CN113249223A

CN113249223A - Application of leishmania transformed with expression plasmid in promotion of DC maturation, method for promoting DC maturation, and expression plasmid

Info

Publication number: CN113249223A
Application number: CN202110521400.7A
Authority: CN
Inventors: 王金勇; 文慧虹; 凌达凯; 彭敏桦; 于江天
Original assignee: Shenzhen International Institute For Biomedical Research
Current assignee: Shenzhen International Institute For Biomedical Research
Priority date: 2021-05-13
Filing date: 2021-05-13
Publication date: 2021-08-13

Abstract

The invention discloses application of Leishmania transformed with an expression plasmid in promotion of DC maturation, a DC maturation promotion method and the expression plasmid, wherein the expression plasmid contains at least one of a tumor-associated protein coding sequence, a tumor-associated polypeptide coding sequence and a tumor-specific antigen coding sequence. Leishmania transformed with the expression plasmid can infect DC in a targeting way and promote the maturation of the DC, thereby enhancing the effect of killing tumor cells by an immune system of an organism.

Description

Application of leishmania transformed with expression plasmid in promotion of DC maturation, method for promoting DC maturation, and expression plasmid

Technical Field

The invention relates to the technical field of tumor immunology, in particular to application of Leishmania transformed with an expression plasmid in promotion of DC maturation, a DC maturation promotion method and the expression plasmid.

Background

Most antigens need to be taken up, processed, internalized and presented by Antigen Presenting Cells (APCs) to be recognized by T cell receptors and thus promote T cell activation and proliferation. In recent years, Dendritic Cells (DCs) have been the focus of much attention in the field of tumor therapy as the most antigen-presenting APC, the only one that activates naive T cells. Most of DC in human body are in immature state, the DC in immature state expresses low level of costimulatory factor and adhesion factor, and the capability of inducing organism to generate immune response is low. However, immature DC have a very strong antigen phagocytic ability, and can be activated by inflammatory factors or internalized antigens, and the like, and become mature. The matured DCs express surface histocompatibility complex molecules (MHC-I/II) at a high level, and the taken antigen peptides are presented to T cells through MHC-I/II antigen presenting molecules, thereby activating the immune system of the body to kill tumor cells. Therefore, if immature DCs in the body are extracted to activate the maturation of the DCs, and then the mature DCs are returned to the body, the efficiency of the DCs for activating T cells is improved, and a stronger anti-tumor immune response is generated. However, the prior art has poor effect of activating DC maturation, thereby reducing the effect of DC activating immune system to kill tumor cells.

The above is only for the purpose of assisting understanding of the technical solutions of the present invention, and does not represent an admission that the above is the prior art.

Disclosure of Invention

The invention mainly aims to provide application of Leishmania transformed with expression plasmids in promotion of DC maturation, a DC maturation promotion method and expression plasmids, and aims to improve the effect of activating DC maturation and further enhance the effect of killing tumor cells by an immune system.

In order to achieve the above objects, the present invention provides, in a first aspect, the use of Leishmania transformed with an expression plasmid for promoting DC maturation.

Optionally, the expression plasmid comprises at least one of a tumor associated protein coding sequence, a tumor associated polypeptide coding sequence, a tumor specific antigen coding sequence.

Optionally, the expression plasmid comprises an ORF of ENO1 or an ORF of MUC 1.

Alternatively, the ORF sequence of ENO1 is as set forth in SEQ ID No: 1, the ORF sequence of the MUC1 is shown as SEQ ID No: 2, respectively.

In a second aspect, the present invention also provides a method for promoting DC maturation, comprising the steps of:

(1) transforming the expression plasmid into leishmania;

(2) infecting said leishmania infected DCs with said expression plasmid;

wherein, the expression plasmid contains at least one of a tumor-associated protein coding sequence, a tumor-associated polypeptide coding sequence and a tumor-specific antigen coding sequence.

Optionally, the expression plasmid comprises an ORF of ENO1 or an ORF of MUC 1.

In a third aspect, the present invention also provides an expression plasmid for transforming leishmania, wherein the leishmania transformed with the expression plasmid promotes DC maturation, wherein the expression plasmid comprises at least one of a tumor-associated protein coding sequence, a tumor-associated polypeptide coding sequence, and a tumor-specific antigen coding sequence.

Optionally, the expression plasmid comprises an ORF of ENO1 or an ORF of MUC 1.

