CN113249403B - Breeding method of sweet potato with SPVD resistance - Google Patents
Breeding method of sweet potato with SPVD resistance Download PDFInfo
- Publication number
- CN113249403B CN113249403B CN202110346271.2A CN202110346271A CN113249403B CN 113249403 B CN113249403 B CN 113249403B CN 202110346271 A CN202110346271 A CN 202110346271A CN 113249403 B CN113249403 B CN 113249403B
- Authority
- CN
- China
- Prior art keywords
- sweet potato
- spvd
- resistance
- transgenic
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the field of biotechnology and plant protection, and particularly relates to a breeding method of sweet potatoes with SPVD resistance. The application provides a breeding method for cultivating SPVD resistant sweet potatoes by a submitted construction method, wherein a corresponding CRISPR/Cas13 vector is constructed based on the method, and the sweet potato callus is infected and induced to differentiate by utilizing an agrobacterium strain EHA105, so that a transgenic sweet potato strain with SPVD resistance is obtained, and the resistance of the transgenic sweet potato is systematically verified by methods of material mixed seed, virus source grafting experiments, toxic insect infection and the like. Experimental results show that the method can be used for creating transgenic sweet potatoes with SPVD sweet potato compound virus disease resistance, and the technology can also be used for creating novel germplasm with SPVD resistance for other varieties and types of cultivated species of sweet potatoes.
Description
Technical Field
The invention belongs to the fields of molecular biology and plant breeding, and particularly relates to a breeding method for a new transgenic sweet potato variety with sweet potato compound virus disease (SPVD) resistance by utilizing molecular biology technology to carry out sweet potato molecular breeding.
Background
Sweet potato virus disease is the most serious disease faced by the sweet potato industry. In recent years, the outbreak of the virus diseases of the sweet potato in the whole country or even the world causes great yield reduction of the sweet potato and economic loss which is difficult to measure, and seriously influences and restricts the development of the sweet potato industry in China or even the world. SPV D is caused by co-infection with two RNA viruses, sweet potato chlorotic dwarf virus (Sweet potato chlorotic stunt virus, SPCSV) of the genus chaetomium (Crin ivirus) and sweet potato pinnate virus (Sweet potato feathery mottle virus, SPFMV) of the genus Potyvirus (Potyvirus). SPVD is one of the most serious diseases of sweet potatoes, and can cause 50% -98% yield reduction and even harvest failure of sweet potatoes, so that the SPVD is a main problem of sweet potato industry in the global scope. The method is characterized in that when two viruses (SPFMV/SPCSV) are independently infected with sweet potato, the disease phenotype of the plant is not obvious or only slight symptoms occur, and when the SPFMV and the SPCSV are infected with the sweet potato together, obvious virus synergistic effect is generated, so that the sweet potato plant shows serious symptoms such as leaf distortion, deformity, chlorosis, vein brightening, plant dwarfing and the like; in the case of viral replication, SPFMV virus copy number increases rapidly during the severe phenotype of the plant caused by the co-infection, and changes in SPCSV virus copy number are not apparent or slightly reduced by about 600-fold compared to the copy number when sweetpotato is infected alone. In this process SPFMV is a distinct beneficiary, and SPCSV functions as a "helper" in contrast to the known vast majority of viral co-production phenomena involving potato virus Y.
SPCSV-RNase3 is a key cause of sweet potato complex virus disease (SPVD) pathogenesis. In addition to the synergistic effect of SPCSV and SPFMV, SPCSV can also generate synergistic effect with various viruses which naturally infect sweet potato, such as Cucumber Mosaic Virus (CMV), sweet potato light mottle mosaic virus (SPMMV) and the like, which cause serious virus symptoms and yield loss of sweet potato. Therefore, this SPCSV-mediated viral co-production is a key factor in the occurrence of serious conditions and yield loss in sweet potato by SPVD. SPCSV-RNase3 is a type III RNA endonuclease (RNase 3) encoded in the SPCSV genome, which is homologous to Arabidopsis and rice Class 1RNA III and has dsRNA-specific endonuclease activity. Cuellar et al found that after infection of RNase3 transgenic sweetpotato with various RNA viruses including SPFMV, the virus accumulation was significantly increased compared to that of wild-type sweetpotato, and exhibited more serious sweetpotato symptoms. This is very similar to the synergistic effect of the virus caused by the natural co-infection of SPFMV or other viruses with SPCSV. Experimental results show that the key mechanism of the SPCSV mediated viral synergistic effect is that RNase3 inhibits host RNA silencing mechanism, so that the virus eliminating capacity of sweet potato is lost or obviously reduced, thereby causing excessive accumulation of SPFMV or other viruses in cells and finally causing serious diseases. SPCSV-P22 is a silencing inhibitor from SPCSV virus, where SPCSV-P22 is found only in a fraction of SPCSV isolates and experimental results demonstrate that while SPCSV-P22 also has the ability to inhibit post-transcriptional silencing, P22 acts primarily to enhance the ability of SPCSV-RNase3 to inhibit post-transcriptional silencing (PTGS) of sweet potato during the onset of SPVD, suggesting that SPCSV-P22 is also not a direct cause of SPVD virus disease. Thus, RNase3 is a key factor in SPCSV-mediated viral co-production and SPVD pathogenesis.
Technical means for effectively preventing and treating the sweet potato compound virus disease SPVD are not available. SPVD causes great economic loss on the planting and production of sweet potatoes, and is a great problem which needs to be solved urgently in the whole sweet potato industry. However, due to the high difficulty and slow progress of SPVD virus disease research, no efficient control means and obviously resistant cultivated germplasm resources have been found so far, and the lack of resistant resources directly limits the breeding process of SPVD resistant sweet potato materials.
The conventional biotechnology breeding is used for improving SPVD resistance of sweet potatoes, the conventional biotechnology breeding is dependent on a method for inducing and activating an RNA silencing system of the sweet potato plants by using exogenous virus fragments, viruses in the plants are accumulated year by year after the sweet potatoes are infected with the SPVD due to propagation of potato blocks and asexual propagation of cuttage, and a series of silencing suppressors coded by the viruses can inhibit the activated RNA silencing system to cause final burst of the SPVD, so that the SPVD resistant technology based on plant RNAi mechanism is not suitable for inhibiting RNase 3-mediated virus synergistic effect, and cannot fundamentally improve the SPVD resistance of the sweet potatoes.
At present, no suitable germplasm resource and technical means are available for SPVD resistance genetic improvement. Therefore, the development of a novel technique for inhibiting RNase 3-mediated viral co-production and for improving SPVD resistance inheritance is urgent.
Disclosure of Invention
The invention designs a molecular breeding scheme for improving virus resistance of cultivar sweet potato to sweet potato complex virus disease (SPVD) by utilizing specific sequences of RfxCas13d (CRISPR-Cas 13 variant) and targeted SPCSV-RNase 3. The content of the method is as follows: the stable genetic transformation vector of the sweet potato targeting the SPCSV-RNase3 is designed and constructed based on the nucleic acid sequences of the RfxCas13d protein and the targeting virus core protein SPCSV-RNase3, and the genetic transformation is carried out on the sweet potato 29 by an embryogenic callus transformation method, so that a positive transformation strain is successfully obtained. Different verification methods such as insect-mediated inoculation virus and culture room grafting inoculation virus under natural culture conditions and greenhouse environment prove that the RfxCas13d positive sweet potato transformed plant of the targeted SPCSV-RNase3 remarkably inhibits the replication of the key virus SPFMV in the SPVD disease process under the same virus infection condition, thereby realizing the prevention and treatment of the sweet potato SPVD virus disease, and the invention creates the transgenic sweet potato with the sweet potato SPVD resistance.
The specific technical scheme is as follows:
a breeding method of sweet potato with SPVD resistance, comprising the following steps:
(1) Obtaining a plant expression vector of the transgenic sweet potato, and inserting an RfxCas13d sequence and a target sequence corresponding to the targeted SPCSV-RNase3 into a conventional ternary plant expression vector pCambia 1380;
(2) Carrying out transformation of agrobacterium strain EHA105 on the vector constructed in the step (1) by a chemical method;
(3) Sorting and propagating the transgenic positive sweet potatoes obtained by the transformation in the step (2);
(4) Identifying the virus resistance of the obtained transgenic sweet potato;
wherein, the expression frame for expressing HYG (hygromycin) is constructed in the conventional ternary plant expression vector pCambia1380 vector in advance for screening transgenic positive plants and identifying the transgenic positive.
Further, the construction method in the step (1) comprises 2 sections of different sequence expression frames; the gene expression of the RfxCas13d protein was driven by using the pNbU4 promoter, and the Spacer expression targeting SPCSV-RNase3 was driven by using the pAtU6 promoter.
Furthermore, the construction method adopts a segmented cloning mode to construct the plant expression vector pCambia 1380.
Furthermore, the construction method comprises the steps of firstly using HindIII/EcoRI for pCambia1380 vector; cutting KpnI/BamHI restriction enzyme, and then respectively inserting a sequence expression frame containing RfxCas13d and an expression frame containing gRNA fragment; the gRNA comprises a Spacer and Poly T DNA fragment of a targeted SPCSV-RNase3 gene; the expression frame of the gRNA fragment uses pAtU6 promoter to drive expression; finally, carrying out vector cloning connection by utilizing a connection mode of homologous recombination to obtain a corresponding sweet potato expression vector for genetic transformation.
Further, the sequence expression frame containing RfxCas13d is subjected to codon preference optimization by using software OptimumGene and is synthesized for nucleic acid fragments; preferably, the preference optimization is performed by dicotyledonous plants.
Furthermore, the pAtU6 promoter adopts an optimized guide sequence for driving expression, and the nucleotide sequence of the guide sequence is shown as SEQ ID NO. 2.
Further, the step (2) includes the following steps:
adding the vector constructed in the step (1) into agrobacterium EHA105 competent cells, performing ice bath, liquid nitrogen freezing, heat shock, fungus shaking and plate coating, culturing for 48 hours in a 28-DEG incubator, and selecting monoclonal colonies identified as positive by PCR; the YEB liquid medium was used for overnight shaking, and the obtained agrobacterium liquid with concentration od600=0.6 was used for infecting the prepared sweet potato callus cells.
Further, the step (3) specifically comprises: and (3) transforming the HYG-resistant embryogenic callus obtained by the transformation in the step (2) (20 mg/LHYG) into a sweet potato differentiation medium MS, culturing for 60 days, and carrying out positive identification on the resistance of the obtained transgenic sweet potato plant by using a PCR identification method.
