CN113249385A

CN113249385A - TLR4 gene deletion zebra fish model

Info

Publication number: CN113249385A
Application number: CN202110488818.2A
Authority: CN
Inventors: 袭细毛
Original assignee: Guangzhou Boshi Biotechnology Co ltd
Current assignee: Guangzhou Boshi Biotechnology Co ltd
Priority date: 2021-04-30
Filing date: 2021-04-30
Publication date: 2021-08-13

Abstract

The invention relates to construction of a TLR4 gene-deleted zebra fish, which comprises the following specific steps of CRISPR/Cas9 gene knockout target site design; constructing an sgRNA in-vitro transcription vector; in vitro transcription, purification and identification of sgRNA; preparing Cas9 mRNA; screening sgRNA with highest mutation efficiency for obtaining F₀An embryo, the sgRNA sequence being 5'-GCCTCTAACGATATAGATGA-3'; f is to be₀Feeding the embryo to sexual maturity; outcrossing with wild adult fish, screening F₀(ii) a Selection of F producing efficient mutations₀Selfing and screening F₁(ii) a From F₁Selecting female fish and male fish with the same mutation from the generation mutants, and hybridizing to obtain F₂Generation; the constructed zebra fish with the TLR4 gene deletion can be stably inherited, and the zebra fish with the TLR4 gene deletion can be used for researching the relation between the TLR4 gene and inflammation and tumors.

Description

TLR4 gene deletion zebra fish model

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to a TLR4 gene deletion zebra fish model.

Background

Toll-like receptor 4 (TLR 4) belongs to type I transmembrane protein receptor, is a key regulator of innate immunity and adaptive immune system, can directly mediate body reaction with pathogens, TLR4 is the earliest discovered TLRs family member, is a pattern recognition receptor involved in infectious and autoimmune diseases, and can be divided into exogenous pathogen-associated molecular patterns (PAMPs) and endogenous loss-associated molecular patterns (DAMPs) according to the source of its ligand. TLR 4/NF-kB is a classical inflammation signal pathway, and can reduce the release of inflammatory mediators by inhibiting the TLR 4/NF-kB signal pathway so as to relieve pain, and at present, the relation between the TLR 4/NF-kB signal pathway and inflammasome and autophagy related molecules is to be further researched. TLR4 is related to the occurrence and development of various tumors, changes of the activity of TLR4, and may affect the growth, invasion, metastasis, drug resistance and the like of tumor cells.

The similarity of the zebra fish and the human gene reaches 87%, the once egg laying amount of the zebra fish is large, a plurality of experimental materials can be obtained, the individual body is small, the feeding cost is low, and the zebra fish is a good animal model for researching the gene function.

Disclosure of Invention

The invention aims to construct a TLR4 gene deletion zebra fish model.

The preparation process of the invention is as follows:

the DNA sequence of the target site of the invention is as follows: 5'-GCCTCTAACGATATAGATGA-3' (Seq No. 1).

The invention provides a gene targeting kit, which comprises two Oligo sequences, wherein the Oligo sequences are 5'-ACACCGCCTCTAACGATATAGATGAG-3' (Seq No.2) and 5'-AAAACTCATCTAT ATCGTTAGAGGCG-3' (Seq No.3), and the kit can be used for silencing TLR4 gene expression.

The invention provides a gene knockout method, which comprises the following steps: the Oligo fragment is used for recognizing a target site of a target gene, binding with Cas9 and recognizing a PAM sequence at the target site, guiding nuclease to bind to the target site of the target gene, starting shearing to form a DSB gap, then connecting a cell with a repair mechanism through a non-homologous end to repair a double chain of the target gene, causing frameshift mutation, and finally knocking out the target gene.

Further, the target point is one or more than one.

