CN113234749B - A method for real-time detection of intracellular leucine levels - Google Patents

Abstract

The invention relates to a method for detecting leucine level in cells in real time, which clones a promoter sequence of LEU4 gene to YY by means of a molecular cloning technology ₁ Among the plasmids, a new plasmid pr-LEU4-GFP was obtained. It is known that in s.cerevisiae cells, leucine synthesis is feedback-inhibited by the LEU4 gene, and that when the intracellular leucine level is too high, the expression of the LEU4 gene is inhibited, and vice versa. The pr-LEU4-GFP plasmid is successfully transferred into saccharomyces cerevisiae, and when the leucine level in the cell of the saccharomyces cerevisiae is reduced, the expression of the LEU4 gene is promoted, so that the expression of the pr-LEU4-GFP plasmid is started, the expression quantity of GFP in the cell is increased, and otherwise, the expression quantity of GFP is reduced. According to the method, the expression quantity of GFP is detected by a Western blot technology, the change of the leucine level in the yeast cells can be reflected in real time, the sample preparation is simple, the detection cost is low, the environment is friendly, and the change trend of the leucine level in the cells can be reflected conveniently and rapidly for experiments which do not need accurate quantification.

Description

A method for real-time detection of intracellular leucine levels

technical field

The invention belongs to the technical field of detection, and in particular relates to a method for real-time detection of intracellular leucine levels.

Background technique

Amino acid is a class of important compounds in animals, plants and microorganisms, and is the basic unit of protein, which is the main bearer of life activities. Scientific research has shown that abnormal amino acid metabolism is related to various diseases, such as albinism caused by abnormal tyrosine metabolism, phenylketonuria caused by abnormal phenylalanine metabolism, etc. Therefore, the qualitative and quantitative analysis of free amino acids in organisms is of great significance for understanding the pathological mechanism of diseases.

The traditional amino acid analysis method is planar chromatography, which has been gradually replaced by instrumental analysis in recent years. Existing analysis methods mainly include amino acid automatic analyzer method, gas chromatography, reversed-phase high performance liquid chromatography, and high performance anion chromatography-integral pulse amperometry. Among them, the amino acid automatic analyzer method is the most widely used, and the fastest-growing method is high-performance liquid chromatography. However, since these two methods require pre-column or post-column derivatization, the results have certain errors, so high-efficiency derivatization reagents are selected. is the future direction of development. High-efficiency anion chromatography-integrated pulse amperometry can directly analyze amino acids. It has the advantages of high resolution, good reproducibility, accurate qualitative and quantitative analysis, and low cost. It has been applied to a certain extent in recent years and has bright development prospects.

However, the existing methods for analyzing amino acids are mainly instrumental analysis, and the detection cost is too high due to the generally high cost of the instruments used. And most amino acids do not contain chromophoric groups, and usually require pre-column or post-column derivatization to achieve signal detection. Organic solvents such as mobile phase methanol and acetonitrile used in high performance liquid chromatography will pollute the environment. Moreover, instrumental analysis usually requires the concentration of the sample to reach its detection limit, and the required sample concentration is relatively high (40OD), which requires high sample quality.

Contents of the invention

In order to solve the above technical problems, the present invention provides a method for real-time detection of intracellular leucine levels. The invention detects the expression level of the fusion protein GFP in the cell, and further reflects the change of the leucine content in the cell. The fusion protein GFP can be detected by Western blot or fluorescent technology to achieve high throughput.

The first object of the present invention is to provide a biosensor for real-time detection of intracellular leucine levels, said biosensor comprising the promoter of the expression gene LEU4 gene of α-isopropylpropionate synthase II, and , the fluorescent protein gene expressed by the promoter.

Further, the nucleotide sequence of the promoter is shown in SEQ ID NO.1.

Further, the fluorescent protein gene is the green fluorescent protein gene.

Further, the green fluorescent protein gene is enhanced green fluorescent protein gene yEGFP.

Further, the promoter and fluorescent protein gene are located on the vector Ycplac33.

The second object of the present invention is to provide a recombinant plasmid for real-time detection of intracellular leucine levels, said recombinant plasmid comprising the promoter of the expression gene LEU4 gene of α-isopropylpropionate synthase II, and , the fluorescent protein gene expressed by the promoter.

Further, the recombinant plasmid uses Ycplac33 as a vector.

The third object of the present invention is to provide a method for real-time detection of intracellular leucine levels, the method is to transfer the biosensor into the leucine-producing cells, and detect the intracellular fluorescent protein The expression level is used to detect changes in the level of leucine in cells.

Further, the cells are Saccharomyces cerevisiae cells.

Further, the expression level of the fluorescent protein is detected by western blot.

By means of the above solution, the present invention has at least the following advantages:

The present invention clones the promoter sequence of LEU4 (alpha-isopropylpropionate synthase II) gene into _YY1 plasmid by means of molecular cloning technology to obtain a new plasmid pr-LEU4-GFP. It is known that in Saccharomyces cerevisiae cells, the synthesis of leucine is subject to feedback inhibition by the LEU4 gene. When the level of leucine in the cell is too high, the expression of the LEU4 gene will be inhibited, and vice versa. We successfully transformed the pr-LEU4-GFP plasmid into Saccharomyces cerevisiae. When the leucine level in the yeast cells decreased, it would promote the expression of the LEU4 gene, thereby initiating the expression of the pr-LEU4-GFP plasmid, which manifested as intracellular GFP The expression level increased, whereas the expression level of GFP decreased. This method detects the expression level of GFP by Western blot technology, which can reflect the change of leucine level in yeast cells in real time. The sample preparation is simple, the detection cost is low, and the environment is friendly. For experiments that do not require accurate quantification, it can be conveniently and quickly reflected. The change trend of intracellular leucine level was shown.

The above description is only an overview of the technical solutions of the present invention. In order to understand the technical means of the present invention more clearly and implement them according to the contents of the description, the preferred embodiments of the present invention are described in detail below.

Description of drawings

Figure 1 is the YY1 plasmid map;

Figure 2 is a specificity verification diagram of the pr-LEU4-GFP plasmid;

Figure 3 is a time sensitivity verification diagram of the pr-LEU4-GFP plasmid;

Figure 4 is a graph showing the sensitivity verification of the pr-LEU4-GFP plasmid to changes in leucine concentration;

Fig. 5 is the intracellular leucine concentration determined by high performance liquid chromatography.

Detailed ways

Example 1: Construction of a plasmid for sensing leucine levels in Saccharomyces cerevisiae cells

The present invention first uses PCR technology to amplify the promoter sequence of LEU4 gene, separates the PCR product with agarose gel, then recovers and purifies the obtained PCR product with a gel recovery kit, and measures the concentration of the product with Nanodrop 200D software. The purified LEU4 gene promoter sequence and the _YY1 plasmid were subjected to double digestion to generate cohesive ends, run on an agarose gel, and then the purified digestion product was recovered and its concentration was determined. Then, the LEU4 gene promoter sequence and _YY1 were ligated with T ₄ DNA ligase to clone the LEU4 gene promoter sequence into the _YY1 plasmid to form a new plasmid pr-LEU4-GFP.

Transform the newly constructed plasmid pr-LEU4-GFP into Escherichia coli, and then spread the transformed Escherichia coli on the LB plate containing ampicillin for screening, and after coating evenly, culture it upside down in a 37°C incubator for 12 to 14 hours . The next day, select 3 to 4 single clones on the LB plate and culture them overnight in LB liquid medium, extract the plasmid with a small plasmid extraction kit, measure the concentration, and carry out enzyme digestion verification. After the enzyme digestion verification is successful, hand over the extracted plasmid Sequence verification to Jinweizhi Company.

Finally, the plasmid that was successfully verified by sequencing was transferred into the experimental Saccharomyces cerevisiae. The transformed bacteria were spread on the culture plate of CSH-Ura, and placed in a 30°C constant temperature incubator for 14-16 hours. The clones were cultured overnight in CSH-Ura liquid medium, and finally the overnight bacteria and 45% glycerol were mixed evenly at a volume ratio of 1:2, and stored in a -80°C refrigerator.

The specific operation is as follows:

(1) PCR amplification of the promoter sequence of the LEU4 gene

A.PCR system

B.PCR program

i. Pre-denaturation: 95°C, 3min

ii. Denaturation: 95°C, 15s

iii. Annealing: 54℃, 15s

iv. Extension: 72°C, 1min (repeat steps ii-iv 30 times)

v. Final extension: 72°C, 5min

vi. Keep: 4°C

C. Gel recovery (operate according to the gel recovery kit)

(2) Restriction target fragment and plasmid vector YY ₁

The _YY1 plasmid is based on the Ycplac33 plasmid (a commercial yeast expression plasmid) as the backbone, and the PCR amplification product of yEGFP (enhanced green fluorescent protein gene) is inserted into Ycplac33 through HindⅢ and BamHI double restriction sites to obtain a plasmid map As shown in Figure 1.

A. Enzyme digestion system

a. Digestion of the target fragment

components Volume (μL) target segment 200ng 10× green fast enzyme buffer 3 HindⅢ 1 BamHI 1 Sterilized double distilled water Dilute to 30μL

37°C, enzyme digestion for 30min

b. Digestion of plasmid vector

components Volume (μL) plasmid vector 1000ng 10× green fast enzyme buffer 2 HindⅢ 1 BamHI 1 Sterilized double distilled water Dilute to 20μL

37°C, enzyme digestion for 30min

B. Gel recovery (operate according to the gel recovery kit)

(3) Ligation of digested products

A. Connection system

PCR program: 16°C, ligation overnight

(4) Conversion of ligated products

A. Thaw E. coli Top 10 on ice, add all the ligation products to 50 μL of E. coli Top 10 cells, and gently pipette to mix. Place the mixture on ice for 20 min;

B. Shock the above mixture in a water bath at 42°C for 45 seconds, then immediately place it on ice for 2 minutes;

C. Then add 500 μL of LB liquid medium without ampicillin to the above mixture, and incubate for 1 hour at 37°C in a shaker at 200 rpm;

D. Centrifuge the above mixture at 5000rpm for 1min, discard the supernatant, resuspend the cells with 100μL of sterilized double distilled water, spread the cells on the LB culture plate containing ampicillin, culture in a constant temperature incubator at 37°C overnight, and the next day Pick a single clone;

(5) Cloning Verification

A. Select 3 to 4 single clones from each transformation plate, scale up overnight in LB liquid medium containing ampicillin, and extract the plasmid of each clone according to the instructions of the plasmid mini-extraction kit the next day, and measure its concentration;

B. Digestion verification

PCR system

components Volume (μL) plasmid 500ng 10× green fast enzyme buffer 1 Bam HI 0.5 HindⅢ 0.5 Sterilized double distilled water Dilute to 10μL

C. Sequencing verification (entrusted to Jinweizhi Company)

D. Yeast transfection

a. Stretch the frozen BY4741 strain onto a CSH solid culture plate, and culture it in a constant temperature incubator at 30°C for 2 days. Then the single clones on the plate were picked and cultured in 2 mL CSH liquid medium for amplified culture at 30° C. and 280 rpm for 14 to 16 hours.

b. Measure the OD ₆₀₀ value of overnight bacteria, and dilute the concentration of the bacterial solution to OD ₆₀₀ =0.25.

c. Continue culturing for 4 hours until OD ₆₀₀ =0.8 (ie logarithmic growth phase), take 1 mL of yeast liquid, centrifuge at 13,000 rpm for 1 min, and discard the supernatant.

d. Resuspend the yeast pellet with 1 mL of 0.1 M lithium acetate solution, centrifuge at 13,000 rpm for 1 min, and discard the supernatant. Resuspend with 100 μL, 0.1M lithium acetate solution, gently pipette and mix well, this is the competent cells.

e. Denatured salmon sperm DNA, 5 μL for each transfection, boiled at 100°C for 5 minutes, and placed on ice immediately.

f. In the ultra-clean bench, add 0.5 μg of the above plasmid, 5 μL of denatured salmon sperm DNA, and 350 μL of PLATE MIX to 100 μL of competent yeast in order, and shake intermittently until completely mixed.

g. Put the above mixture into a shaker at 30°C and 280 rpm for 30 minutes, and then heat it in a water bath at 42°C for 10 minutes. Centrifuge at 13,000 rpm for 1 min, discard the supernatant, then resuspend the cells with 100 μL of sterilized double-distilled water, spread them on a C-U selective culture plate, and culture them upside down at 30°C for 2 days.

h. Pick 3-4 single clones from the transformation plate and place them in 2mL C-U liquid medium at 30°C and 280rpm for amplified culture for 14-16h. The next day, freeze the single clones in a -80°C refrigerator until use.

Embodiment 2: verify the specificity of this plasmid

(1) Yeast sampling

1. Shaking bacteria: Inoculate the BY4741 strain transformed with the pr-LEU4-GFP plasmid into a 12mL culture tube, add 4mL of CSH-Ura liquid medium into the culture tube, shake 5 tubes, and culture overnight at 30°C and 280rpm for 14~ 16h.

2. On the next day, measure the OD ₆₀₀ value of the yeast liquid and record it. Take a 6OD bacterial solution from each tube, centrifuge at 13,000 rpm for 1 min, discard the supernatant, and continue culturing with 6 mL of CSH-Ura-20% Leu medium for 1 h.

After 3.1 h, the OD ₆₀₀ values of the yeast liquid were measured and recorded. Take 3 parts of 2OD bacteria solution from each tube, centrifuge at 13000rpm for 1min, discard the supernatant, and store 1 part as 0h sample in -20℃ refrigerator, mix the remaining 2 parts of 2OD bacteria solution together, and use 4mL of CSH respectively -Ura-20% Leu, CSH-Ura-10% Leu, CSH-Ura-10% Met, CSH-Ura-10% His, CSH-Ura-Arg and CSH-Ura-Gln continued to culture for 6 hours.

4. Measure the OD ₆₀₀ of each tube of bacterial liquid at the 3rd hour and the 6th hour respectively, and record it. Take 2OD bacterial solution from each tube, centrifuge at 13000rpm for 1min, and discard the supernatant. As the samples of 3h and 6h respectively.

(2) Sample preparation

1. Prepare cell lysate: Add 1/20 dithiothreitol and 1/500 protease inhibitor to a certain amount of SDS cell lysate.

2. Lysis of yeast cells: Add 200 μL of the above cell lysate and 100 μL of acid-washed glass microbeads to each yeast cell, shake at high speed on a vortex mixer for 45 seconds, then immediately place it on ice for 30 seconds, repeat 4 times . Then heat at 100°C for 5 min to denature the protein.

(3) Western blot

1. Electrophoresis: Add 15 μL of cell lysate to the sample wells of the SDS-polyacrylamide gel in turn, add 2 μL of PageRuler ^TM to the wells on both sides of the gel, and run the electrophoresis for 120 min at a constant voltage of 100V.

2. Membrane transfer: After the electrophoresis is completed, transfer the protein in the SDS-polyacrylamide gel to PVDF (activated with methanol for about 5 minutes before use), and transfer for 90 minutes at a constant voltage of 100V.

3. Blocking: Block the PVDF membrane with 5% skimmed milk on a film shaker (80 rpm) for 45 min.

4. Apply primary antibody: cut the membrane between 34-43Kda, apply Pgk1 to the upper membrane, and GFP to the lower membrane, and apply overnight in a 4°C refrigerator.

5. Membrane washing: recover the primary antibody, wash with 1×PBST on a membrane shaker (100 rpm) for 10 min, and repeat this step 4-5 times.

6. Apply secondary antibody: Incubate with 3mL mouse antibody at room temperature for 1h.

7. Membrane washing: wash with 1×PBST on a membrane shaker (100 rpm) for 5 minutes, and repeat this step 4 to 5 times.

8. Development and imaging.

Figure 2 verifies the specificity of the pr-LEU4-GFP plasmid. Use the BY4741 bacterial strain that has transferred this plasmid, take CSH-Ura-20%Leu as contrast, respectively in CSH-Ura-10%Leu(37), CSH-Ura-10%Met(7.4), CSH-Ura-10% Experiments were carried out under the conditions of His(7.4)CSH-Ura-Arg and CSH-Ura-Gln. The experimental results showed that under the conditions of CSH-Ura-10%Leu, the expression of GFP was significantly increased, while other amino acids were reduced or missing. There was no obvious sign of increase under the condition of , which indicated that the pr-LEU4-GFP plasmid could indeed specifically reflect the level of leucine in yeast cells.

Example 3: Time sensitivity of the pr-LEU4-GFP plasmid

(1) Yeast sampling

1. Shaking bacteria: Inoculate the BY4741 strain transformed with the pr-LEU4-GFP plasmid into a 12mL culture tube, add 7mL of CSH-Ura liquid medium into the culture tube, shake 2 tubes, and culture overnight at 30°C and 280rpm for 14~ 16h.

2. On the next day, measure the OD ₆₀₀ value of the yeast liquid and record it. Take a 14OD bacterial solution from each tube, centrifuge at 13,000 rpm for 1 min, discard the supernatant, and continue culturing with 7 mL of CSH-Ura-20% Leu medium for 1 h.

After 3.1 h, the OD ₆₀₀ values of the yeast liquid were measured and recorded. Take 7 parts of 2OD bacterial solution from each tube, centrifuge at 13000rpm for 1min, discard the supernatant, and store 1 part as 0h sample in -20℃ refrigerator, and mix the remaining 6 parts of 2OD bacterial solution with 8mL of CSH -Ura, CSH-Ura-10% Leu continued to culture for 6 hours.

4. Measure the OD ₆₀₀ of each tube of bacterial liquid at 0.25, 0.5, 1, 2, 3, and 6 hours, and record it. Take 2OD bacterial solution from each tube, centrifuge at 13000rpm for 1min, and discard the supernatant. Respectively as the first 0.25, 0.5, 1, 2, 3, 6h samples.

(2) Sample preparation and Western blot are the same as in Example 2.

Figure 3 uses the BY4741 bacterial strain transfected with the pr-LEU4-GFP plasmid to design an experiment to detect the time sensitivity of the pr-LEU4-GFP plasmid. Taking CSH-Ura-100%Leu as the control and CSH-Ura-10%Leu as the experimental group, the expression of GFP in the cells at 0, 0.25, 0.5, 1, 2, 3, and 6h was detected respectively, and the experimental results can be seen The expression level of GFP in the control group was significantly higher than that in the control group at 0.25h, indicating that the response time of the plasmid was relatively short. Theoretically, our method can detect the expression level of GFP in cells at any time point. It is enough to take 2OD cells at the time point, which is convenient for sampling and takes a short time for sample preparation. However, high performance liquid chromatography requires a 40OD cell sample, which takes more time to sample and is difficult to monitor in real time. (Note: 1OD≈3×10^7 yeast cells).

Example 4: Sensitivity of pr-LEU4-GFP plasmid to changes in leucine concentration

(1) Yeast sampling

1. Shaking bacteria: Inoculate the BY4741 strain transformed with the pr-LEU4-GFP plasmid into a 12mL culture tube, add 7mL of CSH-Ura liquid medium into the culture tube, and culture overnight at 30°C and 280rpm for 14-16 hours.

2. On the next day, measure the OD ₆₀₀ value of the yeast liquid and record it. Take 4 tubes of bacterial liquid, centrifuge each tube at 6OD at 13000 rpm for 1 min, discard the supernatant, and continue culturing with 6 mL of CSH-Ura-20% Leu medium for each tube for 1 h.

After 3.1 h, the OD ₆₀₀ values of the yeast liquid were measured and recorded. Take 3 parts of 2OD bacterial solution from each tube, centrifuge at 13000rpm for 1min, discard the supernatant, and store 1 part as a 0h sample in a -20°C refrigerator, and mix the remaining 6 parts of 2OD bacterial solution with 8mL of CSH -Ura, CSH-Ura-30% Leu, CSH-Ura-20% Leu, CSH-Ura-10% Leu were cultured for 6 hours.

4. Measure the OD ₆₀₀ of each tube of bacterial solution at 3 and 6 hours respectively, and record it. Take 2OD bacterial solution from each tube, centrifuge at 13000rpm for 1min, and discard the supernatant. As the samples of the 3rd and 6h respectively.

(2) Sample preparation and Western blot are the same as in Example 2.

Figure 4 uses the BY4741 bacterial strain transfected with the pr-LEU4-GFP plasmid to design an experiment to detect the sensitivity of the pr-LEU4-GFP plasmid to changes in leucine concentration. Taking CSH-Ura as the control group, CSH-Ura-30% Leu, CSH-Ura-20% Leu, and CSH-Ura-10% Leu as the experimental group, the expression of GFP in their cells at 0, 3, and 6 hours was investigated. It can be seen that when the concentration of leucine is reduced to 20% of the control group, the expression level of GFP is obviously increased, and the lower the concentration of leucine, the higher the expression level of GFP.

Figure 5 shows the concentration of leucine in cells measured by high performance liquid chromatography entrusted to Suzhou Paminoco Company. Using the BY4741 strain experiment, the concentration of intracellular leucine in the cells under the conditions of CSH-20% Leu and CSH-10% Leu was measured for 3 hours. It can be seen that the difference between the two groups is not significant. But if we use our method, when the leucine concentration is lower, the expression level of GFP is higher, and it is easier to reflect the small difference of the leucine concentration change.

Regarding the detection limit of this method, according to the existing experimental results, the lower the concentration of leucine, the stronger the signal of GFP, and the theoretical detection limit can be infinitely low. Generally speaking, to use high-performance liquid chromatography to determine the concentration of a substance, the concentration of the substance in the sample needs to reach the detection limit. An addition to the method.

The above are only preferred embodiments of the present invention, and are not intended to limit the present invention. It should be pointed out that for those of ordinary skill in the art, some improvements and modifications can be made without departing from the technical principles of the present invention. , these improvements and modifications should also be regarded as the protection scope of the present invention.

sequence listing

<110> Soochow University

<120> A method for real-time detection of intracellular leucine levels

<160> 1

<170> SIP Sequence Listing 1.0

<210> 1

<211> 746

<212>DNA

<213> (artificial sequence)

<400> 1

aagaaaattc aagcaatatg cttgtgtggc ccgatgacac acaatagcat gtgcgacgag 60

acaccagctg tgtgccgggt gctacccgcg cacgtgatta aaaggaaacg gggaaaaagc 120

catagcggaa aagtgctcga agaagcctcg ataaatgaag taaaaaattc gatatttttc 180

aacgacaata agacgtatat aagcatccgt atgtccagcg attgagctta tgcttctgtt 240

ctccgctttg acacttccac tcggctgtta tgaccagccc caggattgct accggagcgg 300

gaccggctct gagacagtag taggttagtc atcgctctac cgacgcgcag gaaaagaaag 360

aaggcctcag aaaagctgag ttgaatgtgtgtcatacttg gctgaaaaaa ttgtacagta 420

acggccagtc actgtcatgc gcgtgcatgt atgtgcgtgc atgtatgtgtgtatgtatat 480

ttatatatat ataagcacgg gcgcatggga gatgtgcgct atggagtcgc gtaggttcga 540

tgttttctcc tcttgggtca gcctctctcc tctttcaacg ttctttccat aatcatttat 600

tggttatttt tcaacttgac cagtaaaaag aaacttacgt gtaagtgact cagttctttc 660

aaagggtatt ttttgaagaa aaaaaaggat tctcacacta gaagtttact gtagactttt 720

tccttacaaa aagacaagga acaatc 746

Claims (9)

1. A biosensor for real-time detection of intracellular leucine levels, characterized in that, said biosensor comprises the promoter of the expression gene LEU4 gene of α-isopropylpropionate synthase II, and, with the Said promoter promotes the expressed fluorescent protein gene, and the nucleotide sequence of said promoter is shown in SEQ ID NO.1. 2. The biosensor according to claim 1, wherein the fluorescent protein gene is a green fluorescent protein gene. 3. The biosensor according to claim 2, wherein the green fluorescent protein gene is an enhanced green fluorescent protein gene yEGFP. 4. The biosensor according to claim 1, wherein said promoter and fluorescent protein gene are located on the vector Ycplac33. 5. A recombinant plasmid for real-time detection of intracellular leucine levels, characterized in that, the recombinant plasmid includes the promoter of the expression gene LEU4 gene of α-isopropylpropionate synthase II, and, with the Said promoter promotes the expressed fluorescent protein gene, and the nucleotide sequence of said promoter is shown in SEQ ID NO.1. 6. The recombinant plasmid according to claim 5, characterized in that, the recombinant plasmid uses Ycplac33 as a vector. 7. A method for real-time detection of intracellular leucine levels, characterized in that, the method is to transfer the biosensor according to any one of claims 1-3 into the cells producing leucine, by detecting The expression level of fluorescent protein in the cell is used to detect the change of leucine level in the cell. 8. The method according to claim 7, wherein said cells are Saccharomyces cerevisiae cells. 9. The method according to claim 7, wherein the expression level of the fluorescent protein is detected by western blotting.