Furthermore, the step (4) adopts an insect vector transmission and grafting transmission mode to carry out resistance test. Experimental results show that compared with a control group, the transgenic sweet potato can effectively inhibit virus (SPFMV/SPCSV) accumulation caused by long-term (90 d) insect vector transmission and short-term grafting (15 d).
The beneficial effects are that:
the invention creatively develops a molecular breeding method for effectively creating sweet potatoes with resistance to Sweet Potato Virus Diseases (SPVD) by using a CRISPR Cas13 technology, and the method endows transgenic sweet potatoes with resistance to SPVD virus diseases by using the CRISPR Cas13 technology, effectively avoids the problem that the conventional RNAI technology cannot effectively inhibit virus replication due to silencing failure caused by virus silencing inhibitor. The application can effectively realize the resistance to the SPVD of the sweet potato composite virus disease, and experimental results show that the virus accumulation level of the transgenic sweet potato plant obtained by the method is far lower than that of a control group.
Drawings
FIG. 1 is a diagram of genetic transformation vector design, construction and molecular detection of sweet potato.
Fig. 2 is a schematic of CRISPR Cas13 control strategy for SPVD.
FIG. 3 shows a graph of resistance to SPVD virus disease of transformed control sweet potato NT and RNase 3-targeted RfxCas13d transformed sweet potato using natural propagation (insect vector) method,
infecting sweet potato callus by using agrobacterium tumefaciens and inducing differentiation;
phenotype of transformed transgenic sweetpotato NT, L1;
carrying out molecular detection on the transgenic sweet potato by utilizing PCR;
molecular detection is carried out on the RfxCas13d of the transgenic sweet potato by qRT-PCR;
protein accumulation levels of RfxCas13d of transgenic sweetpotato were detected using WB techniques.
FIG. 4 is a graph showing the resistance of transformed control sweet potato NT and RNase 3-targeted RfxCas13d transformed sweet potato to SPVD virus disease using an insect-borne transmission method, wherein,
A. verifying the resistance of the transformed control sweet potato NT and the RfxCas13d transformed sweet potato targeting RNas e3 to SPVD virus diseases by using an insect vector transmission mode in a natural environment;
B. and verifying the resistance of the transformed control sweet potato NT and the RNas e 3-targeted RfxCas13d transformed sweet potato to SPVD virus diseases by using an insect vector transmission mode in a greenhouse environment.
FIG. 5 shows a graph of resistance of transgenic sweetpotato NT and RNase 3-targeted RfxCas13 d-transformed sweetpotato to SPVD virus disease using grafting,
A. screening and detecting sweet potatoes severely infected by SPVD virus diseases as a virus source for subsequent grafting;
B. and (3) carrying out virus molecular detection on the grafted NT and 2 transgenic sweet potatoes targeting RNase3 RxCas13 d.
Detailed Description
The invention is further illustrated below in conjunction with specific examples. These examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out under conventional conditions or under conditions recommended by the manufacturer. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention. The preferred methods and materials described herein are presented for illustrative purposes only.
Example 1 plant expression vectors for obtaining transgenic sweetpotato
As shown in fig. 1 and 2, the present invention first uses a common plant expression vector pCambia1380 for vector design and transformation.
In order to obtain the plant recombinant vector for sweet potato genetic modification, sequences are obtained step by step according to the design: wherein the Rfx Cas13d sequence is referenced from the sequence disclosed on NC BI g en e bank network, and the preference of the sequence is optimized by utilizing codon optimization software (OptimumGene), and a design base scheme biased towards dicot codons is adopted; the pAtU6 promoter sequence is a conventional sequence, the gRNA sequence is a specific sequence, the design of the gRNA sequence conforms to the design requirement of RfxCas13d and is designed according to the sequence of SPCSV-RNase3-JS (the laboratory clone is obtained from a sweet potato sample from Xuzhou region), and the sequence S of the SPCSV-RNase3-J is shown as SEQ ID NO. 1. The development process of the recombinant vector is as follows:
the pCambia1380 vector was first cut with the restriction enzyme HindIII/BamHI as follows: to 200. Mu.L of the centrifuge tube, 20. Mu.L of the vector plasmid, 5. Mu.L of Buffer, 1. Mu.L of each endonuclease and 23. Mu.L of sterile water were added to form a 50. Mu.L reaction system, and incubated at 37℃for 1 hour. And (3) carrying out electrophoresis analysis on the enzyme digestion product by using 0.8% agarose gel, selecting bright and specific strips, purifying by using a gel recovery kit, and measuring the concentration to obtain the linearized skeleton carrier. Then cloning the promoter pNbU4 and the terminator tHSP of the fragment I by using primers pNbU4-1F/pNbU4-1R and tHSP-1F/tHSP-1R respectively; the promoters pAtU6 and terminator Poly T of fragment two were cloned using primers pAtU6-1F/pAtU6-1R and Poly T-1F/Poly T-1R, respectively. Cloning PCR conditions were
Fragments obtained from the clones were analyzed by electrophoresis using a 1% agarose gel, bright, specific bands were selected, purified using a gel recovery kit and the concentration was measured. The purified fragment was integrated into the plant expression vector pCambia1380 prepared by digestion in advance using the Norpran C113 multi-fragment homologous recombination kit, and the obtained ligation product was transformed into E.coli DH 5. Alpha. Competent cells, and the selection resistance was kanamycin (Kan) at a final concentration of 50mg/L. The plates are placed in a constant temperature incubator at 37 ℃ in an inverted mode, single colonies are selected for PCR detection after culturing for 8-10 hours, and positive clones with correct lengths are selected corresponding to the nucleic acid Marker. The correct monoclonal bacteria solution for PCR detection was pipetted into a centrifuge tube containing 2ml LB liquid medium (50 mg/L Kan) and placed into a shaker at 37℃for 12 hours at 200rpm. 100 mu L of turbid bacterial liquid is sucked and sent to Nanjing qing department biotechnology company for sequencing, the sequencing result is compared with a reference sequence, enzyme digestion verification is carried out on plasmids with correct sequences again, and the correct plasmids are named as intermediate vectors pCambia1380-mid.
