CN113249379A

CN113249379A - DNA (deoxyribonucleic acid) joint for combining magnetic beads and coupling transposase, novel magnetic beads and DOT-seq method

Info

Publication number: CN113249379A
Application number: CN202110775101.6A
Authority: CN
Inventors: 江翱; 陈晶晶; 苏杰; 曹振; 宋东亮
Original assignee: Yisheng Biotechnology Shanghai Co ltd
Current assignee: Yisheng Biotechnology Shanghai Co ltd
Priority date: 2021-07-09
Filing date: 2021-07-09
Publication date: 2021-08-13
Anticipated expiration: 2041-07-09
Also published as: CN113249379B

Abstract

The invention discloses a DNA joint for combining magnetic beads and coupling transposase, wherein the joint is a U-shaped joint, an oligomeric single-stranded nucleotide is arranged in the middle of the joint and is modified to be connected to the magnetic beads, two ends of the oligomeric single-stranded nucleotide are respectively provided with a double-stranded Tn5 recognition sequence, and a P5 sequence and a P7 sequence of an illumina sequencing library structure are respectively connected behind the Tn5 recognition sequences at the two ends. And discloses a corresponding novel magnetic bead and a DOT-seq method. The DOT-seq uses a more efficient magnetic bead coupling transposase method, can effectively ensure that a joint combined in a transposase dimer is a heterogeneous joint, and can also ensure that the distribution of transposase on magnetic beads is more uniform. The DOT-seq has the advantages of shorter time consumption, higher library yield, lower requirements on DNA quality and input quantity, better library uniformity and the like, and is suitable for the requirements of building various DNA NGS libraries, especially low-quality pathogen DNA samples.

Description

DNA (deoxyribonucleic acid) joint for combining magnetic beads and coupling transposase, novel magnetic beads and DOT-seq method

Technical Field

The invention relates to a DNA joint for combining magnetic beads and coupling transposase, a novel magnetic bead and a DOT-seq method, belonging to the technical field of biology.

Background

The second-generation DNA sequencing is a main means of modern pathology detection, and has important effects in the fields of disease diagnosis, tumor screening, pathogen identification, drug target design and the like. The conventional second generation DNA library is usually constructed by adopting a mechanical method or an enzyme cutting method to carry out DNA fragmentation, and then completing the construction of the DNA library through four steps of end repair, linker connection and library amplification. However, the method has the problems of nonuniform fragment size, long time consumption, large difference of fragmentation effects on DNA from different sources, uncontrollable fragmentation efficiency and the like, and the original sample of complex diseases often causes the phenomena of library construction failure, low yield, poor uniformity and the like. With the discovery and modification of transposase, a DNA NGS library construction method by utilizing transposase Tn5 to perform library fragmentation and amplification is developed and widely used, and compared with the traditional mechanical method and the enzyme cutting method DNA library construction method, the technology has the advantages of short time consumption and simple operation, but has strict requirements on the accuracy of the input amount of a template. Generally speaking, the traditional Tn 5-mediated DNA library construction is sensitive to the input amount of DNA, and a slightly high input amount can cause serious large fragments of the library and reduce the yield of the library; a slightly lower input amount results in an excessively small library and a reduced yield. These are caused by the severe dispersion of DNA fragments generated by fragmentation of transposase Tn 5. This greatly reduces the operability and application range of Tn5 mediated DNA library construction. And the uniformity of the library generated by the transposase library construction is much poorer than that of the traditional mechanical method and the enzyme cutting method. In recent years, a magnetic bead coupled transposase method DNA library building technology is developed for solving the defects of strict requirement on template input amount, poor DNA library uniformity and the like caused by transposase method library building, but no effective solution is available for ensuring that transposase is coupled uniformly on magnetic beads and can be effectively assembled into a transposase heterogeneous dimer. This greatly limits the development and application of magnetic bead-coupled transposase-method DNA library construction technology.

Disclosure of Invention

The invention aims to provide a novel magnetic bead coupled transposase and a method for quickly homogenizing and constructing a library of DNA (the principle is shown in a figure 1), which is named DOT-seq (Dual On-bead targeting and sequencing). The DOT-seq uses a more efficient magnetic bead coupling transposase method, and can effectively ensure that a joint combined in a transposase dimer is a heterogeneous joint.

The technical scheme adopted by the invention is as follows:

a DNA joint for combining magnetic beads and coupling transposase is a U-shaped joint, the middle sequence of the joint is oligomeric single-stranded nucleotide which is modified to be connected to the magnetic beads, two ends of the oligomeric single-stranded nucleotide are respectively provided with double-stranded Tn5 recognition sequences, and a P5 sequence and a P7 sequence of an illumina sequencing library structure are respectively connected behind the Tn5 recognition sequences at the two ends. Wherein the modification site is usually located in the region 1/3-2/3 of the oligonucleotide to ensure that the Tn5 recognition sequences at both ends have sufficient space to bind with Tn5, and the most preferable scheme is the middle site of the oligonucleotide.

Preferably, the oligonucleotide in the middle of the U-shaped linker is modified with biotin, amino group, or Arcydite.

Preferably, the oligonucleotide in the middle of the U-shaped linker is 8-32nt in length.

Preferably, the sequence of the U-shaped linker is: [ Phos ] CTGTCTCTTATACACATCTCCGAGCCCACGAGACT … T [ Int NH 2C 6 dT ] T … TC GTCGGCAGCGTCAGATGTGTATAAGAGACAG, wherein the oligonucleotide in the middle of the U-shaped linker is 8-32nt in length.

Preferably, the sequence of the U-shaped linker is: [ Phos ] is]CTGTCTCTTATACACATCTCCGAGC CCACGAGACT…T[Int Biotin dT]T … TC GTCGGCAGCGTCAGATGTGTATAAGAGA CAG, wherein the length of the oligonucleotide single-stranded nucleotide in the middle of the U-shaped joint is 8-32 nt.

The invention also discloses a novel magnetic bead for coupling transposase, which comprises the magnetic bead and the DNA joint combined on the magnetic bead.

Preferably, the magnetic beads are streptavidin magnetic beads, carboxyl magnetic beads or polyacrylamide coated magnetic beads; when the magnetic beads are streptavidin magnetic beads, the DNA joints are modified by biotin; when the magnetic beads are carboxyl magnetic beads, the DNA joints are modified by amino; when the magnetic beads are polyacrylamide coated magnetic beads, the DNA joints are Arcydite modified.

The invention also discloses a DOT-seq method, which comprises the following steps:

(1) coupling the magnetic beads with the annealed DNA joints to obtain magnetic beads coupled with the joints, wherein the joints are the DNA joints;

(2) incubating and combining the magnetic beads of the coupling joint obtained in the step (1) with transposase Tn5 to obtain a transposase coupling magnetic bead compound;

(3) combining the transposase coupled magnetic bead compound obtained in the step (2) with a DNA sample and fragmenting;

(4) the fragmentation reaction of the transposase was terminated, library amplification was performed, and DNA was recovered.

Preferably, when the magnetic beads in step (1) are carboxyl magnetic beads and the DNA linker is amino-modified, an activator is added in step (1) to complete the coupling, and the activator is one or more of morpholine ethanesulfonic acid (MES), N-Dimethylacetamide (DMAC), N-hydroxysuccinimide (NHS), and 1-ethyl- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDC).

Preferably, an enhancer is further added in the step (3), and the enhancer is one or more of polyethylene glycol, polysucrose, polypropylene glycol and polyethyleneimine.

The invention has the beneficial effects that:

the DOT-seq uses a more efficient magnetic bead coupling transposase method, can effectively ensure that a joint combined in a transposase dimer is a heterogeneous joint, and can also ensure that the distribution of transposase on magnetic beads is more uniform. Therefore, compared with the traditional magnetic bead coupled transposase method DNA library building, the DOT-seq has the advantages of shorter time consumption, higher library yield, lower requirements on DNA quality and input amount (50 pg-1 mug), better library uniformity and the like, and is suitable for various DNA NGS library building requirements, especially low-quality pathogen DNA samples.

Drawings

FIG. 1, DOT-seq principle schematic.

FIG. 2 is a schematic diagram of the principle of streptavidin magnetic bead coupled biotin modified linker and carboxyl magnetic bead coupled amino linker.

FIG. 3 comparison of library yields for streptavidin magnetic bead-coupled transposase and carboxy magnetic bead-coupled transposase.

FIG. 4, schematic diagram of U-shaped linker and linear linker coupled magnetic beads.

FIG. 5 comparison of Tn 5-coupled magnetic beads mediated by U-linkers and linear linkers on the yield of DNA libraries.

FIG. 6 comparison of Tn5 coupled magnetic beads mediated by U-linkers and linear linkers on DNA library size.

FIG. 7 is a schematic diagram of the principle of magnetic bead coupling with amino-modified and biotin-modified U-shaped linkers.

FIG. 8 comparison of amino-modified and biotin-modified U-linker coupled magnetic beads on DNA library yield.

FIG. 9 comparison of amino-modified and biotin-modified U-linker coupled magnetic beads on DNA library size.

FIG. 10 is a schematic diagram of the structure of the double-stranded pair of U-shaped adaptor with different lengths.

FIG. 11, effect of U-adapters paired for different length duplexes on library yield.

FIG. 12, effect of different annealing conditions of U-shaped linkers on DNA library yield.

FIG. 13 is a schematic diagram of the lengths of different oligonucleotides in the middle of a U-shaped linker.

FIG. 14, effect of different oligonucleotide lengths in the middle of the U-shaped linker on DNA library yield.

FIG. 15, effect of U-linker oligo input ratio on library yield upon annealing.

FIG. 16 shows the effect of the amount of EZ-Tn5 input on the yield of DNA library.

FIG. 17, the effect of the amount of EZ-Tn5 input on the size of the DNA library.

FIG. 18, effect of fragmentation enhancer on DNA library yield.

FIG. 19, effect of fragmentation time on DNA library yield.

FIG. 20, effect of fragmentation time on DNA library size.

FIG. 21, effect of three fragmentation termination conditions on DNA library yield.

FIG. 22, flow comparison of DOT-seq with other transposase mediated DNA banking techniques.

FIG. 23, comparison of DOT-seq and other transposase-mediated DNA banking techniques in library yield.

FIG. 24, comparison of DOT-seq with other transposase-mediated DNA library construction techniques in library size.

FIG. 25, comparison of DOT-seq alignment with sequencing results of other transposase-mediated DNA banking techniques.

FIG. 26, comparison of GC content uniformity for DOT-seq and other transposase-mediated DNA library-building techniques.

FIG. 27, DOT-seq and conventional Tn5 libraries compared at different DNA input.

FIG. 28, library effect of DOT-seq on FFPE DNA of different quality.

FIG. 29, effect of Tn5 coupled magnetic beads on library size distribution for different linker coupling ratios.

Detailed Description

The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way.

Linker sequences and modifications used in this example are shown in table 1.

TABLE 1 linker sequences, corresponding sequence Listing numbers and modifications

Example 1: and (3) comparing the streptavidin magnetic bead coupled transposase with the carboxyl magnetic bead coupled transposase.

In this example, the comparison of the yield of DNA library construction by streptavidin magnetic bead-coupled biotin-labeled linker and carboxyl magnetic bead-coupled amino-labeled linker was compared (see FIGS. 1 and 2 for schematic and library construction principles). The specific implementation mode is as follows:

1) coupling streptavidin magnetic beads and biotin labeling joints.

TABLE 2

Components	Dosage of
		100 µM Biotin-adaptor A	1 µL
100 µM Reverse primer A	3 µL
		10× annealing buffer	1 µL
H2O
		5 µL
Total volume
		10 µL

TABLE 3

Components	Dosage of
		100 µM Biotin-adaptor B	1 µL
100 µM Reverse primer A	3 µL
		10× annealing buffer	1 µL
H2O
		5 µL
Total volume
		10 µL

The 10 × anedealingbuffer contained 500 mM Tris (pH 8.0), 1M NaCl and 10 mM EDTA.

95℃ 5 min，95℃-15℃ （-0.1℃/min），15℃ 10 min。

After the reaction is finished, the linker a and the linker B are mixed together to form a 5 μ M heterogeneous linker mixture.

200 mu L of streptavidin magnetic bead M270 (ThermoFisher) is taken, washed for 3 times by using a magnetic bead binding buffer solution according to the instruction, suspended in 200 mu L of magnetic bead binding buffer solution, added into the 5 mu M heterogeneous joint mixture, and subjected to rotary incubation for 1 h at room temperature. And washing the magnetic beads for 3 times by using 200 mu L of magnetic bead combined buffer solution, and suspending by using 200 mu L of transposase combined buffer solution, and storing at-20 ℃ for later use.

The transposase binding buffer contained 20 mM HEPES-KOH (pH 7.5), 800 mM NaCl, 10% glycerol, 1 mM DTT, 0.1 mM EDTA, and 0.1% Triton X-100.

2) Coupling of carboxyl magnetic beads and amino-labeled linkers.

TABLE 4

Components	Dosage of
		100 µM Amino-adaptor A	1 µL
100 µM Reverse primer A	3 µL
		10× annealing buffer	1 µL
H2O
		5 µL
Total volume
		10 µL

TABLE 5

Components	Dosage of
		100 µM Amino-adaptor B	1 µL
100 µM Reverse primer A	3 µL
		10× annealing buffer	1 µL
H2O
		5 µL
Total volume
		10 µL

95℃ 5 min，95℃-15℃ （-0.1℃/min），15℃ 10 min。

200 muL of carboxyl magnetic beads were taken and added to the 5 muM heterogeneous linker mixture, and 1 mL of 0.2M MES, 900 muL of 100 mM EDC and 100 muL of 100 mM NHS were added. Incubate at room temperature for 24 h with rotation. The magnetic beads were washed 3 times with a magnetic bead binding buffer containing 0.5% Tween 20, suspended with 200. mu.L transposase binding buffer, and stored at-20 degrees for further use.

3) And (4) transposase assembly. And adding 5 mu L Lucigen EZ-Tn5 into 20 mu L of streptavidin magnetic beads or carboxyl magnetic beads coupled with the joint, and performing rotary incubation at room temperature for 1 h, and storing at-20 ℃ for later use.

4) And (5) DNA fragmentation.

TABLE 6

Components	Dosage of
		Magnetic beads coupled with transposase	5 µL
5 Xfragmentation buffer 1	4 µL
		Genomic DNA
	10 ng
		Make up water to	20 µL

5 Xfragmentation buffer 1 contained 50 mM TAPS-NaOH, 25 mM MgCl.

The cells were incubated at 55 ℃ for 1 h with rotation.

After the reaction, 2 μ L of 10 Xfragmentation termination buffer was added, and the reaction was carried out at 55 ℃ for 10 min. And placing the reaction tube on a magnetic frame, removing the supernatant, adding TE buffer solution to wash the magnetic beads twice, and suspending the magnetic beads in 20 mu L of TE buffer solution.

5) And (4) amplifying the library.

Library amplification was performed using the Hieff NGS @ Fast DNA Library for Illumina Kit of an assist holy organism (Cat # 12207).

TABLE 7

Components	Dosage of
		2×Ultima Amplification Mix	25 µL
Primer mix
		3 µL
Primer 5xx			1 µL
	Primer 7xx	1 µL
Magnetic beads obtained in the previous step			20 µL
	Total volume
		50 µL

Blowing, beating and mixing evenly, and then instantly separating. Library amplification was performed according to the following reaction procedure.

TABLE 8

Adding 45 mu L of Hieff NGS DNA Selection Beads (Yeasen, 12601), fully blowing, uniformly mixing, and incubating for 5 min at room temperature. The PCR tube was placed in a magnetic rack to separate the beads from the liquid, and after the solution was clarified (about 3 min), the supernatant was carefully removed. The PCR tube was kept in the magnetic frame, and the beads were rinsed by adding 200. mu.L of clean free H2O freshly prepared 80% ethanol, incubated at room temperature for 30 sec, and the supernatant carefully removed. The rinsing was repeated once. The residual liquid was blotted off with a 10. mu.L pipette. The PCR tube was kept in the magnetic stand all the time, and the magnetic beads were dried with the lid open at room temperature (5 min). Add 22. mu.L of ddH2O, blow to mix well, and let stand at room temperature for 5 min. The PCR tube was briefly centrifuged and placed in a magnetic stand to stand, after the solution cleared (about 5 min), 20. mu.L of the supernatant was carefully removed to a new PCR tube. Library concentrations were determined using qubits.

As a result, as shown in FIG. 3, the use of amino linker-coupled carboxyl magnetic beads provides higher yields in DNA pooling by the transposase-coupled magnetic bead method. Therefore, the amino linker coupled carboxyl magnetic beads are more suitable for the development of the downstream magnetic bead coupled transposase technology.

Example 2: comparison of amino-modified Linear and U-linkers.

In example 1, it was verified that carboxyl magnetic beads coupled with amino-modified linkers had higher yield of library construction. In this example, the effect of linear and U-shaped linkers on the yield of library construction and the size distribution of the library was verified (see FIG. 4 for a schematic). The specific implementation mode is as follows:

1) annealing the U-shaped joint:

TABLE 9

Components	Dosage of
		100 µM U-Amino-adaptor 1	1 µL
100 µM Reverse primer 1	3 µL
		100 µM Reverse primer 2	3 µL
10× annealing buffer	2 µL
		H2O	11 µL
Total volume
		20 µL

5 min at 95 ℃, (-0.1 ℃/min) at 95-15 ℃ and 10 min at 15 ℃. After annealing was completed, linker magnetic bead coupling and library construction were performed as in example 1. The library concentration was determined using Qubit and the Qsep examined the library size distribution.

As a result, as shown in FIGS. 5 and 6, the U-shaped linker has higher library yield than the linear linker in the DNA library construction process. In library size uniformity, the U-shaped linker constructed DNA libraries had a concentrated library size distribution. These results indicate that U-linker mediated coupling of magnetic beads to Tn5 can ensure a more uniform distribution of Tn5 on the beads.

Example 3: comparison of amino-modified and biotin-modified U-linkers.

In example 2, it was verified that coupling verifies that the U-linker coupled magnetic beads have higher yield of library building and more uniform library distribution. In this example, the effect of amino-modified and biotin-modified U-linkers on the yield of the library and the size distribution of the library was verified (see FIG. 7 for a schematic). The specific implementation mode is as follows:

1) annealing amino-modified U-shaped joints:

TABLE 9

95℃ 5 min，95℃-15℃ （-0.1℃/min），15℃ 10 min。

Example 3: comparison of amino-modified and biotin-modified U-linkers.

2) and (3) annealing the biotin modified U-shaped joint:

watch 10

Components	Dosage of
		100 µM U-Biotin-adaptor 1	1 µL
100 µM Reverse primer 1	3 µL
		100 µM Reverse primer 2	3 µL
10× annealing buffer	2 µL
		H2O	11 µL
Total volume
		20 µL

95℃ 5 min，95℃-15℃ （-0.1℃/min），15℃ 10 min。

After annealing, linker magnetic bead coupling and library construction were performed as in example 1, respectively. The library concentration was determined using Qubit and the Qsep examined the library size distribution.

As a result, the amino-modified U-linkers had higher library yields and better library homogeneity as shown in FIGS. 8 and 9.

Example 4: the effect of the length of the paired U-adaptor double-stranded DNA on the library construction.

In example 3, it was verified that magnetic beads coupled with amino-modified U-linkers have higher yield of library construction and more uniform library distribution. In this example, the effect of the length of the U-linker double stranded DNA pair on library construction was verified (schematic as in FIG. 10). The specific implementation mode is as follows:

1) annealing the U-shaped joint:

TABLE 11

Components	Dosage of
		100 µM U-Amino-adaptor 1	1 µL
100 µM Reverse primer 1	3 µL
		100 mu M Reverse primer 2 or 3 or 4 or 5 or 6	3 µL
10× annealing buffer	2 µL
		H2O	11 µL
Total volume
		20 µL

5 min at 95 ℃, (-0.1 ℃/min) at 95-15 ℃ and 10 min at 15 ℃. After annealing was completed, linker magnetic bead coupling and library construction were performed as in example 1. Library concentrations were determined using qubits.

As a result, as shown in FIG. 11, the longer the duplex pairing of the U-shaped adaptor, the higher the yield of the DNA library, which is probably due to the fact that the longer duplex will anneal more easily to the correct U-shaped structure and thus will perform more in library yield.

Example 5: the effect of the annealing mode of the U-shaped joint double-stranded DNA on the library establishment.

In example 4, it was verified that the longer the U-adaptor double stranded DNA match length, the higher the library yield. In this example, the effect of the U-linker annealing regime on library construction was verified. The specific implementation mode is as follows:

1) annealing the U-shaped joint:

TABLE 12

Components	Dosage of
		100 µM U-Amino-adaptor 1	1 µL
100 µM Reverse primer 9	3 µL
		100 µM Reverse primer 10	3 µL
10× annealing buffer	2 µL
		H2O	11 µL
Total volume
		20 µL

The annealing conditions were as follows:

watch 13

Condition	Procedure
			1	95℃ 5 min，95℃-15℃ （-0.1℃/min），15℃ 10 min。
2	95℃ 5 min，90℃ 5 min，85℃ 5 min，80℃ 5 min，75℃ 5 min，70℃ 5 min，65℃ 5 min，60℃ 5 min，55℃ 5 min，50℃ 5 min，45℃ 5 min，40℃ 5 min，35℃ 5 min，30℃ 5 min，25℃ 5 min，20℃ 5 min，15℃ 5 min。
		3	95℃ 5 min，90℃ 5 min，85℃ 5 min，80℃ 5 min，75℃ 5 min，70℃ 5 min，65℃ 5 min，60℃ 5 min，55℃ 5 min，50℃ 5 min，45℃ 5 min，20℃ 5 min，15℃ 5 min。
4	95℃ 5 min，90℃ 5 min，85℃ 5 min，80℃ 5 min，75℃ 5 min，70℃ 5 min，65℃ 5 min，60℃ 5 min，55℃ 5 min，4℃ hold。
		5	95℃ 5 min，90℃ 5 min，85℃ 5 min，80℃ 5 min，75℃ 5 min，70℃ 5 min，65℃ 5 min，4℃ hold。
6	95℃ 5 min，90℃ 5 min，85℃ 5 min，80℃ 5 min，75℃ 5 min，70℃ 5 min，4℃ hold。
		7	95℃ 5 min，90℃ 5 min，85℃ 5 min，80℃ 5 min，75℃ 5 min，70℃ 20 min，4℃ hold。
8	95℃ 5 min，90℃ 5 min，85℃ 5 min，80℃ 5 min，75℃ 5 min，70℃ 1 h，4℃ hold。

After annealing was completed, linker magnetic bead coupling and library construction were performed as in example 1. Library concentrations were determined using qubits.

The structure is shown in FIG. 12, and the yield of DNA library is about high after the U-shaped adaptor is annealed under the condition of 8. This indicates that the annealing condition 8 can ensure the formation of more U-shaped structures.

Example 6: the influence of the length of the U-linker intermediate oligonucleotide on DNA banking.

In example 5, it was verified that the library yield was highest in the annealing pattern of condition 8. In this example, the effect of U-linker middle oligonucleotide length on DNA pooling was verified (schematic in FIG. 13). The specific implementation mode is as follows:

1) annealing the U-shaped joint:

TABLE 14

Components	Dosage of
		100 mu M U-Amino- adaptor 1 or 2 or 3 or 4 or 5 or 6 or 7	1 µL
100 µM Reverse primer 9	3 µL
		100 µM Reverse primer 10	3 µL
10× annealing buffer	2 µL
		Make up water to	20 µL

The annealing conditions are as follows: 5 min at 95 ℃, 5 min at 90 ℃, 5 min at 85 ℃, 5 min at 80 ℃, 5 min at 75 ℃, 1 h at 70 ℃ and hold at 4 ℃.

As a result, as shown in FIG. 14, the yield of the library was the highest when the length of the U-linker intermediate oligonucleotide was 20 to 26 nt, indicating that the U-linker of this length could maximally ensure the assembly of Tn5 dimer.

Example 7: influence of the U-linker oligo input ratio on library construction during annealing.

In example 6, we verified the effect of the U-linker middle oligonucleotide length on DNA banking. In this example, the effect of the U-linker oligo input amount on library construction during annealing was verified. The specific implementation mode is as follows:

1) annealing the U-shaped joint:

watch 15

Components	Dosage of
		100 µM U-Amino-adaptor 4	1 µL
100 µM Reverse primer 9	x µL
		100 µM Reverse primer 10	x µL
10× annealing buffer	2 µL
		Make up water to	20 µL

x is 1, 2, 4 and 8 respectively.

As shown in FIG. 15, the yield of the library was higher as the input amount of the reverse oligo in the U-shaped linker was higher. This is probably because the higher the input amount of the reverse oligo, the easier it is to anneal to the correct U-shaped linker with the long amino-modified oligo.

Example 8: the influence of the amount of EZ-Tn5 input on DNA library construction.

In example 7, it was verified that the linker oligo input amount ratio was 1: at 8, the library yield was highest. In this example, the effect of the difference on library construction was verified under this condition. The specific implementation mode is as follows:

linker annealing and magnetic bead coupling see example 1.

And (4) transposase assembly. And taking 20 mu L of linker-coupled streptavidin magnetic beads or carboxyl magnetic beads, adding 1 mu L, 2 mu L, 4 mu L, 8 mu L and 16 mu L Lucigen EZ-Tn5 respectively, and performing rotary incubation for 1 h at room temperature.

The subsequent reaction was the same as in example 1.

After annealing was completed, linker magnetic bead coupling and library construction were performed as in example 1. The library concentration was determined using Qubit and the Qsep examined the library size distribution.

As a result, as shown in FIGS. 16 and 17, the yield of the library was the highest when the amount of EZ-Tn5 input was 8. mu.L. And the input amount of Tn5 has little influence on the size distribution of the DNA library. This indicates that Tn 5-coupled magnetic beads have a broader selectable range of transposase input in DNA library construction.

Example 9: effect of fragmentation enhancers on DNA banking.

In example 8, the effect of the amount of EZ-Tn5 input on DNA library construction was verified. This example demonstrates the effect of fragmentation enhancers on library construction under this condition. The specific implementation mode is as follows:

linker annealing and bead coupling Tn5 see example 1.

And (4) transposase assembly. And adding 4 mu L Lucigen EZ-Tn5 into 20 mu L of streptavidin magnetic beads or carboxyl magnetic beads coupled with the joint, and performing rotary incubation at room temperature for 1 h, and storing at-20 ℃ for later use.

And (5) DNA fragmentation.

TABLE 16

Components	Dosage of
		Magnetic beads coupled with transposase	4 µL
Different 5 Xfragmentation buffers	4 µL
		Genomic DNA
	10 µg
		Make up water to	20 µL

5 × fragmentation buffer conditions were as follows:

TABLE 17

Condition	Formulation of
		1	50 mM TAPS-NaOH, 25 mM MgCl。
2	50 mM TAPS-NaOH, 25 mM MgCl，20% PEG 8000。
		3	50 mM TAPS-NaOH, 25 mM MgCl，30% PEG 8000。
4	50 mM TAPS-NaOH, 25 mM MgCl，40% PEG 8000。
		5	50 mM TAPS-NaOH, 25 mM MgCl，50% PEG 8000。
6	50 mM TAPS-NaOH, 25 mM MgCl, 1% polyethyleneimine.
		7	50 mM TAPS-NaOH, 25 mM MgCl, 2% polyethyleneimine.
8	50 mM TAPS-NaOH, 25 mM MgCl, 4% polyethyleneimine.
		9	50 mM TAPS-NaOH, 25 mM MgCl, 8% polyethyleneimine.
10	50 mM TAPS-NaOH, 25 mM MgCl, 40% PEG 8000, 2% polyethyleneimine.
		11	50 mM TAPS-NaOH, 25 mM MgCl, 40% PEG 8000, 4% polyethyleneimine.
12	50 mM TAPS-NaOH, 25 mM MgCl, 40% PEG 8000, 8% polyethyleneimine.

The subsequent reaction was the same as in example 1.

As shown in FIG. 18, PEG 8000 and polyethyleneimine can effectively promote the fragmentation of the Tn5 coupled magnetic beads on the DNA substrate, thereby improving the yield of the DNA library. Wherein the final reaction concentration is 8 percent PEG 8000 and 0.8 percent polyethyleneimine, and the effect is most obvious.

Example 10: the effect of fragmentation time on DNA banking.

In example 9, the effect of different fragmentation enhancers on DNA pooling was verified. In this example, the effect of different fragmentation times on library construction was verified under this condition. The specific implementation mode is as follows:

linker annealing and bead coupling Tn5 see example 1.

And (5) DNA fragmentation.

Watch 18

Components	Dosage of
		Magnetic beads coupled with transposase	4 µL
5 Xfragmentation buffer 11	4 µL
		Genomic DNA
	10 µg
		Make up water to	20 µL

Rotating at 55 deg.C for 10 min, 20 min, 30 min, 60 min, and 120 min.

The subsequent reaction was the same as in example 1.

As shown in fig. 19 and 20, the longer the fragmentation time, the higher the library yield, and the library yield remained almost unchanged until the fragmentation time exceeded 30 min. The Qsep results show that fragmentation time has little effect on the size distribution of the library. This indicates that Tn5 coupled magnetic bead-mediated DNA library construction has good homogeneity and can tolerate a wide range of fragmentation times.

Example 11: influence of fragmentation termination reaction conditions on DNA banking.

In example 10, the effect of fragmentation time on DNA banking was verified. In this example, the effect of fragmentation termination reaction conditions on DNA pooling was verified. The specific implementation mode is as follows:

linker annealing and bead coupling Tn5 see example 1.

And (5) DNA fragmentation.

Watch 19

Incubate 30 min at 55 degrees rotation.

Fragmentation termination conditions were as follows:

condition 1: the centrifuge tubes were placed on a magnetic separation rack, the supernatant was removed, and 20 μ L TE (10 mM Tris, 1 mM EDTA, pH 8.0) was added.

Condition 2: 20 μ L stop buffer (1% SDS, 10 mM EDTA, pH 8.0) was added and the incubation was performed for 10 min at room temperature with rotation. The beads were washed twice with 100. mu.L TE and 20. mu.L TE (10 mM Tris, 1 mM EDTA, pH 8.0) was added.

Condition 3: the centrifuge tubes were placed on a magnetic separation rack, the supernatant was removed, 20 μ L of stop buffer (1% SDS, 10 mM EDTA, pH 8.0) and 1 μ L of proteinase K were added, and the incubation was performed for 10 min with rotation at room temperature. The beads were washed twice with 100. mu.L TE and 20. mu.L TE (10 mM Tris, 1 mM EDTA, pH 8.0) was added.

Library amplification was the same as in example 1.

As shown in FIG. 21, the 1% SDS and 10 mM EDTA used in Condition 2 gave higher library yields on DNA pooling after termination of Tn 5.

Example 12: traditional Tn5, linear linker mediated Tn5 coupled magnetic beads and DOT-seq mediated DNA library construction comparison

In examples 1-10, the entire procedure for the complete U-linker mediated Tn 5-coupled magnetic beads on DNA pooling was explored and the procedure was named DOT-seq (see FIG. 22 for a flow comparison). In this example, the differences in library yield and library homogeneity of conventional Tn5, linear linker-mediated Tn5 coupled magnetic beads, and U-linker-mediated Tn5 coupled magnetic beads-mediated DNA banking were compared. The specific implementation mode is as follows:

1) traditional Tn 5-mediated DNA banking.

Tn5 transposase assembly. And E, assembling joints of EZ-Tn5 of Lucigen according to the instruction, and diluting to 1U/mu L for later use.

And (4) fragmenting.

Watch 20

Components	Dosage of
		DNA	10 µg
5 Xfragmentation buffer 1	5 µL
		1 U/µL EZ-Tn5	10 µL
Make up water to	50 µL

After the reaction at 55 degrees for 10 min, 10 μ L of termination buffer solution was added, and the reaction at 55 degrees for 10 min.

After the reaction, 50 μ L of Hieff NGS DNA Selection Beads (Yeasen, 12601) were added, thoroughly blown and mixed, and incubated at room temperature for 5 min. The PCR tube was placed in a magnetic rack to separate the beads from the liquid, and after the solution was clarified (about 3 min), the supernatant was carefully removed. The PCR tube was kept in the magnetic frame, and the beads were rinsed by adding 200. mu.L of clean free H2O freshly prepared 80% ethanol, incubated at room temperature for 30 sec, and the supernatant carefully removed. The rinsing was repeated once. The residual liquid was blotted off with a 10. mu.L pipette. The PCR tube was kept in the magnetic stand all the time, and the magnetic beads were dried with the lid open at room temperature (5 min). Add 22. mu.L of ddH2O, blow to mix well, and let stand at room temperature for 5 min. The PCR tube was briefly centrifuged and placed in a magnetic stand to stand, after the solution cleared (about 5 min), 20. mu.L of the supernatant was carefully removed to a new PCR tube.

And (4) amplifying the library. Library amplification was performed using the Hieff NGS @ Fast DNA Library for Illumina Kit of an assist holy organism (Cat # 12207).

TABLE 21

Components	Dosage of
		2×Ultima Amplification Mix	25 µL
Primer mix
		3 µL
Primer 5xx			1 µL
	Primer 7xx	1 µL
DNA obtained in the previous step			20 µL
	Total volume
		50 µL

TABLE 22

Adding 45 mu L of Hieff NGS DNA Selection Beads (Yeasen, 12601), and recovering the library according to the magnetic bead recovery mode. Eluting with 22 muL water. The library concentration was determined using Qubit and the Qsep examined the library size distribution. Library sequencing was performed using the Illumina NovaSeq 6000 platform.

2) The linear linker mediates the Tn5 coupled magnetic bead DNA library construction method. DNA library construction was performed using the linear linker described in example 2 and EZ-Tn5 inputs described in example 7.

And (5) DNA fragmentation.

TABLE 23

Components	Dosage of
		Magnetic beads coupled with transposase	5 µL
5 Xfragmentation buffer 11	4 µL
		Genomic DNA
	10 ng
		Make up water to	20 µL

The cells were incubated at 55 ℃ for 30 min with rotation.

After the reaction was completed, 20. mu.L of stop buffer (1% SDS, 10 mM EDTA, pH 8.0) was added, and the incubation was performed for 10 min at room temperature with rotation. The beads were washed twice with 100. mu.L TE and 20. mu.L TE (10 mM Tris, 1 mM EDTA, pH 8.0) was added.

Watch 24

TABLE 25

3) U-shaped linkers mediate the Tn5 coupled magnetic bead DNA library construction method (DOT-seq). DNA library construction was performed using the U-linker described in example 6 and the amount of EZ-Tn5 input described in example 7.

And (5) DNA fragmentation.

Watch 26

The cells were incubated at 55 ℃ for 30 min with rotation.

Watch 27

Watch 28

As shown in FIGS. 23, 24, DOT-seq has higher library yield and more focused library size compared to other library construction methods. This demonstrates that DOT-seq has better library homogeneity and higher library efficiency compared to other Tn 5-mediated DNA library construction techniques. Sequencing data show that DOT-seq is more uniform than other techniques in sequencing data ratio distribution and GC content (see FIG. 25 and FIG. 26), which indicates that DOT-seq can effectively utilize the input DNA template and the loss of the DNA template in the library building process is less. The DNA library constructed by using DOT-seq can ensure the coverage efficiency of data when the sequencing data volume is low. This also indicates that the DOT-seq has less preference in the process of library construction.

Example 13: library construction effect of DOT-seq on different DNA input amounts.

In this example, the library construction effect of U-linker mediated Tn 5-coupled magnetic beads on different DNA input amounts was compared. The number of PCR cycles and yields for the amount of library input are given in the following table:

watch 29

As shown in FIG. 27 and Table 29, conventional Tn 5-mediated DNA banking is very sensitive to DNA input, where too much DNA input results in a larger library, too little DNA input results in a smaller library, and the library yield is significantly reduced. The Tn5 magnetic beads coupled by the U-shaped joint can effectively construct a uniform library with concentrated fragment sizes under the DNA input amount of 50 pg-1 mug, and the library yield is high. This indicates that the Tn5 magnetic bead method with U-shaped linker coupling to construct DNA library has wider selectable range for DNA input.

Example 14: DOT-seq has the library building effect on FFPE DNA with different qualities.

In this example, we tested the effect of DOT-seq procedure on the pooling of different quality FFPE DNA samples. The FFPE DNA sample quality, PCR cycle number and yield for the library input are given in the following table:

watch 30

FFPE DNA	DIN value	Input amount	Number of cycles	Yield/ng
					1	7.3	10 ng	7	945
2	5.9	10 ng	7	892
					3	5.1	10 ng	8	873
4	3.5	10 ng	8	635
					5	2.3	10 ng	9	429
6	2.1	10 ng	9	353

As shown in Table 30 and FIG. 28, DOT-seq can construct high-quality libraries with uniform library size distribution for different-quality FFPE DNA samples, which indicates that DOT-seq has a wider selection range for the input amount and quality of the template DNA.

Example 15: influence of different U-shaped joint coupling ratio magnetic beads on DNA library building.

In this example, libraries of different sizes were constructed with different coupling ratios of U-linkers, as follows:

1) annealing the U-shaped joint:

watch 31

Components	Dosage of
		100 µM U-Amino-adaptor 1	1 µL
100 µM Reverse primer 9	8 µL
		100 µM Reverse primer 10	8 µL
10× annealing buffer	2 µL
		Make up water to	20 µL

200 muL of carboxyl magnetic beads are taken and added into the

heterogeneous linker mixture

1, 2, 4, 8, 16 and 32 muL respectively, and 1 mL of 0.2M MES, 900 muL of 100 mM EDC and 100 muL of 100 mM NHS are added. Incubate at room temperature for 24 h with rotation. The magnetic beads were washed 3 times with a magnetic bead binding buffer containing 0.5% Tween 20, suspended with 200. mu.L transposase binding buffer, and stored at-20 degrees for further use.

4) And (5) DNA fragmentation.

Watch 32

The cells were incubated at 55 ℃ for 30 min with rotation.

5) And (4) amplifying the library. Library amplification was performed using the Hieff NGS @ Fast DNA Library for Illumina Kit of an assist holy organism (Cat # 12207).

Watch 33

Watch 34

Adding 45 mu L of Hieff NGS DNA Selection Beads (Yeasen, 12601), and recovering the library according to the magnetic bead recovery mode. Eluting with 22 muL water. The library concentration was determined using Qubit and the Qsep examined the library size distribution.

As shown in FIG. 29, the higher the U-linker input, the smaller the fragments of the library, and the library exhibited significant library size uniformity at different U-linker inputs. This result indicates that DOT-seq can obtain homogeneous libraries for constructing different fragment sizes by adjusting the proportion of coupling U-shaped linkers to meet different library construction requirements. This also expands the scope of application of DOT-seq.

The above examples are provided to those of ordinary skill in the art to fully disclose and describe how to make and use the claimed embodiments, and are not intended to limit the scope of the disclosure herein. Modifications apparent to those skilled in the art are intended to be within the scope of the appended claims.

Sequence listing

<110> Histo Histoste of next (Shanghai) Ltd

<120> DNA linker for binding magnetic beads and coupling transposase, novel magnetic beads and DOT-seq method

<141> 2021-06-28

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 1

tttttttttt ttttttcgtc ggcagcgtca gatgtgtata agagacag 48

<210> 2

<211> 49

<212> DNA

<213> Artificial Sequence

<400> 2

tttttttttt tttttgtctc gtgggctcgg agatgtgtat aagagacag 49

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 3

ctgtctctta tacacatct 19

<210> 4

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 4

tttttttttt ttttttcgtc ggcagcgtca gatgtgtata agagacag 48

<210> 5

<211> 49

<212> DNA

<213> Artificial Sequence

<400> 5

tttttttttt tttttgtctc gtgggctcgg agatgtgtat aagagacag 49

<210> 6

<211> 75

<212> DNA

<213> Artificial Sequence

<400> 6

ctgtctctta tacacatctc cgagcccacg agactttttt tttcgtcggc agcgtcagat 60

gtgtataaga gacag 75

<210> 7

<211> 75

<212> DNA

<213> Artificial Sequence

<400> 7

ctgtctctta tacacatctc cgagcccacg agactttttt tttcgtcggc agcgtcagat 60

gtgtataaga gacag 75

<210> 8

<211> 81

<212> DNA

<213> Artificial Sequence

<400> 8

ctgtctctta tacacatctc cgagcccacg agactttttt tttttttttc gtcggcagcg 60

tcagatgtgt ataagagaca g 81

<210> 9

<211> 87

<212> DNA

<213> Artificial Sequence

<400> 9

ctgtctctta tacacatctc cgagcccacg agactttttt tttttttttt tttttcgtcg 60

gcagcgtcag atgtgtataa gagacag 87

<210> 10

<211> 93

<212> DNA

<213> Artificial Sequence

<400> 10

ctgtctctta tacacatctc cgagcccacg agactttttt tttttttttt tttttttttt 60

tcgtcggcag cgtcagatgt gtataagaga cag 93

<210> 11

<211> 99

<212> DNA

<213> Artificial Sequence

<400> 11

ctgtctctta tacacatctc cgagcccacg agactttttt tttttttttt tttttttttt 60

tttttttcgt cggcagcgtc agatgtgtat aagagacag 99

<210> 12

<211> 35

<212> DNA

<213> Artificial Sequence

<400> 12

agtctcgtgg gctcggagat gtgtataaga gacag 35

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 13

ctgtctctta tacacatct 19

<210> 14

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 14

ctgtctctta tacacatctg acg 23

<210> 15

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 15

ctgtctctta tacacatctg acgctgc 27

<210> 16

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 16

ctgtctctta tacacatctg acgctgccga 30

<210> 17

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 17

ctgtctctta tacacatctg acgctgccga cga 33

Claims

1. A DNA joint used for combining magnetic beads and coupling transposase is a U-shaped joint, the middle sequence of the joint is an oligomeric single-stranded nucleotide which is modified to be connected to the magnetic beads, two ends of the oligomeric single-stranded nucleotide are respectively provided with a double-stranded Tn5 recognition sequence, and a P5 sequence and a P7 sequence of an illumina sequencing library structure are respectively connected behind the Tn5 recognition sequences at the two ends.

2. The DNA linker of claim 1, characterized in that: the oligonucleotide in the middle of the U-shaped joint is modified by biotin, amino or Arcydite.

3. The DNA linker of claim 2, characterized in that: the length of the oligonucleotide single-stranded nucleotide in the middle of the U-shaped joint is 8-32 nt.

4. The DNA linker of claim 1 or 2, characterized in that: the sequence of the U-shaped joint is as follows: [ Phos ] is]CTGTCTCTTATACACATCTCCGAGC CCACGAGACT…T[Int NH2 C6 dT]T … TC GTCGGCAGCGTCAGATGTGTATAAGAGA CAG, wherein the length of the oligonucleotide single-stranded nucleotide in the middle of the U-shaped joint is 8-32 nt.

5. The DNA linker of claim 1 or 2, characterized in that: the sequence of the U-shaped joint is as follows: [ Phos ] is]CTGTCTCTTATACACATCTCCGAGC CCACGAGACT…T[Int Biotin dT]T … TC GTCGGCAGCGTCAGATGTGTATAAGAGA CAG, wherein the length of the oligonucleotide single-stranded nucleotide in the middle of the U-shaped joint is 8-32 nt.

6. A novel magnetic bead for coupling transposase, comprising a magnetic bead, and the DNA linker of any one of claims 1-5 bound to the magnetic bead.

7. The novel magnetic bead of claim 6, wherein: the magnetic beads are streptavidin magnetic beads, carboxyl magnetic beads or polyacrylamide coated magnetic beads; when the magnetic beads are streptavidin magnetic beads, the DNA joints are modified by biotin; when the magnetic beads are carboxyl magnetic beads, the DNA joints are modified by amino; when the magnetic beads are polyacrylamide coated magnetic beads, the DNA joints are Arcydite modified.

8. A DOT-seq method comprising the steps of:

(1) coupling the magnetic beads with the annealed DNA linkers to obtain linker-coupled magnetic beads, wherein the DNA linkers are the DNA linkers of any one of claims 1-5;

9. The DOT-seq method of claim 8, wherein: when the magnetic beads in the step (1) are carboxyl magnetic beads and the DNA joint is modified by amino, adding an activating agent in the step (1) to complete coupling, wherein the activating agent is one or more of morpholine ethanesulfonic acid (MES), N-Dimethylacetamide (DMAC), N-hydroxysuccinimide (NHS) and 1-ethyl- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDC).

10. The DOT-seq method of claim 8, wherein: and (3) adding an enhancer, wherein the enhancer is one or more of polyethylene glycol, polysucrose, polypropylene glycol and polyethyleneimine.