The invention provides application of Leishmania transformed with an expression plasmid in promotion of DC maturation, a DC maturation promotion method and the expression plasmid, wherein the expression plasmid contains at least one of a tumor-associated protein coding sequence, a tumor-associated polypeptide coding sequence and a tumor-specific antigen coding sequence. Thus, leishmania targetedly infects DC, DC is stimulated by leishmania to produce a large amount of inflammatory factors, meanwhile, expression plasmids in the leishmania body express tumor-associated proteins, tumor-associated polypeptides or tumor-specific antigens at high levels, immature DC take up and internalize expressed proteins/polypeptides in large amounts, inflammatory factors and DC internalized proteins/polypeptides induce DC maturation; presenting tumor-related protein/polypeptide or specific antigen to T cells by the mature DC, secreting Th1 type cell factor IFN-gamma, inducing and activating T cells to clone, and further activating the immune system of an organism to kill tumor cells; thus, immature DCs are efficiently induced to mature by Leishmania transformed with the expression plasmid, enhancing the effect of the body's immune system in eliminating tumor cells.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the structures shown in the drawings without creative efforts.

FIG. 1 is a plasmid map of p6.5MCS plasmid;

FIG. 2 is a set of graphs showing the results of gel electrophoresis of ENO1 in example I;

FIG. 3 is a graph showing the results of qRT-PCR of ENO1 in example two;

FIG. 4 is a graph of the qRT-PCR results of MUC1 in example two;

FIG. 5 is a graph showing Western blotting results of ENO1 in example two;

FIG. 6 is a graph showing the results of flow cytometry detection of ENO1 in example three;

FIG. 7 is a graph comparing the results of the MFI analysis of ENO1 in example III;

FIG. 8 is a graph comparing the results of MFI analysis of the deactivated group of ENO1 in example III;

FIG. 9 is a graph showing the results of flow cytometry analysis of MUC1 in example three.

The implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.

Detailed Description

It should be noted that if the description of "first", "second", etc. is provided in the embodiment of the present invention, the description of "first", "second", etc. is only for descriptive purposes and is not to be construed as indicating or implying relative importance or implicitly indicating the number of indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In addition, the meaning of "and/or" appearing throughout is to include three juxtapositions, exemplified by "A and/or B" including either scheme A, or scheme B, or a scheme in which both A and B are satisfied.

The invention provides an application of Leishmania transformed with an expression plasmid in promoting DC maturation.

In the application of the invention, the expression plasmid can shuttle to the Escherichia coli and propagate in the Escherichia coli in a large amount. The expression plasmid can also be shuttled to leishmania and express foreign genes at high levels within the leishmania. The exogenous gene can be at least one of a tumor-associated protein coding sequence, a tumor-associated polypeptide coding sequence and a tumor-specific antigen coding sequence. The kind of the expression plasmid is various. For example, the expression plasmid may be at least one of p6.5MCS plasmid, pX63NEO (Hyg) plasmid, pHM plasmid, pTEX plasmid, cLNEO (Hyg) plasmid, and pALT-NEO plasmid. The Leishmania may be at least one of Leishmania amazonensis LV78(MPRO/BR/72/M1845), Leishmania major (LV39), Leishmania donovani (LV39), Leishmania brasiliensis and Leishmania infantum. Any Leishmania that can target infection of DCs and can be transferred into expression plasmids is within the scope of the present invention.

The invention provides application of Leishmania transformed with expression plasmids in promotion of DC maturation. The expression plasmid contains at least one of a tumor-associated protein coding sequence, a tumor-associated polypeptide coding sequence and a tumor-specific antigen coding sequence. Thus, leishmania targetedly infects DC, DC is stimulated by leishmania to produce a large amount of inflammatory factors, meanwhile, expression plasmids in the leishmania body express tumor-associated proteins, tumor-associated polypeptides or tumor-specific antigens at high levels, immature DC take up and internalize expressed proteins/polypeptides in large amounts, inflammatory factors and DC internalized proteins/polypeptides induce DC maturation; presenting tumor-related protein/polypeptide or specific antigen to T cells by the mature DC, secreting Th1 type cell factor IFN-gamma, inducing and activating T cells to clone, and further activating the immune system of an organism to kill tumor cells; thus, immature DCs are efficiently induced to mature by Leishmania transformed with the expression plasmid, enhancing the effect of the body's immune system in eliminating tumor cells.

The types of the tumor-associated proteins, tumor-associated polypeptides, and tumor-specific antigens are very diverse. Optionally, the expression plasmid comprises an ORF of ENO1 or an ORF of MUC 1. ENO1 is an important protein in the process of tumor metastasis, can cause specific immune response in tumors, and is a potential target for cancer immunotherapy. ENO1 belongs to an autoantigen, and healthy people have only low or no levels of ENO1 antibodies. Clinically, however, high levels of autoantibodies against ENO1 can be detected in the blood of many neoplastic and autoimmune disease patients. The ENO1 can induce the activation of the immune system of the body and generate antigen-specific CD4⁺And CD8⁺T cell responses. MUC1 is a type I transmembrane protein, normally expressed predominantly in the abluminal or glandular surface of epithelial cells, expressed apically, and distributed in polarity. MUC1 is also expressed in various cells of the hematopoietic system (e.g., T, B, DC). In most epithelial malignant tumors, the expression of MUC1 is abnormal, the expression level is increased by more than 100 times, the distribution of MUC1 protein on the cell surface is changed, the expression polarity is lost, the protein glycosylation is not complete, and new sugar chains and peptide epitopes are presented. The present study demonstrated that MUC1 antigen can specifically induce T cell proliferation and interferon gamma secretion. Thus, MUC1 is considered as a target for immunotherapy.

Alternatively, the ORF sequence of ENO1 is as set forth in SEQ ID No: 1, the ORF sequence of the MUC1 is shown as SEQ ID No: 2, respectively. The ORF sequence of ENO1 may also differ from SEQ ID No: 1, and the ORF sequence of MUC1 may also differ from the sequence of SEQ ID No: 2.

SEQ ID No: 1 is as follows:

GGATCCATGTCTATTCTCAGGATCCACGCCAGAGAGATCTTTGACTCCCGTGGGAATCCCACTGTTGAGGTCGATCTGTACACCGCAAAAGGTCTCTTCCGAGCTGCGGTGCCCAGCGGTGCGTCCACTGGCATCTACGAGGCCCTAGAACTCCGAGACAATGATAAGACCCGCTTCATGGGGAAGGGTGTCTCACAGGCTGTTGAGCACATCAATAAAACTATTGCGCCTGCTCTGGTTAGCAAGAAAGTGAATGTTGTGGAGCAAGAGAAGATTGACAAGCTGATGATCGAGATGGACGGCACAGAGAATAAATCTAAATTTGGTGCAAATGCCATCCTGGGAGTGTCCCTGGCTGTCTGCAAAGCTGGTGCCGTGGAAAAGGGGGTGCCCCTTTACCGCCACATTGCTGACTTGGCCGGCAACCCTGAAGTCATCCTGCCTGTCCCGGCTTTCAATGTGATCAACGGTGGTTCTCATGCTGGCAACAAGCTGGCCATGCAAGAGTTCATGATCCTGCCTGTGGGGGCATCCAGCTTCCGGGAAGCCATGCGCATTGGAGCAGAGGTTTACCACAACCTGAAGAACGTGATCAAGGAGAAGTACGGGAAGGACGCCACCAATGTGGGTGATGAGGGTGGATTCGCACCTAACATCCTGGAGAACAAAGAAGCACTGGAGCTGCTCAAGACTGCAATCGCAAAGGCCGGCTACACTGACCAGGTTGTCATTGGCATGGATGTGGCTGCCTCCGAGTTCTACAGGTCTGGCAAGTATGACCTGGACTTCAAGTCTCCGGATGACCCCAGCAGGTACATCACTCCCGACCAGCTGGCTGATCTGTACAAGTCCTTCGTCCAGAACTACCCAGTGGTGTCCATCGAAGATCCCTTTGACCAGGACGACTGGGGCGCCTGGCAGAAGTTCACGGCTAGTGCGGGCATCCAGGTGGTGGGCGATGACCTCACAGTGACCAACCCTAAGCGGATTGCCAAGGCTGCGAGCGAGAAGTCCTGCAACTGCCTCTTGCTCAAAGTGAACCAGATCGGCTCTGTGACCGAATCCCTGCAGGCGTGTAAGCTGGCCCAATCCAATGGCTGGGGCGTCATGGTGTCCCACCGATCTGGGGAAACTGAGGACACTTTCATCGCAGACCTGGTGGTGGGGCTCTGCACTGGGCAGATCAAGACTGGTGCCCCTTGCCGATCCGAGCGCCTGGCCAAGTACAATCAGATCCTCAGAATTGAGGAAGAGCTGGGCAGCAAAGCCAAGTTTGCTGGCAGGTCCTTCAGGAACCCCCTGGCCAAATAAGGATCC

SEQ ID No: 2 is as follows:

ATGACCCCGGGCATTCGGGCTCCTTTCTTCCTGCTGCTACTTCTAGCAAGTCTAAAAGGTTTTCTTGCCCTTCCAAGTGAGGAAAACAGTGTCACCTCATCTCAGGACACCAGCAGTTCCTTAGCATCGACTACCACTCCAGTCCACAGCAGCAACTCAGACCCAGCCACCAGACCTCCAGGGGACTCCACCAGCTCTCCAGTCCAGAGTAGCACCTCTTCTCCAGCCACCAGAGCTCCTGAAGACTCTACCAGTACTGCAGTCCTCAGTGGCACCTCCTCCCCAGCCACCACAGCTCCAGTGAACTCCGCCAGCTCTCCAGTAGCCCATGGTGACACCTCTTCCCCAGCCACTAGCCTTTCAAAAGACTCCAACAGCTCTCCAGTAGTCCACAGTGGCACCTCTTCAGCTCCGGCCACCACAGCTCCAGTGGATTCCACCAGCTCTCCAGTAGTCCACGGTGGTACCTCGTCCCCAGCCACCAGCCCTCCAGGGGACTCCACCAGCTCTCCAGACCATAGTAGCACCTCTTCTCCAGCCACCAGAGCTCCCGAAGACTCTACCAGTACTGCAGTCCTCAGTGGCACCTCCTCCCCAGCCACCACAGCTCCAGTGGACTCCACCAGCTCTCCAGTAGCCCATGATGACACCTCTTCCCCAGCCACTAGCCTTTCAGAAGACTCCGCCAGCTCTCCAGTAGCCCACGGTGGCACCTCTTCTCCAGCCACCAGCCCTCTAAGGGACTCCACCAGTTCTCCAGTCCACAGTAGTGCCTCCATCCAAAACATCAAGACTACATCAGACTTAGCTAGCACTCCAGACCACAATGGCACCTCAGTCACAACTACCAGCTCTGCACTGGGCTCAGCCACCAGTCCAGACCACAGTGGTACCTCAACTACAACTAACAGCTCTGAATCAGTCTTGGCCACCACTCCAGTTTACAGTAGCATGCCATTCTCTACTACCAAAGTGACGTCAGGCTCAGCTATCATTCCAGACCACAATGGCTCCTCGGTGCTACCTACCAGTTCTGTGTTGGGCTCAGCTACCAGTCTAGTCTATAATACCTCTGCAATAGCTACAACTCCAGTCAGCAATGGCACTCAGCCTTCAGTGCCAAGTCAATACCCTGTTTCTCCTACCATGGCCACCACCTCCAGCCACAGCACTATTGCCAGCAGCTCTTACTATAGCACAGTACCATTTTCTACCTTCTCCAGTAACAGTTCACCCCAGTTGTCTGTTGGGGTCTCCTTCTTCTTCTTGTCTTTTTACATTCAAAACCACCCATTTAATTCTTCTCTGGAAGACCCCAGCTCCAACTACTACCAAGAACTGAAGAGGAACATTTCTGGATTGTTTCTGCAGATTTTTAACGGAGATTTTCTGGGGATCTCTAGCATCAAGTTCAGGTCAGGCTCCGTGGTGGTAGAATCGACTGTGGTTTTCCGGGAGGGTACTTTTAGTGCCTCTGACGTGAAGTCACAGCTTATACAGCATAAGAAGGAGGCAGATGACTATAATCTGACTATTTCAGAAGTCAAAGTGAATGAGATGCAGTTCCCTCCCTCTGCCCAGTCCCGGCCGGGGGTACCAGGCTGGGGCATTGCCCTGCTGGTGCTGGTCTGTATTTTGGTTGCTTTGGCTATCGTCTATTTCCTTGCCCTGGCAGTGTGCCAGTGCCGCCGAAAGAGCTATGGGCAGCTGGACATCTTTCCAACCCAGGACACCTACCATCCTATGAGTGAATACCCTACCTACCACACTCACGGACGCTACGTGCCCCCTGGCAGTACCAAGCGTAGCCCCTATGAGGAGGTTTCGGCAGGTAATGGCAGTAGCAGTCTCTCTTATACCAACCCAGCTGTGGTGACCACTTCTGCCAACTTGTAG

the invention also provides a method for promoting DC maturation, which comprises the following steps: (1) transforming the expression plasmid into leishmania; (2) infecting said leishmania infected DCs with said expression plasmid; wherein, the expression plasmid contains at least one of a tumor-associated protein coding sequence, a tumor-associated polypeptide coding sequence and a tumor-specific antigen coding sequence.

The specific steps of the method of the present invention refer to the following embodiments, which are not described herein. The method for promoting DC maturation can effectively induce DC maturation, thereby effectively activating the immune system of an organism to kill tumor cells and enhancing the effect of the immune system of the organism to eliminate the tumor cells.

The invention also provides an expression plasmid, which is used for transforming leishmania, and the leishmania transformed with the expression plasmid promotes DC maturation, wherein the expression plasmid comprises at least one of a tumor-associated protein coding sequence, a tumor-associated polypeptide coding sequence and a tumor-specific antigen coding sequence. The expression plasmid of the invention can freely shuttle to Leishmania and can express tumor-associated protein, polypeptide or specific antigen at high level. The protein/polypeptide expressed by the expression plasmid can be greatly taken up and internalized by immature DC, so that the maturation of the DC is effectively induced, and the immune system of an organism is activated to kill tumor cells.

Example one construction of expression plasmid

The expression plasmid is constructed by adopting p6.5MCS plasmid. Referring to FIG. 1, the total length of p6.5MCS plasmid is 9185bp, and includes a partial sequence of pBluescript plasmid, a Multiple Cloning Site (MCS) and a partial gene sequence of Leishmania. The part sequence of the pBluescript plasmid contains an Ampicillin resistant (Ampicillin) gene sequence. The partial gene sequence of Leishmania contains N-acetylglucosamine-1-phosphotransferase (NAGT) sequence, which is used for expressing and mediating leishmania to generate resistance to Tunicamycin (Tunicamycin).

The construction of the expression plasmid is as follows (using ENO1 as an example):

(1) carrying out enzyme digestion on the purified p6.5MCS plasmid by using BamHI enzyme, and carrying out enzyme digestion at 37 ℃ overnight;

(2) carrying out agarose gel electrophoresis detection on the enzyme digestion product, and recovering a target band to obtain a linearized p6.5MCS vector (9185 bp);

(3) extracting RNA of a mouse, carrying out reverse transcription, PCR amplification and purification to obtain an ORF fragment (1344bp) of the murine ENO1 gene;

(4) connecting the ENO1 and the digested p6.5MCS plasmid by using the seamless cloning kit to obtain an expression vector p6.5MCS-ENO 1;

(6) transferring the expression plasmid into escherichia coli (adding ampicillin into the culture medium);

(5) PCR identification of positive clone of bacterial liquid;

(6) sequencing positive clones, and comparing and analyzing a sequencing result with a target gene sequence;

(7) the positive clones were cultured overnight at 37 ℃ (ampicillin was added to the medium);

(8) carrying out PCR identification on positive clones by using the bacterium liquid again;

(9) and extracting the plasmid from the positive clone bacterium liquid without endotoxin to obtain p6.5MCS-ENO1 expression plasmid.

The invention also constructs the p6.5MCS-MUC1 expression plasmid, and the construction process is similar to that of the p6.5MCS-ENO1 expression plasmid and is not repeated. Wherein, the sequences of the upstream primer and the downstream primer of the ORF of the ENO1 amplified by PCR are shown as SEQ ID No: 3 and SEQ ID No: 4 is shown in the specification; the sequences of the upstream primer and the downstream primer for amplifying the ORF of MUC1 are shown as SEQ ID No: 5 and SEQ ID No: 6, see table 1 for specific sequences. The PCR reaction system is referred to the PCR kit instruction. The PCR reaction conditions were pre-denaturation at 95 ℃ for 2min, replication (denaturation at 95 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 90s) for 38 cycles, and final extension at 72 ℃ for 5 min.

TABLE 1 PCR primer sequences

Referring to FIG. 2, panel A in FIG. 2 is a gel electrophoresis of linearized p6.5MCS plasmid (9185 bp); FIG. 2B is a gel electrophoresis of PCR amplified ORF of ENO1 (1305 bp); FIG. 2C is a gel electrophoresis image of PCR identification of positive clone bacteria liquid; FIG. 2D is a gel electrophoresis image of EcoRI and BglII double-digested plasmid after extraction. In diagram D of FIG. 2, the number 1 indicates the cleavage result of the p6.5MCS empty plasmid control, the p6.5MCS vector has only an EcoRI cleavage site, does not contain a BglII cleavage site, and the EcoRI and BglII double-cleaved p6.5MCS vector has only one band; the plasmid p6.5MCS-ENO1 was digested at accession number 2, and the ORF of ENO1 contained a BglII cleavage site, so that the plasmid p6.5MCS-ENO1 was digested with EcoRI and BglII to generate two fragments of 3844bp and 6652 bp. The results in FIG. 2 demonstrate that the p6.5MCS-ENO1 plasmid has been successfully constructed. The gel electrophoresis result of the construction process of p6.5MCS-MUC1 plasmid is not shown.

Example II expression plasmid transfer into Leishmania

The two expression plasmids constructed in example one were separately transferred into Leishmania.

The specific steps are as follows (taking ENO1 as an example as well):

(1) the number of Leishmania amazonensis (LV78) in the logarithmic growth phase was counted to 1.2X 10⁷Then, the mixture was collected and washed twice with PBS;

(2) adding 100 mu l of transfection solution into p6.5MCS-ENO1 expression plasmid solution containing 10 mu g, re-suspending and transferring the solution into an electric transfer cup, putting the electric transfer cup into a Lonza Nucleofector nuclear transfer system, and carrying out transfection by using a program U-033;

(3) taking out the electric rotating cup from the Nucleofector device, immediately adding 3ml of M199 complete culture medium, and culturing for 24 hours;

(4) adding Tunicamycin (Tunicamycin) 5ug/ml into the above solution, and culturing for 3 weeks;

(5) performing DNase I treatment (Takara) using TRIzol reagent solution (ThermoFisher), and isolating total RNA from the harvested Leishmania;

(6) designing primers, and synthesizing cDNA by using a ReverTra Ace q-PCR RT kit (Toyobo);

(7) adding the cDNA into SYBR Green Real-time PCR premix solution, and analyzing the expression level of ORF of ENO1 in the expression vector by Real-time quantitative PCR;

(8) RIPA lysis buffer (containing 1mM protease inhibitor PMSF) lyses cells;

(9) centrifuging at 0-4 ℃ and 12,000rpm for 15min, collecting the supernatant of the protein lysate, heating at 100 ℃ for 10 min, and carrying out electrophoretic separation on polyacrylamide gel containing SDS;

(10) the electrophoresis gel was then transferred to a PVDF membrane (Millipore), detection was performed using a diabody, blotting was developed with a chemiluminescent reagent, and the results were observed.

In this example, the sequences of the upstream and downstream primers of ENO1 were amplified by real-time quantitative PCR as shown in SEQ ID No: 7 and SEQ ID No: 8 is shown in the specification; the sequences of the upstream primer and the downstream primer for amplifying the MUC1 are shown as SEQ ID No: 9 and SEQ ID No: 10, see table 2. For the setting of the real-time quantitative PCR reaction system and the reaction program, please refer to the description of the real-time quantitative PCR kit. The diabodies used in this example were anti-ENO 1 (or anti-MUC 1 protein) and anti-beta-tubulin (control).

TABLE 2 real-time quantitative PCR primer sequences

FIG. 3 shows the results of qRT-PCR of ENO1, FIG. 4 shows the results of qRT-PCR of MUC1, and the control is Leishmania (LV78) not transferred into the expression plasmid. The results in FIGS. 3 and 4 demonstrate that the foreign gene on the expression plasmid can be expressed at high levels in the Leishmania. FIG. 5 is a Western blot result of ENO1, indicating that p6.5MCS-ENO1 has successfully expressed the ENO1 protein in the Leishmania. Western blot results for p6.5MCS-MUC1 were consistent with those for p6.5MCS-ENO1 and are not shown.

EXAMPLE III Leishmania infected DC transformed with expression plasmid

Culture of immature DC: bone marrow of C57BL/6 mouse was cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, recombinant mouse GM-CSF (31.5ng/ml) for 3 days; culture was continued to day seven by addition of fresh medium containing GM-CSF to yield large numbers of loosely adherent immature DCs (imDCs).

Culturing Leishmania: l. lv78 leishmania promastigotes (capable of expressing GFP tag) were cultured in M199 medium containing 10% fetal bovine serum, penicillin and streptomycin until logarithmic growth phase was reached.

Infection: firstly, Leishmania promastigotes are used for infecting immature DCs, the infection complex number is 4 and 10 respectively, and the infection condition is 35 ℃ for 8 h. ② infecting immature DC with inactivated Leishmania promastigotes (incubated at 70 ℃ for 45 minutes), the multiplicity of infection is 4 and 10 respectively, and the infection condition is 35 ℃ for 8 h.

And (3) analysis: DC cells of control group (uninfected leishmania promastigotes) and experimental group (infected live/dead leishmania promastigotes) were subjected to flow cytometry analysis using monoclonal antibodies against CD80, CD86, and MHC II, respectively.

FIG. 6 shows the results of flow cytometry analysis of Leishmania promastigote infected DCs transformed with p6.5MCS-ENO1, and the results show that the positive rates of MHC II expression and CD86 of live Leishmania promastigote infected DCs were increased compared with the control group of uninfected Leishmania promastigotes, and the positive rate of group with a multiplicity of infection of 10 was more significant than the increase of group with a multiplicity of infection of 4. FIG. 7 shows that the trend of change in MFI (mean fluorescence intensity) of Leishmania promastigotes transformed with p6.5MCS-ENO1 is consistent with the positive ratio in FIG. 6, indicating that infection of DC with Leishmania promastigotes transformed with p6.5MCS-ENO1 promotes DC maturation and expression of MHC II and CD 86. Referring to FIG. 8, the positive rate of CD86 was slightly increased in the group of infected killed Leishmania promastigotes compared to the uninfected control group, indicating that although the inactivated Leishmania promastigotes were less effective in promoting DC cell maturation than in the live Leishmania promastigotes, they also had some induction of DC maturation and expression of CD 86.

FIG. 9 shows the results of flow cytometry analysis of Leishmania promastigotes infected DC transformed with p6.5MCS-MUC1, and the results show that MUC1 was consistent with those of ENO1, and that the positive rates of MHC II and CD86 of live Leishmania promastigotes were also increased compared with the uninfected control group, wherein the positive rate was more significant in the group with a multiplicity of infection of 10 than in the group with a multiplicity of infection of 4.

In combination with the above results, Leishmania transformed with the expression plasmid can effectively promote DC cell maturation. Therefore, the leishmania transformed with the expression plasmid provided by the invention has great potential value in promoting DC maturation, promoting DC maturation method and expression plasmid in tumor treatment.

The above description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and all modifications and equivalents of the present invention, which are made by the contents of the present specification and the accompanying drawings, or directly/indirectly applied to other related technical fields, are included in the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen Rotzmann international transformation medical research institute

<120> use of Leishmania transformed with expression plasmid for promoting DC maturation, method and table for promoting DC maturation

Daplasmid

<130>

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 1317

<212> DNA

<213> Artificial Synthesis

<400> 1

ggatccatgt ctattctcag gatccacgcc agagagatct ttgactcccg tgggaatccc 60

actgttgagg tcgatctgta caccgcaaaa ggtctcttcc gagctgcggt gcccagcggt 120

gcgtccactg gcatctacga ggccctagaa ctccgagaca atgataagac ccgcttcatg 180

gggaagggtg tctcacaggc tgttgagcac atcaataaaa ctattgcgcc tgctctggtt 240

agcaagaaag tgaatgttgt ggagcaagag aagattgaca agctgatgat cgagatggac 300

ggcacagaga ataaatctaa atttggtgca aatgccatcc tgggagtgtc cctggctgtc 360

tgcaaagctg gtgccgtgga aaagggggtg cccctttacc gccacattgc tgacttggcc 420

ggcaaccctg aagtcatcct gcctgtcccg gctttcaatg tgatcaacgg tggttctcat 480

gctggcaaca agctggccat gcaagagttc atgatcctgc ctgtgggggc atccagcttc 540

cgggaagcca tgcgcattgg agcagaggtt taccacaacc tgaagaacgt gatcaaggag 600

aagtacggga aggacgccac caatgtgggt gatgagggtg gattcgcacc taacatcctg 660

gagaacaaag aagcactgga gctgctcaag actgcaatcg caaaggccgg ctacactgac 720

caggttgtca ttggcatgga tgtggctgcc tccgagttct acaggtctgg caagtatgac 780

ctggacttca agtctccgga tgaccccagc aggtacatca ctcccgacca gctggctgat 840

ctgtacaagt ccttcgtcca gaactaccca gtggtgtcca tcgaagatcc ctttgaccag 900

gacgactggg gcgcctggca gaagttcacg gctagtgcgg gcatccaggt ggtgggcgat 960

gacctcacag tgaccaaccc taagcggatt gccaaggctg cgagcgagaa gtcctgcaac 1020

tgcctcttgc tcaaagtgaa ccagatcggc tctgtgaccg aatccctgca ggcgtgtaag 1080

ctggcccaat ccaatggctg gggcgtcatg gtgtcccacc gatctgggga aactgaggac 1140

actttcatcg cagacctggt ggtggggctc tgcactgggc agatcaagac tggtgcccct 1200

tgccgatccg agcgcctggc caagtacaat cagatcctca gaattgagga agagctgggc 1260

agcaaagcca agtttgctgg caggtccttc aggaaccccc tggccaaata aggatcc 1317

<210> 2

<211> 1896

<212> DNA

<213> Artificial Synthesis

<400> 2

atgaccccgg gcattcgggc tcctttcttc ctgctgctac ttctagcaag tctaaaaggt 60

tttcttgccc ttccaagtga ggaaaacagt gtcacctcat ctcaggacac cagcagttcc 120

ttagcatcga ctaccactcc agtccacagc agcaactcag acccagccac cagacctcca 180

ggggactcca ccagctctcc agtccagagt agcacctctt ctccagccac cagagctcct 240

gaagactcta ccagtactgc agtcctcagt ggcacctcct ccccagccac cacagctcca 300

gtgaactccg ccagctctcc agtagcccat ggtgacacct cttccccagc cactagcctt 360

tcaaaagact ccaacagctc tccagtagtc cacagtggca cctcttcagc tccggccacc 420

acagctccag tggattccac cagctctcca gtagtccacg gtggtacctc gtccccagcc 480

accagccctc caggggactc caccagctct ccagaccata gtagcacctc ttctccagcc 540

accagagctc ccgaagactc taccagtact gcagtcctca gtggcacctc ctccccagcc 600

accacagctc cagtggactc caccagctct ccagtagccc atgatgacac ctcttcccca 660