Next, the intermediate vector pCambia1380-mid was digested with the restriction enzymes SacI/EcoRI in a similar manner to the above-mentioned digestion method of the backbone vector pCambia 1380. The primers RfxCas13d-1F/RfxCas13d-1R and the gRNA-1F/gRNA-1R were used to clone the fragment RfxCas13d with the synthesized gRNA under conditions consistent with the conditions for cloning the promoter fragment described above. The double-fragment homologous recombination kit of the nupraziram C112 is integrated into a plant expression intermediate vector pCambia1380-mid prepared by enzyme digestion in advance, and a correct plasmid, named p1380-RfxCas13d, is obtained by a similar method.
In the expression frame of pNbU4-RfxCas13d-tHSP, the pNbU4 promoter is a plant endogenous gene promoter cloned in the laboratory and verified to have high-efficiency exogenous gene expression efficiency, the specific sequence is shown in a patent document (the invention name is a rolling circle replication recombinant vector construction method for heterologous protein expression and application number 202010156017.1), and in order to obtain the optimal expression efficiency of RfxCas13d protein, host (sweet potato) optimization is carried out on codon preference of RfxCas13d, dicotyledonous plants are adopted, so that the expression efficiency reaches the theoretical optimal value;
for pAtU6-gRNA-Poly T, according to the gRNA design requirement of RfxCas13d (30 bp in length, about 40% -60% of GC40-60% of nucleic acid sequence is selected as a target, CAAGTA AACCCCTACCAACTGGTCGGGGTTTGAAAC is the sequence corresponding to short repeated sequence (DR)) aiming at RNase3, the nucleic acid sequence of RNase3 obtained by cloning is analyzed, and potential proper cleavage sites are selected, so that the designed specific sequences respectively target each core region of target RNase3, thus the silencing effect mediated by gRNA has better specificity and silencing efficiency, and the corresponding gRNA structure and guide sequence are as follows:
caagtaaacccctaccaactggtcggggtttgaaactagaatccaatctatgacgacttccgaa gac aagtaaacccctaccaactggtcggggtttgaaacaccagattgaaaaatcttcataaaatcttg caagtaaacc cctaccaactggtcggggtttgaaac as SEQ ID NO. 2
The 2 DNA fragments pNbU4-RfxCas13d-tHSP and pAtU6-gRNA-Poly T which are assembled are integrated into a plant expression vector pCambia1380 prepared by enzyme digestion in advance by means of homologous recombination, potential positive colonies are screened by Escherichia coli transformation and colony PCR is utilized, and positive plasmids are obtained. The specific construction method comprises the following steps: the two ligation fragments obtained by pre-purification were ligated with the digested and purified linearized backbone vector pCambia1380 using the nuprandial C113 three fragment homologous recombination kit. The ligation product obtained was transformed into E.coli DH 5. Alpha. Competent cells, and the resultant cells were selected for kanamycin (Kan) at a final concentration of 50mg/L. The plates are placed in a constant temperature incubator at 37 ℃ in an inverted mode, single colonies are selected for PCR detection after culturing for 8-10 hours, and positive clones with correct lengths are selected corresponding to the nucleic acid Marker. The correct monoclonal bacteria solution for PCR detection was pipetted into a centrifuge tube containing 2ml LB liquid medium (50 mg/L Kan) and placed into a shaker at 37℃for 12 hours at 200rpm. 100 mu L of turbid bacterial liquid is sucked and sent to Nanjing qing department biotechnology company for sequencing, the sequencing result is compared with a reference sequence, and enzyme digestion verification is carried out on plasmids with correct sequences.
Example 2 agrobacterium competent EHA105 was transformed by chemical transformation and infects the pre-prepared sweet potato 29 embryogenic callus.
EHA105 agrobacterium competent transformation was performed as follows:
freezing and preserving agrobacterium tumefaciens competence at-80 ℃ to carry out ice bath;
after the competent cells were thawed, split into 33. Mu.L per tube, 0.1. Mu.g plasmid DNA was added per 33. Mu.L competent, and gently sucked with a gun tip to mix competent and plasmid DNA;
sequentially carrying out the following operations on the sample in the step (2): ice bath for 5min, liquid nitrogen flash for 5min, incubation at 37 ℃ for 5min, ice bath for 5min;
600. Mu.L of sterile antibiotic-free LB liquid is added, and the mixture is incubated for 3 hours by a constant temperature shaking table 220rmp at 28 ℃;
after centrifugation at 6000rpm for 2min, 50. Mu.L of the bacterial liquid was left, the bacterial plaque and the bacterial liquid were blown off with a gun head and applied to a YEB solid plate containing 50mg/mL Kan and 20mg/mL Rif. Culturing in an incubator at 28 ℃ for 60 hours. The obtained single colony of corresponding agrobacterium is slightly shaken and propagated by using YEB culture medium
After infection is completed, positive calli (R: HYG) obtained through screening are placed on a differentiation medium for induced differentiation, and the specific flow of the operation is as follows:
healthy sweet potato plants are selected, stem tips are stripped after disinfection, and embryogenic callus is induced. After propagation, the sweet potato embryogenic suspension cell mass is prepared. And selecting the embryogenic cell mass after the subculture as a genetic transformation receptor. Suspending in the prepared agrobacterium tumefaciens bacterial solution, culturing in dark environment for 3D, transferring to a solid culture medium containing Hyg, carb and 2,4-D, and selectively culturing. Transferring the surviving and mature somatic embryos to M S solid medium to induce the production of complete regenerated transgenic plants
And taking out partial tissue samples of the tissue-cultured regenerated sweet potato seedlings, carrying out DNA extraction, carrying out PCR identification on the obtained strain DNA by using a transformation detection primer, hardening seedlings of the transgenic sweet potato with positive PCR identification, transferring the transgenic sweet potato into a matrix for culture, extracting RNA for a period of time for reverse transcription, identifying relative expression levels of RfxCas13d of different positive strains by using qRT-PCR primers, screening out three transgenic sweet potatoes with relatively consistent expression levels from the transgenic sweet potato, carrying out seed conservation and propagation and being used for subsequent experiments.
Example 3 verification of resistance of transformed control sweet Potato NT and RNase 3-targeted RfxCas13d transformed sweet Potato to SPVD Virus disease Using Natural propagation (insect vector)
The agrobacterium tumefaciens bacteria liquid with the target gene is inoculated and cultured in LB liquid culture medium containing Kan and Rif. After centrifugation, the mixture was resuspended in MS liquid medium containing 2,4-D for further use.
Healthy sweet potato plants are selected, stem tips are stripped after disinfection, and embryogenic callus is induced. After propagation, the sweet potato embryogenic suspension cell mass is prepared. And selecting the embryogenic cell mass after the subculture as a genetic transformation receptor. Suspending in the prepared agrobacterium tumefaciens bacterial solution, culturing in dark environment for 3D, transferring to a solid culture medium containing Hyg, carb and 2,4-D, and selectively culturing. The surviving and mature somatic embryos are transferred to MS solid medium and induced to produce whole regenerated transgenic plants.
And taking out partial tissue samples of the tissue-cultured regenerated sweet potato seedlings, carrying out DNA extraction, carrying out PCR identification on the obtained strain DNA by using a transformation detection primer, hardening seedlings of the transgenic sweet potato with positive PCR identification, transferring the transgenic sweet potato into a matrix for culture, extracting RNA for a period of time for reverse transcription, identifying relative expression levels of RfxCas13d of different positive strains by using qRT-PCR primers, screening out three transgenic sweet potatoes with relatively consistent expression levels from the transgenic sweet potato, carrying out seed conservation and propagation and being used for subsequent experiments.
And (3) respectively infecting the callus cells of the slow potatoes 29 with the agrobacterium tumefaciens bacteria liquid according to a transformation flow of the callus cells of the sweet potatoes, and operating according to a screening flow, a positive callus regeneration flow and the like. At present, 1380-NLS RfxCas13d-EV (NT) and 1380-NLS RfxCas13d-pre gRNA RNase3 (S2) transgenic sweet potato plants which are identified as positive are obtained, and the PCR technology is utilized to identify the DNA of the transgenic sweet potato, so that 4 positive plants are respectively obtained. Hardening off the seedlings of the transgenic sweet potato positive plants, and respectively transferring the seedlings into a matrix for propagation and proliferation. After a period of culture, sample RNA is extracted and qRT-PCR identification is carried out, and 3 independent strains with more consistent RfxCas13d mRNA expression level are selected from the sample RNA for subsequent experiments. Experimental results show that the expression level of RfxCas13d mRNA of transgenic sweet potatoes transformed into 1380-NLS RfxCas13d-EV and 1380-NLS RfxCas13d-pre gRNA RNase3 is about 15% of IbUBI. As shown in FIG. 3, wherein, A. The callus of sweet potato is infected with Agrobacterium and differentiation is induced; B. phenotype of transformed transgenic sweetpotato NT, L1; C. carrying out molecular detection on the transgenic sweet potato by utilizing PCR; D. molecular detection is carried out on the RfxCas13d of the transgenic sweet potato by qRT-PCR; E. protein accumulation levels of RfxCas13d of transgenic sweetpotato were detected using WB techniques.
Example 4 confirmation of resistance of transformed control sweet Potato NT and RNase 3-targeted RfxCas13d transformed sweet Potato to SPVD Virus disease Using insect-borne propagation
RNA and DNA are extracted from sweet potato plants which are collected from a sweet potato field nearby Xuzhou and are obvious in SPVD symptoms, and samples to be detected are identified respectively. The screened virus-carrying plants infected with only SPVD 2 viruses (SPFMV/SPCSV) are reserved for propagation and used for subsequent experiments. The sweet potato with the disease and the transgenic positive plants S1 and S2 infected by SPVD 2 viruses and the slow potato 29 detoxified seedling plant are planted in a closed space with insect vector (aphid and bemisia tabaci) for spreading, the insect vector is not controlled, the virus infection and spreading are carried out on the transgenic sweet potato and the wild sweet potato by using the natural infection spreading mode of the insect vector, the virus content in the material is quantitatively detected and the SPVD resistance of the transgenic plant is analyzed after a period of time (60 d), and the experimental biology is repeated to 6 groups.
The SPVD resistance verification is carried out on the sweet potatoes with the toxicity and the transgenic sweet potatoes by adopting a method of insect-mediated natural infection, and experimental results show that after a period of time (90 days) of mixed planting, the leaves of the wild type sweet potatoes are slightly yellow, the leaves of the transgenic sweet potatoes are not obviously changed in phenotype, the virus accumulation levels of the three plants are identified by using qRT-PCR technology, and the experimental results show that the relative expression level of 2 viruses (SPFMV/SPCSV) in the wild type sweet potatoes 29 cells is higher, and the relative expression level of the viruses of SPFMV and SPCSV in the leaf cells of the transgenic Rfx-pre-RNase3 sweet potatoes is extremely low and far lower than the virus accumulation level of the wild type sweet potatoes 29. The same method is utilized to identify the resistance of the genetically transformed plasmids RfxCas13d-EV (NT) and RfxCas13d-Pre-RNase3 to SPVD in a greenhouse environment, and experimental results show that after a period of time (60 d) of mixed seed, the virus content in cells of the RfxCas13d-EV (NT) and the RfxCas13d-Pre-RNase3 transgenic sweet potato leaves is obviously changed, wherein the expression level of SPFMV-CP and SPCSV-RNase3 in the cells of the RfxCas13d-EV (NT) transgenic sweet potato leaves is obviously higher than that of the RfxCas13d-Pre-RNase3 transgenic sweet potato. FIG. 4, wherein A. Screening and detecting sweet potato severely infected with SPVD virus disease as a source for subsequent grafting; B. and (3) carrying out virus molecular detection on the grafted NT and 2 transgenic sweet potatoes targeting RNase3 RxCas13 d.
Example 5 verification of resistance of transgenic sweetpotato NT and RNase 3-targeted RfxCas13 d-transformed sweetpotato to SPVD virus disease Using grafting
The obtained sweet potato with disease and infected by SPVD virus is used for grafting verification experiment after long-term seed preservation (90 days) until single plant of the seed preservation material grows and propagates to have a plurality of thicker vines: grafting the disease-bearing material as a stock, and grafting and transforming 1380-NLS RfxCas13d-EV and 1380-NLS RfxCas13d-pre gRNA RNase3 plasmid transgenic sweet potato plants on the upper and lower sides of the vines by using a grafting method. In order to ensure that the grafting position does not influence the change of the virus accumulation level, each stock material is only grafted with 2 experimental materials, the alternate grafting positions are alternated, the experimental interference is removed, the phenotype change is recorded after 14 days and 21 days of grafting, and qRT-PCR is sampled and carried out to calculate the copy accumulation level change of the SPVD (SPFMV/SPCSV) 2 viruses in the grafted materials. The experimental biological replicates were 3.
And verifying the resistance of the two transgenic plants to SPVD by using a grafting method, and respectively embedding 2 transgenic plants into virus seedling stocks which are cut in advance as scions according to a grafting mode of a grafting method after only tender stem ends of terminal buds are reserved, wherein the 2 scions are respectively grafted at upper and lower positions of different vines from the same virus source plant in a rotation mode. Within 7-21 days, the experimental phenotype was observed and sampled for virus copy number identification. The experimental result shows that on the 14 th day of grafting infection, no difference is found in the morphology of the two groups of experimental treatment materials, but analysis of experimental samples by using qRT-PCR technology shows that only trace virus copies can be detected in the NT cells of transgenic sweet potato plants transformed with the RfxCas13a silencing vector targeting RNase3, and obvious virus accumulation is detected in the NT cells of transgenic sweet potato plants transformed with no-target RfxCas13d. Transgenic sweetpotato plants transformed with 1380-NLS RfxCas13d-pre gRNA RNase3 plasmid acquired resistance to SPVD virus disease. FIG. 5, wherein A. Screening and detecting sweet potato severely infected with SPVD virus disease as a source for subsequent grafting; B. and (3) carrying out virus molecular detection on the grafted NT and 2 transgenic sweet potatoes targeting RNase3 RxCas13 d.
