescent quantitative PCR instrument in this example is a YerqTower2.2 fluorescent quantitative PCR instrument in Germany.
2. Results
The results of fluorescent quantitative PCR and the results of electrophoresis are shown in FIG. 2.
The electrophoresis result shows that the amplified bands of the GOQDs with the concentration of 5.3-11 mug/ml have the best specificity and the target bands are brightest; too high a concentration of GOQDs (26. Mu.g/ml) can lead to amplification failure.
The fluorescence quantitative PCR result shows that the Ct value of the fluorescence quantitative detection is hardly influenced by the concentration of GOQDs; the fluorescence intensity is less affected, and the fluorescence signal corresponding to the concentration can be detected except that the excessively high GOQDs concentration (26. Mu.g/ml) can cause the amplification failure.
It is also notable that the fluorescence intensity does not decrease with increasing concentrations of GOQDs, but increases and then decreases with increasing concentrations of GOQDs, the fluorescence signal being the strongest in the 5.3 μg/ml group among the several groups referred to in this example.
Example 3 accuracy test of fluorescent quantitative PCR method with GOQDs added
1. Method of
Experimental reagents and materials:
the sequences and concentrations of the probes and primers were the same as in example 1.
A DNA template: the PCR amplified DNA template is U6 plasmid, and the sequence of U6 is: 5'-GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT-3', concentration of 10 10 ～10 1 copies/μl。
GOQDs group: GOQDs aqueous solution (5.3. Mu.g/ml), sonicated for 30min at room temperature before use, 0.5. Mu.l mixed with primers (containing 0.5. Mu.l each of primers 1 and 2, 10. Mu.M each before mixing) in PCR tubes and incubated for 30min at 35 ℃.
Control group: the PCR tube was added with 0.5. Mu.l of each of primer 1 and primer 2, and incubated at 35℃for 30min.
qRT-PCR system: the PCR tubes of the GOQDs group and the control group were supplemented with: 2 XProbe mix 12.5. Mu.l, DNA template 1. Mu.l, probe 0.5. Mu.l, and sterile water was added to make up the volume to 25. Mu.l.
qRT-PCR conditions: (1) pre-denaturation at 94℃for 30s, (2) denaturation at 94℃for 5s, (3) annealing at 60℃for 30s, steps (2) to (3) were repeated for 40 cycles.
2. Results
The real-time fluorescent quantitative PCR results and the electrophoresis results are shown in FIG. 3.
The real-time fluorescent quantitative PCR method with the addition of GOQDs shows that when in detection: at 10 4 -10 10 In the range of copies/. Mu.l, ct value is linearly related to the logarithm of the initial template copy number, and the coefficient is determined as 0.9983.
The results of this example illustrate: the invention is characterized in that the concentration of the template is low (10 4 The detection of the fluorescence quantitative PCR detection in the field under the lower limit of detection under the premise of ensuring the accuracy) is still very accurate.
In summary, the method of the invention can remarkably improve the specificity of fluorescent quantitative PCR without affecting the sensitivity of the PCR, and can detect DNA in a wider DNA copy number range, and the detection range spans 7 orders of magnitude.
SEQUENCE LISTING
<110> university of adult Chinese medicine
<120> a method for improving the specificity of real-time fluorescent quantitative PCR
<130> GY041-2019P018619CC
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 16
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
ctgcttcggc agcaca 16
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
aacgcttcac gaatttgcgt 20
<210> 3
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
ccatgctaat cttctctgta tcgttcca 28
<210> 4
<211> 106
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
gtgctcgctt cggcagcaca tatactaaaa ttggaacgat acagagaaga ttagcatggc 60
ccctgcgcaa ggatgacacg caaattcgtg aagcgttcca tatttt 106
Claims (12)
1. A method for optimizing real-time fluorescent quantitative PCR, characterized by: preprocessing a primer by using graphene oxide quantum dots, preparing a real-time fluorescent quantitative PCR reaction system, and performing real-time fluorescent quantitative PCR, wherein the real-time fluorescent quantitative PCR is a TaqMan probe method;
mixing graphene oxide quantum dots with a primer, and incubating for 30+/-5 min at 15-35 ℃; before the graphene oxide quantum dots are mixed with the primer, the graphene oxide quantum dots are subjected to ultrasonic treatment for 30min; the dosage ratio of the graphene oxide quantum dots to the forward primer or the reverse primer is 5.3-11 mug: 0.01 mu mol, and the concentration of the graphene oxide quantum dots is 5.3-11 mu g/ml; the preparation method of the graphene oxide quantum dot comprises the following steps:
1) Placing 1 part by weight of graphite in 40-50 parts by volume of concentrated H 2 SO 4 Adding 0.8-1.2 parts by weight of NaNO 3 Obtaining a system A;
2) MnO is added to 3 + Adding the mixture into the system A in batches, wherein the single addition amount is according to MnO 3 + Adding 3.5-4.0 parts by weight of MnO in an amount of not more than 0.15 parts by weight 3 + Obtaining manganese-embedded graphite through reaction;
3) Adding water into manganese-embedded graphite to prepare suspension, adding 500-1200mL of 30% hydrogen peroxide and 1-2g of zero-valent iron into each 10g of manganese-embedded graphite, and continuously boiling for 6min;
4) Dialyzing the product in the step 3) in deionized water for 7 days to obtain graphene oxide quantum dot aqueous solution;
when the volume part is mL, the weight part is g.
2. The method of claim 1, wherein: the temperature is 35 ℃, and/or the incubation time is 30min.
3. A method according to claim 1 or 2, characterized in that: the dosage ratio of graphene oxide quantum dots to forward primer or reverse primer was 5.3 μg: 0.01. Mu. Mol.
4. The method of claim 1, wherein: concentrated H in step 1) 2 SO 4 44-48 parts by volume, and/or NaNO 3 0.9 to 1.1 parts by weight.
5. The method of claim 1, wherein: mnO in step 2) of preparation method of graphene oxide quantum dots 3 + The preparation method of the solution comprises the following steps:
5-10 parts by weight of KMnO 4 Adding 140-150 parts by volume of concentrated H 2 SO 4 And 1 part by weight of NaNO is added 3 Formation of MnO 3 + 。
6. The method of claim 5, wherein: mnO in step 2) of preparation method of graphene oxide quantum dots 3 + The preparation method of the solution comprises the following steps:
5-6 parts by weight of KMnO 4 Adding 144-148 parts by volume of concentrated H 2 SO 4 And 1 part by weight of NaNO is added 3 Formation of MnO 3 + 。
7. The application of the graphene oxide quantum dots in improving the specificity of the real-time fluorescence quantitative PCR is characterized in that the graphene oxide quantum dots are used for preprocessing a primer to prepare a real-time fluorescence quantitative PCR reaction system, and the real-time fluorescence quantitative PCR is performed, wherein the real-time fluorescence quantitative PCR is a TaqMan probe method; mixing graphene oxide quantum dots with a primer, and incubating for 30+/-5 min at 15-35 ℃; before the graphene oxide quantum dots are mixed with the primer, the graphene oxide quantum dots are subjected to ultrasonic treatment for 30min; the dosage ratio of the graphene oxide quantum dots to the forward primer or the reverse primer is 5.3-11 mug: 0.01 mu mol, and the concentration of the graphene oxide quantum dots is 5.3-11 mu g/ml; the preparation method of the graphene oxide quantum dot comprises the following steps:
1) Placing 1 part by weight of graphite in 40-50 parts by volume of concentrated H 2 SO 4 Adding 0.8-1.2 parts by weight of NaNO 3 Obtaining a system A;
2) MnO is added to 3 + Adding the mixture into the system A in batches, wherein the single addition amount is according to MnO 3 + Adding 3.5-4.0 parts by weight of MnO in an amount of not more than 0.15 parts by weight 3 + Obtaining manganese-embedded graphite through reaction;
3) Adding water into manganese-embedded graphite to prepare suspension, adding 500-1200mL of 30% hydrogen peroxide and 1-2g of zero-valent iron into each 10g of manganese-embedded graphite, and continuously boiling for 6min;
4) Dialyzing the product in the step 3) in deionized water for 7 days to obtain graphene oxide quantum dot aqueous solution;
when the volume part is mL, the weight part is g.
8. The use according to claim 7, wherein: the temperature is 35 ℃, and/or the incubation time is 30min.
9. Use according to claim 7 or 8, characterized in that: the dosage ratio of graphene oxide quantum dots to forward primer or reverse primer was 5.3 μg: 0.01. Mu. Mol.
10. The use according to claim 7, wherein: concentrated H in step 1) 2 SO 4 44-48 parts by volume, and/or NaNO 3 0.9 to 1.1 parts by weight.
11. The use according to claim 7, wherein: mnO in step 2) of preparation method of graphene oxide quantum dots 3 + The preparation method of the solution comprises the following steps:
5-10 parts by weight of KMnO 4 Adding 140-150 parts by volume of concentrated H 2 SO 4 And 1 part by weight of NaNO is added 3 Formation of MnO 3 + 。
12. The use according to claim 11, wherein: mnO in step 2) of preparation method of graphene oxide quantum dots 3 + The preparation method of the solution comprises the following steps:
5-6 parts by weight of KMnO 4 Adding 144-148 parts by volume of concentrated H 2 SO 4 And 1 part by weight of NaNO is added 3 Formation of MnO 3 + 。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010094899.3A CN113265451B (en) | 2020-02-14 | 2020-02-14 | Method for improving real-time fluorescence quantitative PCR specificity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010094899.3A CN113265451B (en) | 2020-02-14 | 2020-02-14 | Method for improving real-time fluorescence quantitative PCR specificity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113265451A CN113265451A (en) | 2021-08-17 |
| CN113265451B true CN113265451B (en) | 2023-08-29 |
Family
ID=77227442
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010094899.3A Active CN113265451B (en) | 2020-02-14 | 2020-02-14 | Method for improving real-time fluorescence quantitative PCR specificity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113265451B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355300B (en) * | 2018-11-26 | 2022-01-28 | 成都中医药大学 | Application of coptis SDAR transcription factor in improving drought resistance of plants |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773757A (en) * | 2014-01-23 | 2014-05-07 | 华东理工大学 | Method for optimizing polymerase chain reaction (PCR) by using graphene quantum dots |
| KR20140146349A (en) * | 2013-06-17 | 2014-12-26 | 한국과학기술원 | Sensor and method for sensing metal ion based on graphene |
| KR20160075955A (en) * | 2014-12-19 | 2016-06-30 | 중앙대학교 산학협력단 | PCR Composition Containing Graphene Oxide Coated by Au Nanoparticles and Method for PCR Using The Same |
| CN107381551A (en) * | 2016-08-18 | 2017-11-24 | 成都中医药大学 | A kind of embedding manganese graphene and preparation method and application |
-
2020
- 2020-02-14 CN CN202010094899.3A patent/CN113265451B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20140146349A (en) * | 2013-06-17 | 2014-12-26 | 한국과학기술원 | Sensor and method for sensing metal ion based on graphene |
| CN103773757A (en) * | 2014-01-23 | 2014-05-07 | 华东理工大学 | Method for optimizing polymerase chain reaction (PCR) by using graphene quantum dots |
| KR20160075955A (en) * | 2014-12-19 | 2016-06-30 | 중앙대학교 산학협력단 | PCR Composition Containing Graphene Oxide Coated by Au Nanoparticles and Method for PCR Using The Same |
| CN107381551A (en) * | 2016-08-18 | 2017-11-24 | 成都中医药大学 | A kind of embedding manganese graphene and preparation method and application |
Non-Patent Citations (1)
| Title |
|---|
| 氧化石墨烯对聚合酶链式反应扩增效率、灵敏度和特异性的影响;蒋城等;《环境化学》;20170430;第36卷(第4期);摘要，第1.3节，第1.4节，第2.5节，图5，第3节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113265451A (en) | 2021-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters | |
| WO2021114914A1 (en) | Bismuthene nanosheet fluorescence quenching based biosensor, and mirna detection kit and use thereof | |
| CN110146566A (en) | Modified electrode, combination product and its electroluminescent chemiluminescence biosensor and application | |
| CN113549449B (en) | Nano fluorescent probe, preparation method and application thereof | |
| CN113265448A (en) | Method for improving sensitivity and specificity of real-time fluorescence PCR (polymerase chain reaction) based on graphene oxide | |
| CN112626209A (en) | miRNA marker for ovarian cancer diagnosis, application thereof and diagnosis kit | |
| CN113265451B (en) | Method for improving real-time fluorescence quantitative PCR specificity | |
| CN111175268A (en) | Fluorescent sensor for detecting dual signal amplification of mercury ions and preparation method thereof | |
| CN107064515A (en) | A kind of copper ion detection method and detection kit based on click chemistry | |
| Wang et al. | Sensitive electrochemical detection of oxytetracycline based on target triggered CHA and poly adenine assisted probe immobilization | |
| CN113913561B (en) | SARS-CoV-2 delta variant strain detection method based on primer design and copper nano cluster | |
| Jiang et al. | Development of a cyclic voltammetry method for DNA electrochemical detection on microfluidic gene chip | |
| CN108414596B (en) | Microelectrode biosensor and application thereof in detecting telomerase | |
| CN110628950B (en) | Primer combination, kit and PSR method for detecting EV71 virus | |
| Chen et al. | A cancer cell membrane vesicle-packaged DNA nanomachine for intracellular microRNA imaging | |
| Feng et al. | Construction of aptasensors for sensitive detection of 8-OH-dG based on a diffusion mediated electrochemiluminescence quenching effect | |
| CN114395613B (en) | Method for detecting activity of capping enzyme of vaccinia virus | |
| CN113549692B (en) | Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction | |
| CN115851882A (en) | Method for miRNA detection based on CRISPR/Cas12a driven controlled-release homogeneous system | |
| CN110129043B (en) | Preparation method of carbon quantum dots and kit and method for detecting nucleic acid | |
| CN113106156A (en) | IDH1R132H gene mutation real-time fluorescence quantitative PCR detection reagent and method | |
| Song et al. | Trace miRNA Assay Based on DNA Nanostructures Formed by Hybridization Chain Reaction and Gold‐Nanoparticle Tags | |
| CN110819717A (en) | Graphene oxide-containing amplification system and application thereof in colorectal cancer marker detection | |
| Zhang et al. | Preparation of Novel Cystine-multiwalled Carbon Nanotubes-graphene Oxide-glassy Carbon Electrode and Electrochemical Detection of Riboflavin and Dopamine. | |
| CN113341128A (en) | Biosensor for detecting tobramycin and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |