CN113234710A - Iris japonica dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine - Google Patents

Iris japonica dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine Download PDF

Info

Publication number
CN113234710A
CN113234710A CN202110501473.XA CN202110501473A CN113234710A CN 113234710 A CN113234710 A CN 113234710A CN 202110501473 A CN202110501473 A CN 202110501473A CN 113234710 A CN113234710 A CN 113234710A
Authority
CN
China
Prior art keywords
ddc
dopa decarboxylase
pet24a
hydroxytryptamine
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110501473.XA
Other languages
Chinese (zh)
Inventor
陈可泉
王莹莹
张阿磊
贾蕙宁
衡佳欣
罗雅献
刘雨洁
欧阳平凯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Tech University
Original Assignee
Nanjing Tech University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Tech University filed Critical Nanjing Tech University
Priority to CN202110501473.XA priority Critical patent/CN113234710A/en
Publication of CN113234710A publication Critical patent/CN113234710A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10—Nitrogen as only ring hetero atom
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01084—D-Dopachrome decarboxylase (4.1.1.84)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses harmonia axyridis dopa decarboxylase DDC and application thereof in catalyzing 5-hydroxytryptamine. The high-activity dopa decarboxylase is obtained by cloning a gene segment of the harmonia axyridis dopa decarboxylase with a nucleotide sequence shown as SEQ ID No. 1. The catalytic decarboxylation of 5-hydroxytryptophan is realized for the first time by utilizing the enzyme, and 5-hydroxytryptophan is obtained. In addition, the enzyme has important guiding significance for catalyzing the generation of 5-hydroxytryptamine from tryptophan by a biological method without catalyzing the tryptophan by the specificity catalysis of 5-hydroxytryptamine. The method has the advantages of high conversion rate, low production cost, simple process, mild reaction conditions and environmental friendliness, and has important reference value in the application of industrial production of 5-hydroxytryptamine.

Description

Iris japonica dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine
Technical Field
The invention relates to the technical field of molecular biology and bioengineering, in particular to ladybug dopa decarboxylase DDC and application thereof in catalyzing 5-hydroxytryptamine.
Background
5-hydroxytryptamine is derived from tryptophan, an indole derivative, 5-HT for short. Originally discovered from serum, and hence the name serotonin, is widely found in mammalian tissues, particularly in the cortical brain and in the nerve synapses in high levels, and is an inhibitory neurotransmitter. The enzymatic synthesis of the analogous biogenic amines dopamine and norepinephrine both result from the decarboxylation of the corresponding amino acids 5-hydroxytryptophan and 3, 4-dihydroxyphenylalanine (dopa). The reduction of the content of 5-hydroxytryptamine in the brain can cause depression and other common mood disorders; reduced dopamine synthesis due to substantia nigra and striatal lesions can also lead to the onset of parkinson's disease.
In the research of two-step catalysis of tryptophan to produce 5-hydroxytryptamine by a microbiological method, most researchers still utilize tryptophan decarboxylase without specificity in catalysis to decarboxylate 5-hydroxytryptamine, and since the decarboxylase can act on tryptophan at the same time and the catalysis capability of the decarboxylase on tryptophan is stronger than that of 5-hydroxytryptamine, unnecessary byproducts can be produced during the production of 5-hydroxytryptamine, and the yield of 5-hydroxytryptamine is low. Therefore, it is important to find a decarboxylase which can catalyze only 5-hydroxytryptophan and has no catalytic ability for tryptophan.
Disclosure of Invention
In view of the defects of the prior art, the invention aims to provide a ladybug dopa decarboxylase DDC and application thereof in catalyzing 5-hydroxytryptamine, wherein the gene of the dopa decarboxylase DDC is derived from Harmonia axyridis (GenBank: AMQ 13055.1).
In order to solve the problems of the prior art, the invention adopts the technical scheme that:
a ladybug dopa decarboxylase DDC has a nucleotide sequence shown in SEQ ID No. 1.
The amino acid sequence of the ladybug dopa decarboxylase DDC is shown in SEQ ID No. 2.
A recombinant plasmid comprising the nucleotide sequence of harmonia axyridis-derived dopa decarboxylase as claimed in claim 1.
A recombinant vector, which expresses the recombinant plasmid of the nucleotide sequence of the harmonia axyridis source dopa decarboxylase.
A recombinant strain transformed with the above recombinant vector.
The harmonia axyridis source dopa decarboxylase, the recombinant plasmid, the recombinant vector or the recombinant strain is applied to catalyzing 5-hydroxytryptamine.
The application of the ladybug-derived dopa decarboxylase in catalyzing 5-hydroxytryptamine specifically comprises the following steps:
step 1, designing a primer, and amplifying a nucleotide sequence shown as SEQ ID No.1 by using PCR;
step 2, construction of a plasmid vector such as pET24a-DDC
The PCR-amplified DNA sequence and pET24a vector were double-digested with the same restriction enzymes NdeI and HindIII, and then digested with T4DNA ligase is used for connecting the purified enzyme-cleaved product to obtain a plasmid vector pET24 a-DDC;
step 3, constructing clone strain pET24a-DDC-E.coli Trans1T1
Transformation of the plasmid vector pET24a-DDC intoE.coli Trans1T1 to obtain positive transformant, and determining the positive transformant as a target strain through colony PCR screening and sequencing;
step 4, constructing expression strain pET24a-DDC-BL21(DE3)
The target strain pET24a-DDC-E.coli Trans1T 1-derived plasmid was transformedE.coliBL21(DE3), selecting positive transformant, directly cloning and culturing to obtain recombinant expression strain pET24a-DDC-BL21(DE 3);
step 5, in vitro inducible expression
The recombinant expression strain pET24a-DDC-BL21(DE3) was inoculated into 5ml of LB medium containing kanamycin, cultured overnight at 25-40 ℃ for 10-20 hours, and then inoculated into 100ml of LB medium containing kanamycin in an inoculum size of 1%, when OD is reached600=0.4-0.6, adding IPTG with final concentration of 0.5mM-1mM, inducing at 16-25 deg.C and 250rpm for 20-24 h;
step 6, obtaining dopa decarboxylase
Centrifuging at 6000-12000rpm at 4 ℃ for 7-10min after the in vitro induction expression is finished, collecting thalli, washing the thalli with PBS buffer solution for three times, then resuspending the thalli with the PBS buffer solution, then placing the thalli on ice for ultrasonic crushing, wherein 10-15min is carried out each time, the interval of 2 seconds of ultrasonic treatment is 3 seconds, and then centrifuging at 6000-12000rpm at 4 ℃ for 7-10min to collect supernatant, thus obtaining crude enzyme liquid DDC;
step 7, purification of crude enzyme solution
Sequentially cleaning a protein purifier pipeline and a nickel column by using ultrasonic pure water and 50mM and 500mM imidazole to remove impurities in the purified water, loading the crude enzyme solution DDC obtained in the step 6 on the column, opening the pipeline by using the 50mM imidazole, wherein the target protein has a His label and can be adsorbed on the nickel column, washing away the impurity protein without the His label and other impurities, eluting the target protein by using the 500mM imidazole, collecting eluent (the eluent is pure enzyme), and performing 8% SDS polyacrylamide gel electrophoresis on a small amount of eluent;
step 8, catalytic application
1.2 ml of 5-hydroxytryptophan of 10g/l, 20mM of PLP and Tris HCl 7.2 buffer solution, adjusting the pH of the system to 7.2, adding 100 mu l of eluent obtained in the step 7, wherein the total amount is 2ml, and carrying out shaking reaction at 35 ℃ to obtain the 5-hydroxytryptophan.
In the improvement, in the step 1, the primers are as follows:
an upstream primer Chi-F: 5'-CATATGATGGCCTTGTTGCCGTTGG-3' the flow of the air in the air conditioner,
a downstream primer Chi-R: 5'-CCCAAGCTTCTACTTTGCCGCCGGAAT-3' are provided.
Has the advantages that:
compared with the prior art, the ladybug dopa decarboxylase DDC and the application thereof in catalyzing 5-hydroxytryptamine have the advantages that:
1. the invention reports harmonia axyridisHarmonia axyridisThe nucleotide sequence of the ladybug dopa decarboxylase is obtained in GenBank (AMQ 13055.1), and a pET-24a-DDC prokaryotic expression vector is constructed, so that the protein with the molecular weight of about 50 kDa is successfully obtained; the protein has good expression effect and simple preparation process, and provides a simple and convenient method for obtaining the ladybug dopa decarboxylase DDC;
2. the method realizes the decarboxylation of 5-hydroxytryptophan by the ladybug dopa decarboxylase DDC for the first time to generate 5-hydroxytryptophan, has high conversion efficiency, can replace tryptophan decarboxylase, and has good application prospect in the aspect of industrial biological synthesis of 5-hydroxytryptophan.
3. The invention firstly utilizes the dopa decarboxylase which specifically catalyzes 5-hydroxytryptophan but has no catalysis effect on tryptophan, and has important guiding significance for catalyzing tryptophan to generate 5-hydroxytryptamine by a biological method.
Drawings
FIG. 1 is the SDS-PAGE detection result of the ladybug dopa decarboxylase DDC of the invention, wherein M: protein standard molecular weight, 1-is the precipitate obtained by DDC protein centrifugation, and 2-is the supernatant obtained by DDC protein centrifugation; and 3-is the eluent obtained after DDC supernatant is purified.
FIG. 2 shows the results of the dopa decarboxylase DDC catalyzed 5-hydroxytryptophan and tryptophan of the present invention: (a) 5-hydroxytryptophan as a substrate, and (b) tryptophan as a substrate.
Detailed Description
The present invention is further described below by way of examples, which are not intended to limit the scope of the present invention. The experimental procedures in the examples are conventional unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the quantitative tests in the following examples, three replicates were set up and the results averaged.
Example 1 amplification of Doladybia variegata dopa decarboxylase
The present invention designs primers based on the amino acid sequence (GenBank: AMQ 13055.1) of dopa decarboxylase DDC from Harmonia axyridis (Harmonia axyridis, KU 820948):
an upstream primer Chi-F: 5'-CATATGATGGCCTTGTTGCCGTTGG-3', respectively;
a downstream primer Chi-R: 5'-CCCAAGCTTCTACTTTGCCGCCGGAAT-3', respectively;
the conserved sequence of dopa decarboxylase DDC is obtained by a Polymerase Chain Reaction (PCR) method.
And (3) PCR reaction system:
genome template 0.5μl
Upstream primer (10. mu.M) 1μl
Downstream primer (10. mu.M) dNTP 1μl
5×TransStart FastPfu Buffer 10μl
2.5mM dNTPs 4μl
TransStart FastPfu DNA Polymerase 0.5μl
ddH2O up to 50μl
And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 20s, annealing at 52 ℃, extension at 72 ℃ for 20s, and 2min for 30 cycles; stretching at 72 deg.C for 5min, and keeping the temperature at 4 deg.C.
After the PCR reaction is finished, 1% agarose gel electrophoresis is used for detection, and a bright band exists at 1431bp, namely the ladybug dopa decarboxylase.
The nucleotide sequence is shown in SEQ ID No. 1. The dopa decarboxylase gene of the invention codes 403 amino acids, has a molecular weight of about 50kD, and has an amino acid sequence as shown in SEQ ID No. 2.
SEQ ID No.1:
AAAACCCAGTGAAGGTAACCCCCATGTACAACGAGGTTCAGCATGTCAAAACGATCGATCTGGCCCCACTTCTTCTTGTCCTCTGATTTAAACTCTTGCAGTAGCCAGAAGAACGCTTTTACTCTCGCTGCAGCCAACCGTGCCTGTCCAGTCTGGGAAACTGAGAGTTTTCCGTGGAGATTGTTCAGTGTGATAAGTGATAAGTGATAAGGAGGCTGCGTATCTATTAAGTGGATTGTTGGATATCCTTTTATTTATTTGAGATTTAAAGAGATGGAGGCTAATCAGTTTAGGGACTTCGGAAAGGCGATGATAGACTACGTCGCCAATTATCTGGAGAATATAAGGGAGAGGCGGGTTTTGCCTACTGTAGAACCAGGGTATTTACGTCCTCTACTTCCCAGTGAGGCACCACAAAAACCTGACACATGGCAAGAAGTTATGGCTGACATTGAAAAAGTCATTATGCCTGGAGTTACACACTGGCATTCACCAAAGTTTCATGCATATTTTCCTACTGCCAACTCCTATCCTGCTATTGTAGCAGATATTCTCAGTGATGGTATTGCTTGCATCGGTTTTTCATGGATCGCAAGTCCCGCTTGCACCGAACTCGAAGTCGTGATGATGGACTGGTTGGGAAAAATGATAGGTCTCCCAGAGGAATTCCTCGCTTGTTCAGGGGGTAAGGGGGGCGGCGTAATCCAGGGGACTGCGAGTGAAGCTACGCTAGTTGCCTTGCTTGGAGCCAAAGCACGTGCCATTCATCATGTGAAAAAAGAACACCCAGATTGGAAAGATGCCGATATAGCCGAGAAATTGGTGGGATACACTTCTAGTCAAAGTCATTCTTCGGTTGAACGAGCTGGTCTTCTTGGTGGTGTTAAGTTAAGAGGTCTACCCACAGACGAATCAAACCGACTACGAGGGGACACTTTAGAAAGGGCAATCAAGGAGGATAGAGAAGCTGGCCTTATTCCATTTTACGTTGTCGCCACCCTGGGAACAACCTCATCCTGCACCTTTGACAACCTTGAAGAGATCGGTCCCGTGTGTAATGTTAACAAGGTGTGGCTCCACATCGACGCCGCTTACGCAGGCGCAGCCTTCACTTGTCCCGAGTACAGGTATCTGATGAAGGGCGTAGAGATGGCCGATTCCTTTGACTTCAACCCGCACAAATGGATGTTGGTCACATTTGACTGTTCTGCAATGTGGCTCAAAGACCCCAACTGGCTCGTGGATGCCTTCAATGTTGACCCCCTCTACTTGAAACACGACCAACAAGGCTCAGCACCGGATTACAGACACTGGCAGATTCAGCTCGGCCGTAGGTTCAGAGCTCTCAAGATTTGGTTTGTCTTGAGATTGTACGGAGTCGAGAACATCCAGAAGCATATACGGAAGCAGATTGGGCTTGCACACCATTTCGAAGATTTGGTCAAGTCGGACGATAGGTTCGAGGTAACTGAGGAGGTGCTTATGGGTTTGGTGTGCTTCAGGCTAAAGGGCCAGTCGAACGAAGTCAACGAACGACTTCTGAAGAGGATCAACGCAAGGGGTACCATACATTTGGTTCCTTCTAAGATAAGAGAAATGTACTTTTTGAGAATGGCTGTATGCTCTAGGTTAACTGAGAAGGAAGACATGGATTTATCATGGAAAGAAGTACGGGAATCTGCTGATGATATTTTGGGAGAGTAGAAAATGAATGAATTTTAGGTGCATCTGTTATACCTCAACATGTATTCCTGCCACATAATAACGATTAATAATTATTTATAAATTATTTATTGCAATAAATGTATATATGTATGTGTTGGAAGGACCAATAAAAAACAGCTAAATTATGTATTGTACAAGTAAATATAATTGTTGAAGCACTTATGAAGAATAAACTCGAATTTTTACATAACATAGCGATCAATCAAAATGACAAGTTCATGATTTCT
SEQ ID No.2
MEANQFRDFGKAMIDYVANYLENIRERRVLPTVEPGYLRPLLPSEAPQKPDTWQEVMADIEKVIMPGVTHWHSPKFHAYFPTANSYPAIVADILSDGIACIGFSWIASPACTELEVVMMDWLGKMIGLPEEFLACSGGKGGGVIQGTASEATLVALLGAKARAIHHVKKEHPDWKDADIAEKLVGYTSSQSHSSVERAGLLGGVKLRGLPTDESNRLRGDTLERAIKEDREAGLIPFYVVATLGTTSSCTFDNLEEIGPVCNVNKVWLHIDAAYAGAAFTCPEYRYLMKGVEMADSFDFNPHKWMLVTFDCSAMWLKDPNWLVDAFNVDPLYLKHDQQGSAPDYRHWQIQLGRRFRALKIWFVLRLYGVENIQKHIRKQIGLAHHFEDLVKSDDRFEVTEEVLMGLVCFRLKGQSNEVNERLLKRINARGTIHLVPSKIREMYFLRMAVCSRLTEKEDMDLSWKEVRESADDILGE
Example 2
Plasmid vector pET24a-DDC and clone strain pET24a-DDC-E.coliPreparation of Trans1T1
1. The PCR product obtained in example 1 was purified and recovered using a Kit available from TaKaRa (TaKaRa DNA Ligation Kit < Mighty Mix >);
2. construction of the plasmid vector pET24a-DDC
The PCR-amplified DNA sequence and pET24a vector were double-digested with the same restriction enzymes NdeI and HindIII, and the digested products were recovered and purified and used with T4DNA ligase is connected to obtain a plasmid vector pET24 a-DDC;
connecting a reaction system:
PCR product of DDC Gene 6μl
pET24a 1μl
5×buffer 2μl
T4DNA ligase 1μl
The conditions of the ligation reaction were: the plasmid pET24a-DDC was constructed by ligation overnight at 16 ℃.
3. Obtaining the clone strain pET24a-DDC-E.coli Trans1T1
Transformation of the plasmid vector pET24a-DDC intoE.coli Trans 1T1：
(1) Take 20. mu.l of competent cell Trans1T1 frozen and thawed on ice, mix gently in the above 10. mu.l of ligation reaction solution;
(2) standing on ice for 30min, performing heat shock treatment at 42 deg.C for 45s, and rapidly standing on ice for 2 min;
(3) adding 800 μ L LB culture medium (10 g/L peptone, 5g/L yeast powder, 5g/L sodium chloride) on a clean bench, and shake-culturing at 37 deg.C for 1 h;
（4）4000gcentrifuging the culture solution, coating the culture solution on an LB (lysogeny broth) flat plate containing kanamycin, performing overnight culture at 37 ℃, screening positive transformants, sequencing to ensure that a target strain is obtained, and transferring the target strain to a liquid culture medium for culture;
(5) a large amount of recombinant plasmid pET24a-DDC was extracted using a kit of TaKaRa, and the transformation of the expression host was continued.
Example 3
Construction of recombinant expression Strain pET24a-DDC-E.coli BL21(DE3)
1. Strain culture: the constructed recombinant plasmid pET24a-DDC was extracted from the cloning host, and the recombinant plasmid was transformed intoE.coli.BL21(DE3) competent cells. Transformation operation As in the above example 2 transformation steps, finally picking 1-2 single colony inoculated to containing kanamycin final concentration of 0.2% of LB medium (LB medium is the existing conventional formulation), 37 degrees overnight culture;
2. main culture: transferring the culture medium into 100ml LB/Kan culture medium according to 1% inoculum size after culturing for 12h, and performing shake culture at 37 ℃ until OD600=0.4-0.6；
3. Inducing expression: adding IPTG with final concentration of 0.25 mM to induce the bacterial cells, and inducing at the low temperature of 18 ℃ and 200 rpm for 20 h;
4. collecting whole cells: centrifuging at 4 deg.C and 6000rpm for 8-10min to collect thallus, mixing with 10ml PBS, and ultrasonic crushing for 10min until the liquid is transparent;
5. extraction of soluble protease DDC: centrifuging the bacterial liquid at 12000rpm and 4 ℃ for 5min, and taking supernatant fluid to obtain soluble protein (the ladybug dopa decarboxylase DDC). The pellet is typically broken cells and a small amount of background expressed protein.
SDS-PAGE electrophoresis was performed to detect the expressed target protein, as shown in FIG. 1.
Example 4
Purified harmonia axyridis dopa decarboxylase DDC
1. Cleaning a protein purifier pipeline: the ultrasonic pure water, 50mM (A pump) and 500mM (B pump) imidazole mobile phase are used for cleaning the pipeline of the protein purifier and the nickel column in sequence to remove impurities in the protein purifier.
2. Loading: the crude enzyme solution obtained in example 3 was applied to the column, and the sample was injected at a flow rate of 1-1.5 ml/min using pump A mobile phase, and the target protein had His tag and thus could be adsorbed to the nickel column, while the foreign protein without His tag and other impurities could not be adsorbed and thus washed off.
3. Eluting to obtain pure enzyme: eluting target protein with pump B at flow rate of 2-3ml/min, collecting eluate, which is target protein (pure enzyme), ultrafiltering and centrifuging the eluate, sampling, performing electrophoresis with 8% SDS polyacrylamide gel, and observing the change of dopa decarboxylase content before and after purification, as shown in FIG. 2.
Example 5
Method for catalyzing 5-hydroxytryptamine to generate 5-hydroxytryptamine by using dopa decarboxylase DDC of harmonia axyridis
1. Reaction system: 5-hydroxytryptophan with the initial concentration of 10g/l is taken as a substrate, 20mM PLP is added, TrisHCl 7.2 buffer solution is used for adjusting the pH of the system to be about 7.2, 15 g/l pure enzyme is added, the total system is 2ml, the shaking reaction is carried out at 35 ℃, and 200 mu l of sample is taken every 30 min. The sample is boiled at high temperature, filtered by a 0.22 μm filter and stored in a refrigerator at-20 ℃ for later use.
2. And (3) product detection: after 12 hours of reaction, the formation of 5-hydroxytryptamine was detected by high performance liquid chromatography (using Agilent TC-C18 column (150 mM. times.4.6 mM,5 μm), 10mM phosphate buffer solution-methanol (88: 12) as mobile phase, flow rate of 1.0 ml/min, detection wavelength of 276nm, column temperature: 25 ℃ C.). The calculation shows that the yield of the 5-hydroxytryptamine reaches 3.4g/l, and the conversion rate reaches over 90 percent.
Example 6
Specificity research of 5-hydroxytryptophan catalyzed by dopa decarboxylase DDC of harmonia axyridis
1. Reaction system: taking 10g/l tryptophan and 5-hydroxytryptophan as substrates, respectively, adding 20mM PLP, adjusting the pH of the system to about 7.2 by using Tris HCl 7.2 buffer solution, adding 15 g/l pure enzyme, wherein the total system is 2ml, carrying out shake reaction at 35 ℃, and sampling 200 mu l every 30 min. The sample is boiled at high temperature, filtered by a 0.22 μm filter and stored in a refrigerator at-20 ℃ for later use. Meanwhile, tryptophan was used as a substrate as a control group.
2. And (3) product detection: after 12 hours of reaction, the formation of 5-hydroxytryptamine was detected by high performance liquid chromatography (using Agilent TC-C18 column (150 mM. times.4.6 mM,5 μm), 10mM phosphate buffer-methanol (88: 12) as mobile phase, flow rate of 1.0 ml/min, detection wavelength of 276nm, column temperature: room temperature).
The detection results are shown in fig. 2: the substrate of the control group with tryptophan as the substrate is not changed, and no new product is generated; the experimental group using 5-hydroxytryptophan as substrate can obviously see that 5-hydroxytryptophan is completely consumed and a new product 5-hydroxytryptophan is generated.
The above description is only a preferred embodiment of the present invention, and the scope of the present invention is not limited thereto, and any simple modifications or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope of the present invention are within the scope of the present invention.
Sequence listing
<110> Nanjing university of industry
<120> harmonia axyridis dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1952
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aaaacccagt gaaggtaacc cccatgtaca acgaggttca gcatgtcaaa acgatcgatc 60
tggccccact tcttcttgtc ctctgattta aactcttgca gtagccagaa gaacgctttt 120
actctcgctg cagccaaccg tgcctgtcca gtctgggaaa ctgagagttt tccgtggaga 180
ttgttcagtg tgataagtga taagtgataa ggaggctgcg tatctattaa gtggattgtt 240
ggatatcctt ttatttattt gagatttaaa gagatggagg ctaatcagtt tagggacttc 300
ggaaaggcga tgatagacta cgtcgccaat tatctggaga atataaggga gaggcgggtt 360
ttgcctactg tagaaccagg gtatttacgt cctctacttc ccagtgaggc accacaaaaa 420
cctgacacat ggcaagaagt tatggctgac attgaaaaag tcattatgcc tggagttaca 480
cactggcatt caccaaagtt tcatgcatat tttcctactg ccaactccta tcctgctatt 540
gtagcagata ttctcagtga tggtattgct tgcatcggtt tttcatggat cgcaagtccc 600
gcttgcaccg aactcgaagt cgtgatgatg gactggttgg gaaaaatgat aggtctccca 660
gaggaattcc tcgcttgttc agggggtaag gggggcggcg taatccaggg gactgcgagt 720
gaagctacgc tagttgcctt gcttggagcc aaagcacgtg ccattcatca tgtgaaaaaa 780
gaacacccag attggaaaga tgccgatata gccgagaaat tggtgggata cacttctagt 840
caaagtcatt cttcggttga acgagctggt cttcttggtg gtgttaagtt aagaggtcta 900
cccacagacg aatcaaaccg actacgaggg gacactttag aaagggcaat caaggaggat 960
agagaagctg gccttattcc attttacgtt gtcgccaccc tgggaacaac ctcatcctgc 1020
acctttgaca accttgaaga gatcggtccc gtgtgtaatg ttaacaaggt gtggctccac 1080
atcgacgccg cttacgcagg cgcagccttc acttgtcccg agtacaggta tctgatgaag 1140
ggcgtagaga tggccgattc ctttgacttc aacccgcaca aatggatgtt ggtcacattt 1200
gactgttctg caatgtggct caaagacccc aactggctcg tggatgcctt caatgttgac 1260
cccctctact tgaaacacga ccaacaaggc tcagcaccgg attacagaca ctggcagatt 1320
cagctcggcc gtaggttcag agctctcaag atttggtttg tcttgagatt gtacggagtc 1380
gagaacatcc agaagcatat acggaagcag attgggcttg cacaccattt cgaagatttg 1440
gtcaagtcgg acgataggtt cgaggtaact gaggaggtgc ttatgggttt ggtgtgcttc 1500
aggctaaagg gccagtcgaa cgaagtcaac gaacgacttc tgaagaggat caacgcaagg 1560
ggtaccatac atttggttcc ttctaagata agagaaatgt actttttgag aatggctgta 1620
tgctctaggt taactgagaa ggaagacatg gatttatcat ggaaagaagt acgggaatct 1680
gctgatgata ttttgggaga gtagaaaatg aatgaatttt aggtgcatct gttatacctc 1740
aacatgtatt cctgccacat aataacgatt aataattatt tataaattat ttattgcaat 1800
aaatgtatat atgtatgtgt tggaaggacc aataaaaaac agctaaatta tgtattgtac 1860
aagtaaatat aattgttgaa gcacttatga agaataaact cgaattttta cataacatag 1920
cgatcaatca aaatgacaag ttcatgattt ct 1952
<210> 2
<211> 476
<212> PRT
<213> Amino acid sequence (Amino acid sequence)
<400> 2
Met Glu Ala Asn Gln Phe Arg Asp Phe Gly Lys Ala Met Ile Asp Tyr
1 5 10 15
Val Ala Asn Tyr Leu Glu Asn Ile Arg Glu Arg Arg Val Leu Pro Thr
20 25 30
Val Glu Pro Gly Tyr Leu Arg Pro Leu Leu Pro Ser Glu Ala Pro Gln
35 40 45
Lys Pro Asp Thr Trp Gln Glu Val Met Ala Asp Ile Glu Lys Val Ile
50 55 60
Met Pro Gly Val Thr His Trp His Ser Pro Lys Phe His Ala Tyr Phe
65 70 75 80
Pro Thr Ala Asn Ser Tyr Pro Ala Ile Val Ala Asp Ile Leu Ser Asp
85 90 95
Gly Ile Ala Cys Ile Gly Phe Ser Trp Ile Ala Ser Pro Ala Cys Thr
100 105 110
Glu Leu Glu Val Val Met Met Asp Trp Leu Gly Lys Met Ile Gly Leu
115 120 125
Pro Glu Glu Phe Leu Ala Cys Ser Gly Gly Lys Gly Gly Gly Val Ile
130 135 140
Gln Gly Thr Ala Ser Glu Ala Thr Leu Val Ala Leu Leu Gly Ala Lys
145 150 155 160
Ala Arg Ala Ile His His Val Lys Lys Glu His Pro Asp Trp Lys Asp
165 170 175
Ala Asp Ile Ala Glu Lys Leu Val Gly Tyr Thr Ser Ser Gln Ser His
180 185 190
Ser Ser Val Glu Arg Ala Gly Leu Leu Gly Gly Val Lys Leu Arg Gly
195 200 205
Leu Pro Thr Asp Glu Ser Asn Arg Leu Arg Gly Asp Thr Leu Glu Arg
210 215 220
Ala Ile Lys Glu Asp Arg Glu Ala Gly Leu Ile Pro Phe Tyr Val Val
225 230 235 240
Ala Thr Leu Gly Thr Thr Ser Ser Cys Thr Phe Asp Asn Leu Glu Glu
245 250 255
Ile Gly Pro Val Cys Asn Val Asn Lys Val Trp Leu His Ile Asp Ala
260 265 270
Ala Tyr Ala Gly Ala Ala Phe Thr Cys Pro Glu Tyr Arg Tyr Leu Met
275 280 285
Lys Gly Val Glu Met Ala Asp Ser Phe Asp Phe Asn Pro His Lys Trp
290 295 300
Met Leu Val Thr Phe Asp Cys Ser Ala Met Trp Leu Lys Asp Pro Asn
305 310 315 320
Trp Leu Val Asp Ala Phe Asn Val Asp Pro Leu Tyr Leu Lys His Asp
325 330 335
Gln Gln Gly Ser Ala Pro Asp Tyr Arg His Trp Gln Ile Gln Leu Gly
340 345 350
Arg Arg Phe Arg Ala Leu Lys Ile Trp Phe Val Leu Arg Leu Tyr Gly
355 360 365
Val Glu Asn Ile Gln Lys His Ile Arg Lys Gln Ile Gly Leu Ala His
370 375 380
His Phe Glu Asp Leu Val Lys Ser Asp Asp Arg Phe Glu Val Thr Glu
385 390 395 400
Glu Val Leu Met Gly Leu Val Cys Phe Arg Leu Lys Gly Gln Ser Asn
405 410 415
Glu Val Asn Glu Arg Leu Leu Lys Arg Ile Asn Ala Arg Gly Thr Ile
420 425 430
His Leu Val Pro Ser Lys Ile Arg Glu Met Tyr Phe Leu Arg Met Ala
435 440 445
Val Cys Ser Arg Leu Thr Glu Lys Glu Asp Met Asp Leu Ser Trp Lys
450 455 460
Glu Val Arg Glu Ser Ala Asp Asp Ile Leu Gly Glu
465 470 475
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
catatgatgg ccttgttgcc gttgg 25
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cccaagcttc tactttgccg ccggaat 27

Claims (8)

1. A ladybug-derived dopa decarboxylase is characterized in that: the nucleotide sequence of the ladybug-derived dopa decarboxylase is shown in SEQ ID NO. 1.
2. The ladybug-derived dopa decarboxylase of claim 1, wherein: the amino acid sequence of the dopa decarboxylase is shown in SEQ ID NO. 2.
3. A recombinant plasmid comprising the nucleotide sequence of the harmonia axyridis-derived dopa decarboxylase of claim 1.
4. A recombinant vector expressing the recombinant plasmid of claim 3.
5. A recombinant strain transformed with the recombinant vector of claim 4.
6. Use of the ladybug-derived dopa decarboxylase as defined in claim 1, the recombinant plasmid as defined in claim 3, the recombinant vector as defined in claim 4, or the recombinant strain as defined in claim 5 for catalyzing 5-hydroxytryptamine.
7. The use of claim 6, wherein the ladybug-derived dopa decarboxylase for catalyzing 5-hydroxytryptamine comprises the following steps:
step 1, designing a primer, and amplifying a nucleotide sequence shown as SEQ ID No.1 by using PCR;
step 2, construction of a plasmid vector such as pET24a-DDC
The PCR-amplified DNA sequence and pET24a vector were double-digested with the same restriction enzymes NdeI and HindIII, and then digested with T4DNA ligase is used for connecting the purified enzyme-cleaved product to obtain a plasmid vector pET24 a-DDC;
step 3, constructing clone strain pET24a-DDC-E.coli Trans1T1
Transformation of the plasmid vector pET24a-DDC intoE.coli Trans1T1 to obtain positive transformant, and determining the positive transformant as a target strain through colony PCR screening and sequencing;
step 4, constructing expression strain pET24a-DDC-BL21(DE3)
The target strain pET24a-DDC-E.coli Trans1T 1-derived plasmid was transformedE.coliBL21(DE3), selecting positive transformant, directly cloning and culturing to obtain recombinant expression strain pET24a-DDC-BL21(DE 3);
step 5, in vitro inducible expression
The recombinant expression strain pET24a-DDC-BL21(DE3) was inoculated into 5ml of LB medium containing kanamycin, cultured overnight at 25-40 ℃ for 10-20 hours, and then inoculated into 100ml of LB medium containing kanamycin in an inoculum size of 1%, when OD is reached600=0.4-0.6, adding IPTG with final concentration of 0.5mM-1mM, inducing at 16-25 deg.C and 250rpm for 20-24 h;
step 6, obtaining dopa decarboxylase
Centrifuging at 6000-12000rpm at 4 ℃ for 7-10min after the in vitro induction expression is finished, collecting thalli, washing the thalli with PBS buffer solution for three times, then resuspending the thalli with the PBS buffer solution, then placing the thalli on ice for ultrasonic crushing, wherein 10-15min is carried out each time, the interval of 2 seconds of ultrasonic treatment is 3 seconds, and then centrifuging at 6000-12000rpm at 4 ℃ for 7-10min to collect supernatant, thus obtaining crude enzyme liquid DDC;
step 7, purification of crude enzyme solution
Cleaning a protein purifier pipeline and a nickel column by using ultrasonic pure water and 50mM and 500mM imidazole in sequence, removing impurities, loading the crude enzyme solution obtained in the step 6 on the column, opening the pipeline by using 50mM imidazole, wherein the target protein has a His label and can be adsorbed on the nickel column, washing out the foreign protein without the His label and other impurities, eluting the target protein by using 500mM imidazole, collecting eluent, and performing 8% SDS polyacrylamide gel electrophoresis on the eluent;
step 8, catalytic application
Adjusting the pH of the system to 7.2 by 10g/l of 5-hydroxytryptophan, 20mM PLP and TrisHCl 7.2 buffer solution, adding 100 mu l of eluent obtained in the step 7, wherein the total amount is 2ml, and carrying out shaking reaction at 35 ℃ to obtain the 5-hydroxytryptophan.
8. The use according to claim 7,
the primers in the step 1 are as follows: and (3) primers Chi-F: 5'-CATATGATGGCCTTGTTGCCGTTGG-3' the flow of the air in the air conditioner,
a downstream primer Chi-R: 5'-CCCAAGCTTCTACTTTGCCGCCGGAAT-3' are provided.
CN202110501473.XA 2021-05-08 2021-05-08 Iris japonica dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine Pending CN113234710A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110501473.XA CN113234710A (en) 2021-05-08 2021-05-08 Iris japonica dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110501473.XA CN113234710A (en) 2021-05-08 2021-05-08 Iris japonica dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine

Publications (1)

Publication Number Publication Date
CN113234710A true CN113234710A (en) 2021-08-10

Family

ID=77132699

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110501473.XA Pending CN113234710A (en) 2021-05-08 2021-05-08 Iris japonica dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine

Country Status (1)

Country Link
CN (1) CN113234710A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111235080A (en) * 2020-01-19 2020-06-05 福建师范大学 Gene recombination escherichia coli and production method of 5-hydroxytryptamine

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111235080A (en) * 2020-01-19 2020-06-05 福建师范大学 Gene recombination escherichia coli and production method of 5-hydroxytryptamine

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BERTOLDI ET AL.,: ""Mammalian Dopa decarboxylase: structure, catalytic activity and inhibition"", 《ARCH BIOCHEM BIOPHYS》 *
BERTOLDI M ET AL.,: ""Reaction and substrate specificity of recombinant pig kidney dopadecarboxylase under aerobic and anaerobic conditions"", 《BIOCHIMICA ET BIOPHYSICA ACTA (BBA)-PROTEINS PROTEOMICS》 *
TORRENS-SPENCE MP ET AL.,: ""Structural basis for divergent and convergent evolution of catalytic machineries in plant aromatic amino acid decarboxylase proteins"", 《PROC NATL ACAD SCI》 *
匿名: ""Harmonia axyridis dopa decarboxylase mRNA, complete cds"", 《GENBANK》 *

Similar Documents

Publication Publication Date Title
CN108865962B (en) Escherichia coli engineering bacterium capable of efficiently and soluble expressing 4-alpha-glycosyltransferase
CN112391365B (en) Starch branching enzyme mutant with improved catalytic activity and application thereof
CN112725319B (en) Alginate lyase FaAly7 with polyG substrate specificity and application thereof
CN111826360B (en) Leucine dehydrogenase mutant with improved catalytic activity and application thereof
CN111172142B (en) Cephalosporin C acylase mutant with high thermal stability
CN112708589A (en) Genetically engineered bacterium, construction method thereof and application of genetically engineered bacterium in fermentation production of 5-hydroxytryptophan
CN110499301B (en) Meso-diaminopimelate dehydrogenase mutant with improved catalytic efficiency
CN109072215B (en) Cephalosporin C acylase mutant and application thereof
CN113801240B (en) D-psicose-3-epimerase activity aggregate and preparation method and application thereof
CN111088183A (en) Marine vibrio and application thereof in preparation of iota-carrageenase with thermal stability
CN111454918B (en) Enol reductase mutant and application thereof in preparation of (R) -citronellal
CN111057686B (en) Alcohol dehydrogenase mutant and application thereof
CN110129305B (en) Cephalosporin C acylase mutant for preparing 7-ACA
CN114836406B (en) Agarase mutant with improved catalytic activity and application thereof
CN115058408B (en) Metagenome-derived high-specific-activity acid-resistant D-psicose 3-epimerase and encoding gene and application thereof
CN110257361A (en) A kind of algin catenase and its gene and application
CN113234710A (en) Iris japonica dopa decarboxylase DDC and application thereof in catalytic production of 5-hydroxytryptamine
CN111808836B (en) Heat-resistant mutant enzyme of pullulanase I and preparation method and application thereof
CN111876436B (en) Methionine lyase and coding gene and application thereof
CN110951716B (en) Circumscribed alginate lyase VsAly7D, recombinant strain thereof and application thereof
CN114958893A (en) Construction method of lactase required by preparation of high-temperature creep feed for porkets
CN109022471B (en) Escherichia coli expression system for producing oxalate oxidase, and production method and application of oxalate oxidase
CN110144340B (en) Chitosanase CsnQ and application thereof
CN106636019B (en) High-efficiency catalytic synthesis of (S) -phenyl glycol by using (S) -carbonyl reductase oligomer mediated by Sortase A
CN113249350B (en) Copper-containing amine oxidase capable of degrading biogenic amine and derived from saccharopolyspora holtziae and application of copper-containing amine oxidase

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20210810

RJ01 Rejection of invention patent application after publication