Sequence listing
<110> university of Jiangsu teachers and universities
<120> a method for breeding sweet potato having SPVD resistance
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 688
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgatgattc cgatcttttc tgatgtttct gaagaaagta aacttactat cttcggaagt 60
cgtcatagat tggattctat catacaatcc atttgtactt cagaagacag agacaaatat 120
gaaattttgg gtgattgggc tatcacaaca tacgttacta gtatgttgac tgatcttttt 180
aaacatgacg cagatgccga atctctgtct tacttcgtgc tcataatatt tcaaatttta 240
tgttcgcgaa agctatggtg gagtcaagat tttatgaaga tttttcaatc tggttgacgc 300
cgaccaattg cagttatgta gaatgacttt cggtggtggg aaaaatgttt atgaagttaa 360
tgttaaattc ttggctaact actttgagag agttgttggt tggttagtca taaatgatag 420
ttcggaaagt attaagaagt ttcttgattt gttcttgaag cctcttatgt ctttccgtat 480
taagaaacct gctcgttcta tccttcaaga atgggctgta aagaataaca agagacttga 540
catttatacg ggtgagtata atgtcaacaa tgtagtctat gtcctagtcg acggaaaaga 600
gatcagtcga gctaatgatt tgattagtaa gaaaagagca atctcaaagg cagtaatttt 660
tgctgtcgaa gctctaaatt tgaattga 688
<210> 2
<211> 168
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
caagtaaacc cctaccaact ggtcggggtt tgaaactaga atccaatcta tgacgacttc 60
cgaagacaag taaaccccta ccaactggtc ggggtttgaa acaccagatt gaaaaatctt 120
cataaaatct tgcaagtaaa cccctaccaa ctggtcgggg tttgaaac 168
Claims (8)
1. A breeding method of sweet potatoes with SPVD resistance, which is characterized by comprising the following steps:
(1) Obtaining a plant expression vector of the transgenic sweet potato, and inserting an RfxCas13d sequence and a target sequence corresponding to the targeted SPCSV-RNase3 into a conventional ternary plant expression vector pCambia 1380;
(2) Carrying out transformation of agrobacterium strain EHA105 on the vector constructed in the step (1) by a chemical method;
(3) Sorting and propagating the transgenic positive sweet potatoes obtained by the transformation in the step (2);
(4) Identifying the virus resistance of the obtained transgenic sweet potato;
wherein, an expression frame for expressing the HYG hygromycin is pre-constructed in the conventional ternary plant expression vector pCambia1380 vector and is used for screening transgenic positive plants and identifying the transgenic positive;
the construction method of the step (1) comprises 2 sections of different sequence expression frames; respectively using a pNbU4 promoter to drive the expression of an RfxCas13d protein gene, and using a pAtU6 promoter to drive the expression of a Spacer targeting SPCSV-RNase 3;
wherein, the pAtU6 promoter adopts optimized guide sequence gRNA for driving expression, and the nucleotide sequence of the guide sequence gRNA is shown in SEQ ID NO. 2.
2. The method for breeding sweet potato with SPVD resistance according to claim 1, wherein the construction method adopts a segmented cloning mode to construct a plant expression vector pCambia 1380.
3. The method for breeding sweet potato with SPVD resistance according to claim 2, wherein the construction method comprises the steps of firstly cutting pCambia1380 vector by HindIII/EcoRI, kpnI/BamHI restriction enzyme, and then inserting a sequence expression frame containing RfxCas13d and an expression frame containing gRNA fragment; the gRNA comprises a Spacer and Poly T DNA fragment of a targeted SPCSV-RNase3 gene; the expression frame of the gRNA fragment uses pAtU6 promoter to drive expression; finally, carrying out vector cloning connection by utilizing a connection mode of homologous recombination to obtain a corresponding sweet potato expression vector for genetic transformation.
4. The method of claim 3, wherein the expression cassette comprising RfxCas13d is codon optimized and synthesized for the nucleic acid fragment using software OptimumGene.
5. The method for breeding sweet potatoes with SPVD resistance according to claim 4, wherein said preference optimization uses dicotyledonous plants.
6. The method for breeding sweet potatoes having SPVD resistance according to claim 1, wherein the step (2) comprises the steps of:
adding the vector constructed in the step (1) into agrobacterium EHA105 competent cells, performing ice bath, liquid nitrogen freezing, heat shock, fungus shaking and plate coating, culturing for 48 hours in a 28-DEG incubator, and selecting monoclonal colonies identified as positive by PCR; the YEB liquid medium was used for overnight shaking, and the obtained agrobacterium liquid with concentration od600=0.6 was used for infecting the prepared sweet potato callus cells.
7. The method for breeding sweet potatoes with SPVD resistance according to claim 1, wherein the step (3) is specifically: transferring the HYG-resistant embryogenic callus obtained by the transformation in the step (2) to a sweet potato differentiation medium MS, culturing for 60 days, and carrying out positive identification on the resistance of the obtained transgenic sweet potato plant by utilizing a PCR identification method; the concentration of HYG in the anti-HYG embryogenic callus is 20mg/L.
8. The method for breeding sweet potatoes with SPVD resistance according to claim 1, wherein the step (4) adopts a mode of insect vector transmission and grafting transmission for resistance test, and experimental results show that compared with a control group, the transgenic sweet potatoes can effectively inhibit virus accumulation caused by long-term insect vector transmission and short-term grafting; the long term is 90d, and the short term is 15d; the virus is SPFMV/SPCSV.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110346271.2A CN113249403B (en) | 2021-03-31 | 2021-03-31 | Breeding method of sweet potato with SPVD resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110346271.2A CN113249403B (en) | 2021-03-31 | 2021-03-31 | Breeding method of sweet potato with SPVD resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113249403A CN113249403A (en) | 2021-08-13 |
| CN113249403B true CN113249403B (en) | 2023-08-04 |
Family
ID=77181261
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110346271.2A Active CN113249403B (en) | 2021-03-31 | 2021-03-31 | Breeding method of sweet potato with SPVD resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113249403B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114990093B (en) * | 2022-06-24 | 2024-02-13 | 吉林大学 | Protein sequence MINI RFX-CAS13D with small amino acid sequence |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102108419A (en) * | 2010-11-30 | 2011-06-29 | 河南省农业科学院植物保护研究所 | Multiple RT-PCR (reverse transcription-polymerase chain reaction) detection method for SPVD (sweet potato virus disease) |
| CN102206661A (en) * | 2011-03-31 | 2011-10-05 | 河南省农业科学院 | Fusion gene for three sweet potato viruses and interference carrier thereof |
| CN107372102A (en) * | 2017-08-04 | 2017-11-24 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of selection of anti-SPVD virosis sweet potato variety |
| CN110199881A (en) * | 2019-07-10 | 2019-09-06 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of sweet potato health seedling cultural method removing sweet potato viruses complex SPVD |
| CN111549054A (en) * | 2020-05-22 | 2020-08-18 | 中国农业科学院植物保护研究所 | CRISPR/RfxCas13d plant RNA virus resistant vector and construction method and application thereof |
| CN111690773A (en) * | 2020-06-17 | 2020-09-22 | 山东舜丰生物科技有限公司 | Method and system for detecting target nucleic acid by using novel Cas enzyme |
-
2021
- 2021-03-31 CN CN202110346271.2A patent/CN113249403B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102108419A (en) * | 2010-11-30 | 2011-06-29 | 河南省农业科学院植物保护研究所 | Multiple RT-PCR (reverse transcription-polymerase chain reaction) detection method for SPVD (sweet potato virus disease) |
| CN102206661A (en) * | 2011-03-31 | 2011-10-05 | 河南省农业科学院 | Fusion gene for three sweet potato viruses and interference carrier thereof |
| CN107372102A (en) * | 2017-08-04 | 2017-11-24 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of selection of anti-SPVD virosis sweet potato variety |
| CN110199881A (en) * | 2019-07-10 | 2019-09-06 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of sweet potato health seedling cultural method removing sweet potato viruses complex SPVD |
| CN111549054A (en) * | 2020-05-22 | 2020-08-18 | 中国农业科学院植物保护研究所 | CRISPR/RfxCas13d plant RNA virus resistant vector and construction method and application thereof |
| CN111690773A (en) * | 2020-06-17 | 2020-09-22 | 山东舜丰生物科技有限公司 | Method and system for detecting target nucleic acid by using novel Cas enzyme |
Non-Patent Citations (1)
| Title |
|---|
| Targeting of SPCSV-RNase3 via CRISPR-Cas13 confers resistance against sweet potato virus disease;Yicheng Yu等;Mol Plant Pathol;104-117 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113249403A (en) | 2021-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6530887B2 (en) | Agrobacterium strain modified to increase plant transformation rate | |
| CN111424022B (en) | Verticillium dahliae VdEG target gene fragment for pathogen-resistant bacteria, interference vector and application thereof | |
| He et al. | Functional analysis of citrus AP2 transcription factors identified CsAP2-09 involved in citrus canker disease response and tolerance | |
| CN110760515B (en) | lncRNA lnc12 and application thereof in regulation and control of adventitious root development of poplar | |
| CN112175965B (en) | Gene and protein for enhancing resistance of rice blast and bacterial leaf blight and method for improving resistance of rice blast and bacterial leaf blight | |
| CN114752599B (en) | Verticillium dahliae VdNRPS3 gene antipathogen target gene fragment, interference vector and application thereof | |
| CN114736915A (en) | Verticillium dahliae VdNRPS2 gene antipathogen target gene fragment and interference vector and application thereof | |
| CN113549635A (en) | Application of verticillium dahliae VdPRMT1 gene in improving disease resistance of crops or vegetables | |
| CN113249403B (en) | Breeding method of sweet potato with SPVD resistance | |
| JPWO2003040363A1 (en) | Rice transposon gene | |
| WO2022121127A1 (en) | Meloidogyne-related mirna, regulatory gene thereof, protein thereof and application thereof | |
| WO2019103034A1 (en) | Genome-edited plant production method | |
| CN112126707B (en) | Nucleic acid molecules from corn event CA09328 and methods for detecting same | |
| CN116694652B (en) | Verticillium dahliae VdNRPS4 gene antipathogenic target gene fragment, interference vector and application | |
| AU707935B2 (en) | Transgenic plants exhibiting heterologous virus resistance | |
| CN116445446A (en) | Wild cabbage glycosyltransferase BoUGT76C2 gene and application | |
| Zhang et al. | An efficient regeneration protocol for Agrobacterium-mediated transformation of melon (Cucumis melo L.) | |
| Zaidi et al. | Virus-induced gene silencing (VIGS) in cassava using geminivirus agroclones | |
| CN118406698B (en) | Application of ZmWIND gene in improving corn genetic transformation efficiency | |
| CN103255164B (en) | Construct and use thereof | |
| CN113584055B (en) | Pepper PNPAL3 gene and application thereof in resisting blast of peppers | |
| CN110295192B (en) | Bivalent RNAi expression vector for constructing TYLCV and ToCV by Gateway technology and application thereof | |
| CN113005122B (en) | Anti-corn virus small RNA | |
| CN116903718A (en) | Application of SlWRKY80 in improving resistance of tomato root knot nematode disease | |
| CN118703560A (en) | Tobacco branch regulatory gene NtCKX1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |