CN113234602A

CN113234602A - Chaetomium globosum, microbial inoculum, seed soaking liquid and application

Info

Publication number: CN113234602A
Application number: CN202110359081.4A
Authority: CN
Inventors: 张颖施; 陈娟; 陈泽怡; 彭锦胜; 梁均钿
Original assignee: Moon Guangzhou Biotech Co ltd
Current assignee: Moon Guangzhou Biotech Co ltd
Priority date: 2021-04-01
Filing date: 2021-04-01
Publication date: 2021-08-10
Anticipated expiration: 2041-04-01
Also published as: CN113234602B

Abstract

The invention discloses chaetomium globosum, a microbial inoculum, a seed soaking solution and application, and relates to the technical field of agricultural biology. Is preserved in Guangdong province microorganism culture collection center, and the preservation number is GDMCC No: 61363 under the taxonomic name Chaetomium globosum. Experiments prove that the strain has broad spectrum for improving the stress resistance of crops, and can obviously improve the drought resistance and the saline-alkali resistance of the crops. Under the stress of drought environment, chaetomium globosum MN110495 can produce extracellular polysaccharide, antioxidant and other substances to resist the drought environment and improve the drought resistance of various plants such as fruits, vegetables, grain crops and the like. Chaetomium globosum also has the function of promoting seed germination and crop growth.

Description

Chaetomium globosum, microbial inoculum, seed soaking liquid and application

Technical Field

The invention relates to the technical field of agricultural biology, and particularly relates to chaetomium globosum, a microbial inoculum, a seed soaking solution and application.

Background

The shortage of water resources is a global problem restricting the agricultural production at present, the global industrialization is rapidly developed, natural disasters are frequent, the precipitation is reduced, about 43 percent of cultivated lands are dry early and semi-dry early areas, the dry early stress seriously influences the growth and development of plants, and the crop yield is reduced. At present, in the agricultural field, seaweed fertilizers, amino acid water-soluble fertilizers and plant growth regulators are mainly used for assisting drought resistance of crops, and humic acid is one of the representatives of the seaweed fertilizers, the amino acid water-soluble fertilizers and the plant growth regulators. Humic acid fertilizer is a kind of chemical fertilizer made up by using peat rich in humic acid and weathered coal as main raw material and making them pass through the processes of ammoniation, nitration and salinization, and adding trace elements and other preparation. Although humic acid has multiple effects of promoting the growth and development of crop roots, enhancing the stress resistance of crops, increasing yield and enhancing efficiency and the like, the humic acid also has a series of problems of high cost, long production period and the like of the traditional fertilizer.

In recent years, researches for promoting crop growth and improving crop stress resistance by using microorganisms are increasing. Patent CN103667132B discloses that a Bacillus cereus L90 can improve walnut drought resistance. Patent CN110358695A discloses that pseudomonad G3 can improve drought resistance of red date plants. Patent CN105754901B discloses that Klebsiella LTGPAF-6F can improve the drought stress defense capacity of wheat seedlings. However, the existing patents have the following problems: most of the strains only have effect on a single certain crop, and cannot generate broad-spectrum synergistic effect on most of conventional crops. Therefore, the development of more efficient, broad-spectrum and economic microbial fertilizers is urgently needed to improve the drought resistance and saline-alkali resistance of crops and promote the rapid growth of the crops in adverse environments.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide chaetomium globosum, a microbial inoculum, a seed soaking solution and application to solve the technical problems.

The invention is realized by the following steps:

the invention provides application of a fungal strain of Chaetomium globosum (Chaetomium globosum) species in preparation of seed soaking liquid, seed soaking powder or a microbial agent.

The chaetomium globosum is preserved in the Guangdong province microorganism strain preservation center at the preservation address: the preservation date of the No. 59 building 5 of the No. 100 institute of Pieli Zhonglu, Guangzhou province, microorganism research institute: 12/10/2020, accession number GDMCC No: 61363 under the taxonomic name Chaetomium globosum.

The invention provides an application of a fungal strain of Chaetomium globosum (Chaetomium globosum) species in preparing a crop growth regulator or a seed germination regulator.

The crop growth regulator is suitable for the growth regulation of economic and grain crops in saline-alkali soil, arid land barren soil or fertile soil; the seed germination regulator is suitable for the germination of seeds of economic crops and grain crops;

preferably, the commercial crop is selected from at least one of the following commercial crops: solanaceae, Rosaceae, Rutaceae, Musaceae, Cucurbitaceae, Papilionaceae, Compositae, Liliaceae, Zingiberaceae, Passifloraceae, Anacardiaceae, Araliaceae and Cactaceae; the food crop is selected from Gramineae;

preferably, the fungal strain is a strain deposited under the accession number GDMCC No: 61117 the deposited Chaetomium globosum or its progeny strain.

The invention provides a chaetomium globosum, which is preserved in the Guangdong province microorganism strain preservation center with the preservation address as follows: the preservation date of the No. 59 building 5 of the No. 100 college of the Pieli Zhonglu city, Guangdong province microbial research institute: 12/10/2020, accession number GDMCC No: 61363 under the taxonomic name Chaetomium globosum.

In a preferred embodiment of the present invention, the colony culture of chaetomium globosum is characterized by: the hyphae on the fungus culture medium are white initially, light brown later, grey brown to olive brown in the ascocarp shell, medium-sized, scattered or aggregated, and oval.

Optionally, the fungal culture medium is a PDA medium, a SDAY medium, a liquid Sabouraud medium, a modified Martin medium, malt extract, corn meal agar, a high salinity Chachi medium, or a Bengal medium.

Optionally, the optimal growth temperature of chaetomium globosum is 25-30 ℃.

The invention also provides seed soaking liquid or seed soaking powder, which comprises the chaetomium globosum.

In a preferred embodiment of the present invention, the chaetomium globosum is an effective component of seed soaking liquid or seed soaking powder. Preferably, the effective amount of chaetomium globosum in the seed soaking solution is 10⁴cfu/mL～10⁹cfu/mL。

Preferably, the effective amount of chaetomium globosum in the seed soaking solution is 10⁶cfu/mL。

Alternatively, the seed soaking liquid or seed soaking powder is suitable for seed soaking of crops.

Optionally, the crop comprises at least one of a cash crop and a food crop.

Optionally, the cash crop is selected from at least one of the following cash crops: solanaceae, Rosaceae, Rutaceae, Musaceae, Cucurbitaceae, Papilionaceae, Compositae, Liliaceae, Zingiberaceae, Passifloraceae, Anacardiaceae, Araliaceae and Cactaceae; the food crop is selected from Gramineae.

Optionally, the solanaceae is selected from at least one solanaceae crop of: potatoes, peppers and tomatoes; rosaceae is selected from at least one of the following Rosaceae crops: strawberry and papaya; the Rutaceae is selected from Rutaceae crops as follows: citrus; the Musaceae family is selected from Musaceae crops as follows: bananas; cucurbitaceae family selected from cucumber; the Papilionaceae family is selected from semen glycines, the Compositae family is selected from lettuce, the Liliaceae family is selected from Bulbus Allii, the Zingiberaceae family is selected from rhizoma Zingiberis recens, the Passiflorae family is selected from Passiflora edulis, the Anacardiaceae family is selected from fructus Ananadis Comosi, the Araliaceae family is selected from Notoginseng radix, and the Cactaceae family is selected from fructus Hylocerei.

The invention also provides a microbial inoculum which comprises the chaetomium globosum; preferably, the microbial inoculum takes chaetomium globosum as a main effective component.

The invention also provides application of chaetomium globosum in preparation of seed soaking liquid, seed soaking powder or a microbial inoculum.

The invention also provides application of chaetomium globosum or a microbial inoculum in preparing a crop growth regulator or a seed germination regulator.

The crop growth regulator is suitable for the growth regulation of economic and grain crops in saline-alkali soil, arid land barren soil or fertile soil; the seed germination regulator is suitable for seed germination of economic crops and grain crops.

The invention also provides a fertilizer or a pesticide, which comprises the chaetomium globosum or the microbial inoculum.

In a preferred embodiment of the present invention, the fertilizer or pesticide is applied to the foliage or roots of the crops.

The invention has the following beneficial effects:

the invention provides Chaetomium globosum, which has broad spectrum for improving the stress resistance of crops and can obviously improve the drought resistance and the saline-alkali resistance of the crops. Under the stress of drought environment, chaetomium globosum MN110495 can produce extracellular polysaccharide, antioxidant and other substances to resist the drought environment and improve the drought resistance of various plants such as fruits, vegetables, grain crops and the like. The chaetomium globosum has the functions of promoting seed germination and crop growth, and can produce indoleacetic acid to resist drought stress, raise the germination speed of seed and the growth speed of crop in drought environment and raise the survival rate of crop. In addition, chaetomium globosum can improve the saline-alkali resistance of crops and promote the growth of the crops in the saline-alkali environment.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention, and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a phylogenetic tree analysis diagram;

FIG. 2 is a diagram of the harvest of a wheat plant pot plant on the next rehydration day.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

Optionally, the optimal growth temperature of chaetomium globosum is 25-30 ℃.

The ITS sequencing result of the strain is shown as the following SEQ ID NO. 1:

ACATTACAGAGTTGCAAAACTCCCTAAACCATTGTGAACGTTACCTATACCGTTGC TTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCG CCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGA ATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGC GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC ACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATC AAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGG CGGGCTCGCTGTCGCACCGAGCGTAGTAGCATACATCTCGCTCTGGTCGCGCCGCGGG TTCCGGCCGTTAAACCACCTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACC CGCTGAACTTAAGCATATCA

the sequencing result of the strain is shown as the following SEQ ID NO. 2:

CGGGCGGAAGAGCTGGCCGAAGGGGCCGGCACGGACGGCATCCATGGTGCCGG GCTCCAAGTCGACGAGGACAGCGCGAGGAACATACTTGTTGCCGGAAGCCTGTATAAT ACTATGAGCACGCCATCACTCGGTCGTGTAAAATTATTTGACCCGACTGACCTCGTTGA AGTACACGTTCATACGCTCGAGCTGGAGCTCGGAGGTGCCGTTGTACCTATCGAAGCG GTGAGCGGGGATTTATCGGTTGGGAACTGTCATGCCCACATACACGCCATTGCTGTCG AGGCCGTGCTCGCCAGAGATGGTCTGCCTGAAAAGAAGTCAGTCTCGATTGTCATCA GCCAAGAGTGTTTGCTTTGCTTGGACGTACCAGAAAGCGGCACCGATTTGGTTACCCT AGAGAGCTCCATGTCAGTTATCCTGCGCGGCCGGTCGGTCGTAATGTTCGATTCGGTC CAACTTACGCACTGGCCGGTCTGGAGGTGAACCTATAGTACGAAAAAGCAGTCAGCA TCATCAAGCTTCGCATCATCGTCGTGTTGCTATCCGTCAGGAGCTGTGGAAATGAGGG TCGTCCCGATGGGTGGGGTAGTTCAGGGGCCCAAAAAAAAAGCTCCCAGACGCGTCG TCGCCGTGCGGCTCAGGAATGTGCGGGGTGACTTACA

a phylogenetic tree established based on polygenes (ITS, BenA) showed that strain GDMCC 61363 was Chaetomium globosum.

The seed culture solution is a culture solution of chaetomium globosum or an aqueous dilution solution of chaetomium globosum.

In other embodiments, the chaetomium globosum can be produced into freeze-dried powder and seed soaking powder, and the seed soaking powder is mixed with water when in use. Optionally, the seed soaking liquid or the seed soaking powder further comprises a preservative, an antioxidant, a stabilizer and other ingredients to improve the stability and activity of the finished product.

In practical use, the seeds to be treated can be disinfected and then soaked. Number of spores in seed-soaking liquidThe fermentation culture can be adjusted according to the requirement, and optionally, the spore number of the fermentation liquor is adjusted to 10⁴CFU/mL or more.

Optionally, the crop comprises at least one of a cash crop and a food crop.

Optionally, the solanaceae is selected from at least one solanaceae crop of: potato, pepper, tobacco, Ningxia wolfberry fruit, stramonium, black nightshade and tomato; rosaceae is selected from at least one of the following Rosaceae crops: apple, pear, strawberry and papaya; the Rutaceae is selected from Rutaceae crops as follows: citrus; the Musaceae family is selected from the following Musaceae family crops: bananas; cucurbitaceae is selected from fructus Cucumidis Sativi, Cucurbita pepo, pulp Citrulli, fructus Cucurbitae Moschatae, etc.; the Papilionaceae family is selected from semen glycines, semen Viciae Fabae, semen Arachidis Hypogaeae, semen Pisi Sativi, semen Vignae sinensis, semen Phaseoli Radiati or semen Cajani, the Compositae family is selected from lettuce, caulis et folium Lactucae Sativae, herba Xanthii, flos Chrysanthemi or sunflower, the Liliaceae family is selected from Bulbus Allii, rhizoma Polygonati Odorati or rhizoma anemarrhenae, the Zingiberaceae family is selected from rhizoma Zingiberis recens, fructus Amomi or Curcuma rhizome, the Passiflorae family is selected from Passiflora edulis, the Anacardiaceae family is selected from fructus Ananadis Comosi, the Caucaceae family is selected from Notoginseng radix, and the Cactaceae family is selected from Hylochiaceae fructus Pyrolae.

In other embodiments, the seed soaking liquid or the seed soaking powder provided by the present invention may be used for seed soaking of other crops, without being limited to the above-mentioned types of crops.

The microbial inoculum can be liquid preparation, solid microbial inoculum, pasty microbial inoculum, suspending agent, emulsion, spray or semisolid microbial inoculum.

Besides chaetomium globosum as a main effective component, the microbial inoculum can also comprise other addition auxiliary agents.

In a preferred embodiment of the present invention, the fertilizer or pesticide is applied to the foliage or roots of the crops. The leaf fertilizer or root fertilizer can be water-soluble fertilizer or other soluble fertilizer.

The fertilizer can be used as a base fertilizer, and can also be applied by being mixed with other organic fertilizers, inorganic fertilizers or organic-inorganic fertilizers.

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Preparation of the following reagents

5% of sodium hypochlorite: 5ml of sodium hypochlorite and 95ml of sterile water are prepared on site without sterilization;

75% of ethanol: 26.67ml of sterile water and 73.33ml of 95 percent ethanol are prepared on site without sterilization;

PDA culture medium: PDA 16.04g, 400mL of tap water;

PDB culture medium: 9.6g of PDB and 400mL of tap water;

RBM medium: RBM 14.66g, tap water 400 mL;

sodium carboxymethylcellulose: 0.7% CMC suspension, 655rpm, 100 ℃, 2 hours heating and stirring, sterilizing at 121 ℃ for 20 min;

sterile water: weighing 1000ml of sterile water, sterilizing at 121 ℃ for 20 min.

Hoagland nutrient solution: 1.28g of calcium nitrate tetrahydrate is weighed and dissolved in 900mL of distilled water or deionized water by boiling, and 0.945g of calcium nitrate tetrahydrate is dissolved in 100mL of water. Mixing the two solutions, and autoclaving at 121 deg.C for 20 min.

AGPS medium: 10g/L of polypeptone, 10g/L of glycerol, S120 ml/L, S220 ml/L and S320 ml/L, and 0.1 percent of L-tryptophan (accounting for 0.1 percent of the mixed solution) is added before inoculation.

Solution 1: 14g/400mL of anhydrous dipotassium phosphate and 10.8g/400mL of anhydrous potassium dihydrogen phosphate;

solution 2: 50g/L of magnesium sulfate heptahydrate and 25g/L of anhydrous ammonium chloride;

solution 3: 10g/L of calcium chloride dihydrate;

salkowski reagent colorimetric solution: 250ml of H₂O，150ml H₂SO₄And 7.5ml of 5mol/L FeCl₃.6H₂And storing in an O, 4-degree refrigerator.

EPS special culture medium: 2% of yeast extract and K₂HPO₄ 1.5％、MgSO₄ 0.02％、MnSO₄0.0015％、 FeSO₄ 0.0015％、CaCl₂0.003%, NaCl 0.0015%, agar 1.5%, sucrose 10%, and pH 7.5;

50mM Hoagland saline alkali: NaCl 0.59g, NaHCO₃ 7.56g、Na₂SO₄ 12.78g、Na₂CO₃ 1.06g、hoagland 2L。

The culture medium and solution prepared above are sterilized in vertical pressure steam sterilizer at 121 deg.C for 20min except for special description.

Example 1

This example provides methods for screening, isolating and identifying Chaetomium globosum (Chaetomium globosum) MN110495 strain.

(1) Screening and isolation of strains:

the samples were from root soil collected from cotton plantation in Henan province. Weighing 10g of dry soil, putting the soil into a sterilized mortar, mashing the soil with a pestle, placing the gauze, washing with tap water, attaching clay to the gauze, transferring the gauze to a centrifuge tube, adding 50ml of sterile water, carrying out vortex, centrifuging at 10000rpm for 6min, pouring off supernatant, washing with sterile water, centrifuging again to precipitate particles to the bottom of a conical centrifuge tube, and repeatedly centrifuging and cleaning for 3 times. Diluting the above washed soil 1g with 20mL sterile sodium carboxymethylcellulose suspension, spreading the diluted precipitate on RBM medium, and culturing in dark at room temperature for 7 d. Inoculating mycelium into PDA culture medium, culturing in dark at room temperature for 7d, and separating to obtain Chaetomium globosum MN 110495.

(2) Identification of the strains:

hyphae of the colonies on PDA plates appeared initially white and later pale brown. The shell of the ascon ranges from grayish brown to olive brown, of medium size, loose or aggregated, ovoid.

The ITS and BenA sequence determination is respectively carried out on the strain, gene extraction and PCR amplification are finished by adopting a Biospin fungal genome DNA extraction kit, amplification primers and an operation method are shown in table 1, and an amplification product is sequenced by Jinzhi Biotech Limited company.

ITS and BenA sequence sequencing results are shown in SEQ ID NO.1 and SEQ ID NO. 2. The strain was registered to the National Center for Biotechnology Information (NCBI) website, and the sequencing results were subjected to homology search using BLAST search, sequence alignment (https:// BLAST. NCBI. nlm. nih. gov /), phylogenetic tree analysis, and it was determined that the strain was Chaetomium globosum. A phylogenetic tree analysis diagram is shown with reference to figure 1.

Table 1 PCR upstream and downstream primers.

Example 2

In this example, the fermentation broth of chaetomium globosum MN110495 strain was prepared.

The cells obtained in the separation and selection in example 1 were punched out in 18 pieces by a sterile punch, and the cells were filled in a 50mL sterile centrifuge tube containing 30mL PDB medium, and cultured in a constant temperature shaking incubator at 28 ℃ under 200rmp for 4 days, and the number of spores in the fermentation broth was adjusted to 10⁶CFU/mL。

Example 3

In this example, the influence of chaetomium globosum MN110495 strain on drought resistance of wheat seeds in germination period was studied. The technical route is shown in fig. 2.

Taking out wheat seeds (Jimai 23) from a refrigerator, selecting healthy seeds with consistent particle size, sterilizing with 75% ethanol for 1 min, washing with sterile water for 3 times, sterilizing with 5% sodium hypochlorite for 5min, and washing with sterile water for 3 times. Then seed soaking treatment is carried out by using the treatment solution under the condition of room temperature. The experimental group and the blank control group were set according to the treatment solutions.

The experimental components comprise an MN110495 treatment group, a negative control group and a positive control group, wherein the MN110495 treatment group uses the strain fermentation liquor in the embodiment 2 to soak seeds overnight; the negative control group is soaked by PDB culture solution; the positive control group was inoculated with a commercially available product (see table 2). The blank control group was also inoculated with PDB medium.

Then, sowing the seeds soaked in the seed soaking pot into a seedling pot, wherein the seedling pot is filled with a hoagland nutrient solution according to the weight ratio of 1: 8 (volume ml/mass g ratio), and repeating ten times, wherein the matrix soil is subjected to sterilization for 60min at 121 ℃ in a vertical steam autoclave before mixing, 3 seeds are sown in each seedling pot, and each group is subjected to sterilization. After sowing, 50mL of hoagland nutrient solution is poured into all seedling pots of the blank control group, and the experimental group is not poured. Then placing the mixture in a greenhouse at 25 ℃, illuminating for 12 hours every day, and carrying out drought treatment.

In the seed germination period (1-10 days after sowing), 10mL of hoagland nutrient solution is irrigated every other day by the experimental group, so that the soil humidity of the experimental group potted plant is maintained in a super severe drought state between 8% and 12%; and 0-20 mL of hoagland nutrient solution is irrigated to the blank control group every day, so that the soil humidity of the potted plant of the blank control group is maintained in a normal irrigation state of 75-80%.

After the seed germination period is finished, calculating a seed germination drought resistance index by counting the seed germination number, and further analyzing the seed germination conditions of different experimental groups in the drought stress environment.

The water content is divided into drought grade (mild 55-65%, moderate 40-55%, severe 30-40%) and normal irrigation 75-85%.

And (3) the seed germination drought resistance index is the seed germination index of the experimental group/the seed germination index of the blank control group.

Seed germination index ═ 1 x nd₂+0.75*nd₄+0.5*nd₆+0.25*nd₈

Where nd₂、nd₄、nd₆、nd₈The drought resistance index of the seeds in the germination period is a reliable index for evaluating the drought resistance of the seeds in the germination period.

TABLE 2 list of commercially available products

The results in table 3 show that, although the germination drought resistance index (1.15) of the wheat seeds subjected to seed soaking treatment by the chaetomium globosum MN110495 strain fermentation liquor is lower than that of the chemical fertilizer type commercial product 1(1.32) with fulvic acid as the main component in the super severe drought state, the germination drought resistance index is obviously superior to that of the similar microbial fertilizers commercial products 2 and 3 (the germination drought resistance indexes are 1.01 and 0.82 respectively), and is improved by 33.7 percent compared with that of the negative control group (0.86). Therefore, the chaetomium globosum MN110495 strain can effectively improve the germination speed of seeds under the drought condition, improve the drought resistance of the seeds and improve the survival rate of crops.

Table 3 comparison table of drought resistance conditions of each group of seeds in germination period.

Example 4 Effect of Chaetomium globosum MN110495 strain on wheat seedling drought resistance.

Transplanting the seedlings with the same growth vigor after the seeds germinate into seedling pots, wherein each seedling pot comprises three seedlings, and each group is provided with five repetitions. 10mL of hoagland nutrient solution is poured into the transplanted seedlings of the experimental group every other day, and 20mL of hoagland nutrient solution is poured into each pot plant of the experimental group on the 4 th day after transplantation, and then water cut-off treatment is started. And 10mL of hoagland nutrient solution is irrigated to the transplanted blank control group seedlings every day. And after 5 days of water cut-off, pouring 20mL of hoagland nutrient solution for rehydration, and counting the average plant height, the root surface area, the fresh weight, the dry weight and the plant drought grade of the plant the next day after rehydration. The results are shown in Table 4.

Evaluation standard of plant drought grade:

a grade 1-9 evaluation system is adopted, with grade 9 being the best and grade 1 being the worst.