gccactagcc tttcagaaga ctccgccagc tctccagtag cccacggtgg cacctcttct 720

ccagccacca gccctctaag ggactccacc agttctccag tccacagtag tgcctccatc 780

caaaacatca agactacatc agacttagct agcactccag accacaatgg cacctcagtc 840

acaactacca gctctgcact gggctcagcc accagtccag accacagtgg tacctcaact 900

acaactaaca gctctgaatc agtcttggcc accactccag tttacagtag catgccattc 960

tctactacca aagtgacgtc aggctcagct atcattccag accacaatgg ctcctcggtg 1020

ctacctacca gttctgtgtt gggctcagct accagtctag tctataatac ctctgcaata 1080

gctacaactc cagtcagcaa tggcactcag ccttcagtgc caagtcaata ccctgtttct 1140

cctaccatgg ccaccacctc cagccacagc actattgcca gcagctctta ctatagcaca 1200

gtaccatttt ctaccttctc cagtaacagt tcaccccagt tgtctgttgg ggtctccttc 1260

ttcttcttgt ctttttacat tcaaaaccac ccatttaatt cttctctgga agaccccagc 1320

tccaactact accaagaact gaagaggaac atttctggat tgtttctgca gatttttaac 1380

ggagattttc tggggatctc tagcatcaag ttcaggtcag gctccgtggt ggtagaatcg 1440

actgtggttt tccgggaggg tacttttagt gcctctgacg tgaagtcaca gcttatacag 1500

cataagaagg aggcagatga ctataatctg actatttcag aagtcaaagt gaatgagatg 1560

cagttccctc cctctgccca gtcccggccg ggggtaccag gctggggcat tgccctgctg 1620

gtgctggtct gtattttggt tgctttggct atcgtctatt tccttgccct ggcagtgtgc 1680

cagtgccgcc gaaagagcta tgggcagctg gacatctttc caacccagga cacctaccat 1740

cctatgagtg aataccctac ctaccacact cacggacgct acgtgccccc tggcagtacc 1800

aagcgtagcc cctatgagga ggtttcggca ggtaatggca gtagcagtct ctcttatacc 1860

aacccagctg tggtgaccac ttctgccaac ttgtag 1896

<210> 3

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 3

ctactgccag aaattcgcc 19

<210> 4

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 4

agggatctcc ggtccatg 18

<210> 5

<211> 33

<212> DNA

<213> Artificial Synthesis

<400> 5

gctcgaattc agatcatgac cccgggcatt cgg 33

<210> 6

<211> 40

<212> DNA

<213> Artificial Synthesis

<400> 6

cactaaaggg agatcctaca agttggcaga agtggtcacc 40

<210> 7

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 7

tcctggagaa caaagaagca ctg 23

<210> 8

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 8

cttcgatgga caccactggg ta 22

<210> 9

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 9

ggctccgtgg tggtagaatc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 10

ccagctgccc atagctcttt 20

Claims

1. Use of Leishmania transformed with an expression plasmid to promote DC maturation.

2. The use of claim 1, wherein said expression plasmid comprises at least one of a tumor associated protein coding sequence, a tumor associated polypeptide coding sequence, a tumor specific antigen coding sequence.

3. The use of claim 2, wherein the expression plasmid comprises the ORF of ENO1 or the ORF of MUC 1.

4. The use of claim 3, wherein the ORF of ENO1 has the sequence shown in SEQ ID No: 1, the ORF sequence of the MUC1 is shown as SEQ ID No: 2, respectively.

5. A method of promoting DC maturation, comprising the steps of:

(1) transforming the expression plasmid into leishmania;

(2) infecting said leishmania infected DCs with said expression plasmid;

6. The method of promoting DC maturation according to claim 5, wherein the expression plasmid comprises the ORF of ENO1 or the ORF of MUC 1.

7. The method for promoting DC maturation according to claim 6, wherein the ORF sequence of ENO1 is as set forth in SEQ ID No: 1, the ORF sequence of the MUC1 is shown as SEQ ID No: 2, respectively.

8. An expression plasmid for transforming leishmania, wherein leishmania transformed with the expression plasmid promotes DC maturation, wherein the expression plasmid comprises at least one of a tumor associated protein coding sequence, a tumor associated polypeptide coding sequence, and a tumor specific antigen coding sequence.

9. The expression plasmid of claim 8, wherein the expression plasmid comprises an ORF of ENO1 or an ORF of MUC 1.

10. The expression plasmid of claim 9, wherein the ORF sequence of ENO1 is as set forth in SEQ ID No: 1, the ORF sequence of the MUC1 is shown as SEQ ID No: 2, respectively.