According to another aspect of the invention, the invention provides a preparation method of zebra fish with the TLR4 gene deleted, which comprises the following steps:

1. determining a TLR4 target site according to a TLR4 gene sequence;

2. designing an Oligo sequence according to a TLR4 target site;

3. constructing a gRNA in vitro transcription vector;

4, PCR to obtain a gRNA in vitro transcription template;

5. carrying out in-vitro transcription on the template obtained in the step 4 to obtain gRNA;

6. preparing an in vitro transcription template of Cas9 mRNA;

7. transcribing Cas9 mRNA in vitro;

8. adding a polyA sequence, and recovering Cas9 mRNA;

9. cas9 mRNA and gRNA are mixed and injected into zebra fish embryos at the single cell stage;

screening the gRNA with the highest mutation efficiency for obtaining F₀An embryo, the sgRNA sequence being 5'-GCCTCTA ACGATATAGATGA-3' (Seq No. 1);

10. f is to be₀Feeding the embryo to sexual maturity;

11. outcrossing with wild adult fish, screening F₀；

12. Selection of F producing efficient mutations₀Selfing and screening F₁；

13. From F₁Selecting female fish and male fish with the same mutation from the generation mutants, and hybridizing to obtain F₂Generation;

14. screening TLR4 gene knockout homozygote to obtain the stably inherited TLR4 gene deletion zebra fish.

The invention has the advantages that:

the constructed zebra fish with the TLR4 gene deletion is the first case at home and abroad.

The constructed zebra fish with the TLR4 gene deletion can be stably inherited and can be used for researching the relation between the TLR4 gene and inflammation and tumors.

Drawings

FIG. 1: clone scaffold pGU6 electrophoretogram

FIG. 2: gRNA in vitro transcription template

FIG. 3: in vitro transcription of Cas9 mRNA

FIG. 4: PCR and enzyme digestion identification mutant

FIG. 5: wild type and TLR4 gene deletion zebra fish sequence comparison

FIG. 6: comparison of wild type and TLR 4-deleted zebra fish IL6 expression level after LPS stimulation

FIG. 7: comparison of TNF alpha expression levels of wild type zebra fish with TLR 4-deleted zebra fish after LPS stimulation

FIG. 8: comparison of TNF alpha expression levels of wild type zebra fish with TLR 4-deleted type before LPS stimulation

Detailed Description

The present invention will be described in further detail with reference to the following examples, which are provided only for illustrating the present invention and are not intended to limit the scope of the present invention.

Example 1: preparation of animal models of the invention

1. Laboratory animal

Culturing wild zebra fish (TU strain) according to a standardized scheme, wherein the water temperature is 28.5 ℃, the light/dark cycle is 14 h/10 h, collecting embryos after the adult zebra fish spawns, culturing the adult zebra fish in E3 hatching fluid, and expressing the development stages of the embryos and the young fishes according to hours of fertilization (hpf) or days of fertilization (dpf);

CRISPR/Cas9 Gene knockout target site design

Inquiring a zebra fish TLR4 gene sequence (KC832406.1, Seq No.4) on NCBI, designing TLR4 sgRNA and Oligo sequences according to a CRISPR/Cas9 knockout principle, wherein target sites and the Oligo sequences are shown in Table 1;

TABLE 1 sgRNA and Oligo sequences

3. Construction of gRNA in vitro transcription vector

3.1 using Bsa I to carry out enzyme digestion on pGL3-U6-SgRNA-PGK-Puromycin (hereinafter referred to as pGU6) and carrying out gel cutting recovery (shown in figure 1) to obtain a sgRNA cloning skeleton, wherein the length of the sgRNA cloning skeleton is about 5000bp, and a reaction system is shown in a table 2;

table 2 enzyme digestion system:

3.2 ordering the oligo sequence according to the target site;

3.3 using ddH₂O respectively dissolving the oligos into 10 mu M solution, annealing to obtain small viscous terminal fragments, wherein the annealing reaction system is shown in Table 3;

TABLE 3 annealing procedure

3.4 connecting and transforming the annealed fragment with the recovered sgRNA cloning framework, selecting positive clones to be sequenced, selecting clone glycerol with correct sequence for bacterium conservation and quality improvement, wherein the connection system is shown in Table 4;

TABLE 4 connection System

4. Preparation of sgRNA

4.1 order primer sequence T7-sgRNA-F: TTAATACGACTCACTCACTATAGGCCTCTAACGA TATAGATGAG-3' (Seq No.11), sgRNA-R: AAGAATGTGCGAGTCCCAGG (Seq number 12); performing PCR amplification according to the following reaction and reaction program, wherein the reaction system is 50 μ L, obtaining a DNA template of sgRNA in vitro transcription, and analyzing and identifying by 2% agarose gel electrophoresis, about 470bp (shown in figure 2), the PCR reaction system is shown in Table 5, the PCR reaction program is pre-deformed at 95 ℃ for 5min, the PCR reaction program is repeated for 30 cycles (94 ℃ 30s, 52 ℃ 30s and 72 ℃ 30s), the PCR reaction program is 5min at 72 ℃ and 1h at 4 ℃;

TABLE 5 PCR reaction System

Components	Sample addition amount
		10×5 PCR buffer	5μL
25mM MgSO₄	5μL
		2mM dNTPs	5μL
T4-sgRNA-F(10μM)	1μL
		sgRNAr-R(10μM)	1μL
pGU6-sgRNA	10ng
		X5 High-Fidelity DNA polymerase	1uL
ddH₂O	50μL

4.2 in vitro transcription template for purification of sgRNA

4.2.1 adding chloroform/phenol/isopropanol mixed solution with the same volume into the PCR product, and uniformly mixing;

4.2.24 ℃, 16000g centrifugation for 5min, carefully suction supernatant into new EP tube;

4.2.3 adding 1/10 volume of 3mM NaAC, mixing, adding 2 times volume of anhydrous ethanol, mixing, standing at-80 deg.C for at least 1h, taking out, centrifuging at 4 deg.C and 16000g for 30 min;

4.2.4 carefully discard the supernatant, wash the precipitate with 70% ethanol 3 times, each time with 200. mu.L, wash at 4 ℃ and centrifuge at 16000g for 5 min;

4.2.5 washing with 400 μ L anhydrous ethanol, taking away residual salt solution, sucking up liquid, and drying at room temperature for 5-10min to volatilize ethanol;

4.2.6 adding appropriate amount of non-RNA water to dissolve according to the amount of precipitate, and measuring the concentration;

4.3 in vitro transcription, purification and identification of sgRNA

Using MEGAshortscript^TMThe Kit in vitro transcription Kit performs in vitro transcription of sgRNA according to the following reaction system, the reaction system is shown in table 6, the reaction conditions are 37 ℃ and 4 hours, after the in vitro transcription is finished, 4.5 mu L of DNase is added, the reaction is performed for 20min at 37 ℃, a DNA template is removed, after the reaction is finished, 480 mu L of nucleic-free Water is added, the purification is performed by using a phenol chloroform extraction method, the RNase-free Water is added to dissolve RNA precipitate, the concentration is not lower than 500 ng/mu L, the RNA is subpackaged, and the purified RNA is subjected to electrophoresis identification by using 2% agarose gel;

the sgRNA in vitro transcription system is shown in table 6;

TABLE 6 in vitro transcription sgRNA reaction System

Components	Sample addition amount
		NTPs	8μL
In vitro transcription of DNA templates	7μL
		T7 Enzyme Mix	2uL
10×T7 Reaction Buffer	2μL
		Nuclease-free Water	To 20μl

5. Preparation of Cas9 mRNA

5.1 preparation of in vitro transcription template for Cas9 mRNA: the pSP6-2sNLS-spC as9 vector (37 ℃, 4h or more) was linearized by a single digestion with Xba I; taking a small amount of electrophoresis to confirm that linearization is complete, and directly recovering a linearization product;

5.2 in vitro transcription of Cas9 mRNA, the mRNA in vitro transcription system is shown in Table 7;

TABLE 7 Cas9 mRNA in vitro transcription System

5.3 addition of polyA sequence, system shown in Table 8, recovered mRNA (FIG. 3) for microinjection;

TABLE 8 mRNA plus polyA reaction System

5.3 screening of the highest mutation efficiency gRNAs for F₀An embryo, wherein Cas9 mRNA and gRNA are mixed and injected into a single-cell zebra fish embryo, the same batch of uninjected embryos are used as a control, Cas9 mRNA 300-500pg and gRNA 25-200pg are adopted, and the mutation efficiency of each group is shown in Table 9;

table 9 sgRNA mutation efficiency

Serial number	sgRNA sequence	Efficiency (%)
			1	GAATGAACTTATGGAGAATC(Seq No.5)	21.35
2	GCCTCTAACGATATAGATGA(Seq No.1)	39.81
			3	GACCCAAGCTTCATCATAGC(Seq No.8)	18.69

As can be seen from table 9, sgRNA No.2, which was the most efficient mutation, was selected for co-injection with Cas9 mRNA for F acquisition₀And (3) an embryo.

6. Preparation F₀Zebra fish substitute

6.1 Cas9 mRNA and gRNA are mixed and injected into a single-cell zebra fish embryo, and meanwhile, the uninjected embryo of the same batch is used as a control, the Cas9 mRNA 300-500pg and the gRNA 25-200 pg;

6.2 taking embryos with normal phenotype after 2-4dpf injection, extracting genome DNA, and detecting the mutation efficiency of the target site by PCR and T7E1 enzyme digestion (figure 4);

6.3 sequencing the PCR products which can be cut, and detecting the mutation type;

6.4 selection of F for injection in the same batch with higher mutation efficiency and higher survival rate₀Feeding the embryo to sexual maturity;

6.5 outcrossing with wild adult fish, 3-5F of 1dpf₁Mixing the embryos into a group to extract genome DNA;

6.6 detecting the mutation condition of the target site by PCR and enzyme digestion;

6.7 sequencing the PCR products which can be cut to determine the mutation type;

6.8 selection of F producing potent mutations₀Mating fish and breeding in large quantities F₁；

7. Screening for F carrying the mutation at the target site₁Adult fish

7.1 mixing F₁Raising to be large enough until tail fins are suitable to be cut;

7.2F₁cutting tail fins of adult fishes, extracting a genome, carrying out gene detection one by one through PCR and enzyme digestion, and screening out an F1 heterozygote;

7.3 sequencing the PCR products which can be cut, and determining the mutation type by sequencing;

8. from F₁Selecting female fish and male fish with the same mutation from the generation mutants, and hybridizing to obtain F₂Culturing at 28.5 deg.C, taking part of embryo at 4dpf, extracting genome DNA from each embryo, and performing T7E1 enzyme digestion detection;

9. the efficiency of identifying homozygous mutations by PCR banding analysis was further identified by sequencing (figure 5).

Example 2: after LPS stimulation, the wild type is compared with the TLR4 gene deletion zebra fish IL6 and TNF-alpha mRNA expression level

1. Dividing 20 male and female half wild type zebra fishes into two groups, wherein one group is used as a control, the other group is soaked for 2 hours by using 3% LPS, the 20 male and female half TLR4 gene-deleted zebra fishes are also divided into two groups, one group is used as a control, the other group is soaked for 2 hours by using 3% LP S, the groups are anesthetized in an ice water bath after 4 hours, the surface moisture of the fishes is completely absorbed, the tails of the fishes are cut off by using an aseptic surgical scissors, a high-speed refrigerated centrifuge is used for centrifuging at 4 ℃ and 2000r/min for 2 minutes, then blood serum of the 2 fishes is absorbed and mixed, the contents of IL6 and TNF-alpha in the blood and the blood are measured by an ELISA experiment, and then the heart, the liver and the lung are respectively extracted to obtain RNA;

2. after quantifying the RNA extracted in the step 1, 2 mu g of each sample is subjected to RNA reverse transcription, the expression conditions of IL6 and TNF-alpha in the heart, the liver and the lung are respectively measured by quantitative PCR with p-actin as an internal reference, and the reaction conditions are as follows: 3min at 95 ℃; (95 ℃ for 30s, 60 ℃ for 15s, 72 ℃ for 30s)40 cycles; the primer sequences are shown in Table 10 at 95 ℃ for 15s and 60 ℃ for 15 s.

3. Results of the experiment

The real-time quantitative PCR reaction results show (figure 6-8), before stimulation by LPS, the wild type and TLR4 gene-deleted zebra fish can not detect the expression of IL6 mRNA, after stimulation by LPS, the wild type IL6 mRNA expression is obviously increased, the TLR4 gene-deleted zebra fish can still not detect the expression of IL6 mRNA, before and after stimulation by LPS, the expression quantity of the wild type zebra fish TNF-alpha mRNA is obviously increased, but the expression quantity of the TLR4 gene-deleted zebra fish TNF-alpha mRNA is little increased. The TLR4 gene deletion zebra fish TLR4 gene loses efficacy, downstream IL6 gene expression cannot be caused, and compared with wild TLR4 gene expression, the expression is obviously reduced. Furthermore, Elisa experimental results show that IL6 and TLR4 are not detected in the serum of the zebra fish with the deletion of the wild type and TLR4 genes before stimulation of LPS, the content of the wild type IL6 is 598.374 +/-129.22, the content of TNF-alpha is 132.94 +/-43.21, and the expression of IL6 and TLR4 proteins is not detected in the zebra fish with the deletion of the TLR4 genes after stimulation of LPS.

Sequence listing

<110> Guangzhou Bojii Biotechnology Ltd

<120> TLR4 gene deletion zebra fish model

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcctctaacg atatagatga 20

<210> 2

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acaccgcctc taacgatata gatgag 26

<210> 3

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaaactcatc tatatcgtta gaggcg 26

<210> 4

<211> 224

<212> DNA

<213> Danio rerio

<400> 4

tatttgcgtt attgttggat tttactaaga ggctacagat cacctggaca gcaagaatgt 60

tcttatgacg catttgtgat attctccagc tatgatgaag cttgggtcat gaatgaactt 120

atggagaatc tggaggtcgg cgcgctacca attcgttttt gccttcacat gcgggacttt 180

caagcaggga agtcaatcgc ctctaacgat atagatgaag gaat 224

<210> 5

<211> 20

<212> DNA

<213> Danio rerio

<400> 5

gaatgaactt atggagaatc 20

<210> 6

<211> 26

<212> DNA

<213> Danio rerio

<400> 6

acaccgaatg aacttatgga gaatcg 26

<210> 7

<211> 26

<212> DNA

<213> Danio rerio

<400> 7

aaaacgattc tccataagtt cattcg 26

<210> 8

<211> 20

<212> DNA

<213> Danio rerio

<400> 8

gacccaagct tcatcatagc 20

<210> 9

<211> 26

<212> DNA

<213> Danio rerio

<400> 9

acaccgaccc aagcttcatc atagcg 26

<210> 10

<211> 26

<212> DNA

<213> Danio rerio

<400> 10

aaaacgctat gatgaagctt gggtcg 26

<210> 11

<211> 44

<212> DNA

<213> Danio rerio

<400> 11

ttaatacgac tcactcacta taggcctcta acgatataga tgag 44

<210> 12

<211> 20

<212> DNA

<213> Danio rerio

<400> 12

aagaatgtgc gagtcccagg 20

<210> 13

<211> 19

<212> DNA

<213> Danio rerio

<400> 13

tcgtgtggct ctagtatga 19

<210> 14

<211> 21

<212> DNA

<213> Danio rerio

<400> 14

ccttgttata gtgctcttga c 21

Claims

1. The construction method of the zebra fish with the TLR4 gene deletion is characterized by comprising the following steps:

1) determining a TLR4 target site according to a TLR4 gene sequence, and designing the target site according to a CRISPR/Cas9 knockout principle;

2) designing an Oligo sequence according to a TLR4 target site;

3) constructing a gRNA in vitro transcription vector;

4) PCR is carried out to obtain a gRNA in vitro transcription template;

5) carrying out in-vitro transcription on the template obtained in the step 4 to obtain gRNA;

6) preparing an in vitro transcription template of Cas9 mRNA;

7) transcribing Cas9 mRNA in vitro;

8) adding a polyA sequence, and recovering Cas9 mRNA;

9) cas9 mRNA and sgRNA are mixed and injected into zebra fish embryos at the single cell stage;

10) screening sgRNA with highest mutation efficiency for obtaining F₀An embryo, the sgRNA sequence being 5'-GCCTCTAACGATATAGATGA-3';

11) f is to be₀Feeding the embryo to sexual maturity;

12) outcrossing with wild adult fish, screening F₀；

13) Selection of F producing efficient mutations₀Selfing and screening F₁；

14) From F₁Selecting female fish and male fish with the same mutation from the generation mutants, and hybridizing to obtain F₂Generation;

15) screening TLR4 gene knockout homozygote to obtain the stably inherited TLR4 gene deletion zebra fish.

2. The use of the TLR4 gene-deleted zebrafish of claim 1, which is used for studying the relationship of TLR4 gene with inflammation and tumor.