Grade 9, plant is intact;

grade 8, the leaves begin to be soft but are not curled, and the color of individual areas of the leaves is lightened;

grade 7, the leaves are softened continuously, the leaf color is lightened continuously, and at least 1 leaf begins to curl;

grade 6, the leaves are softened continuously, the color is lightened, and most of the leaves begin to curl;

grade 5, all leaves start to become soft and curled, even the leaves droop;

grade 4, the lowest leaves begin to dry, the whole plant becomes bad, and the middle leaves are seriously curled;

grade 3, the two lowest leaves wither, and the other leaves begin to dry;

level 2, the middle leaves begin to dry;

grade 1, any more severe than grade 2, is classified as grade 1.

TABLE 4 growth of wheat seedlings in each group under drought conditions

Comparing the blank and negative control groups, it can be seen that the water cut-off treatment is not beneficial to the growth of wheat seedlings. After water supply is cut off, the growth indexes of the wheat seedlings of the negative control group in the experimental group are lower than those of the wheat seedlings of other experimental groups, and therefore the growth speed of the plant seedlings can be effectively increased by microbial fertilizers and chemical fertilizers. The wheat seedlings treated by the commercial product 2 have plant height, root surface area, fresh weight, dry weight and plant drought grade after rehydration which are all higher than those of the commercial product 1, and the chaetomium globosum MN110495 strain shows the treatment effect equivalent to that of the commercial product 1. It is shown that under drought conditions, microbial and chemical fertilizer products exhibit comparable or even better growth promoting effects.

In addition, the MN110495 treated group and the negative control group are independently compared, and the seedling height, the root surface area, the fresh weight and the dry weight of the MN110495 treated group are respectively improved by 12 percent, 15 percent, 14 percent and 11 percent compared with the negative control group in the super severe drought state. The drought grade of the MN110495 treated plant after rehydration is 6.73, which is improved by 15 percent compared with the drought grade of the negative control plant by 5.87 percent. As can be seen from FIG. 2, compared with the negative control group wheat plants, the MN110495 treatment group plants grow greenish, have less withered and yellow parts, and have thicker and longer root systems and more lateral roots. Therefore, the MN110495 treatment group has the functions of promoting the growth of plants and accelerating the revival of the plants in a drought environment state.

Example 5

This example further analyzes the drought-resistant effect of chaetomium globosum MN110495 strain in other crops.

PDB seed soaking is used as a control group, chaetomium globosum MN110495 strain fermentation liquor seed soaking is used as an experimental group, the seed soaking, sowing, seedling transplanting and drought resisting test methods described in the embodiments 3 and 4 are adopted to test the drought resisting effect of more varieties of existing plants in laboratories such as rice, corn, potato and the like, and finally the dry weight conditions of the seedlings of each plant in the next day of water cut-off treatment and rehydration are measured, so that the drought resisting effect of the chaetomium globosum MN110495 strain on the plants is verified.

The chaetomium globosum MN110495 strain acts on the roots of plants and can obviously enhance the growth speed of the roots. This example selects the dry weight of harvested material as the index of drought-resistant effect to illustrate the drought-resistant and growth-promoting effects of Chaetomium globosum MN110495 strain. As can be seen from Table 5, the chaetomium globosum MN110495 strain has broad spectrum in the aspect of improving the drought resistance of crops, can effectively improve the drought resistance of the crops, promotes the growth speed of plants in a drought environment, and obviously improves the dry weight of the plants.

TABLE 5 influence of Chaetomium globosum MN110495 strain on the drought resistance of the plants.

Example 6

This example analyzes the saline-alkali resistance of chaetomium globosum MN110495 strain on corn plants.

The corn seed sterilization, soil preparation and sowing steps were the same as in example 3.

The experimental group and the blank control group were set according to the treatment solutions. The experimental components are that MN110495 treatment group uses the strain fermentation liquor in the embodiment 2 to soak seeds, and a negative control group uses LB culture solution to soak seeds; the positive control group was inoculated with a commercial product (see Table 6), and the blank control group was also inoculated with LB medium. Measuring OD600, diluting the bacterial liquid concentration with LB until OD600 is 0.8-0.9, and soaking seeds for 5 h.

And (3) sowing the seeds after seed soaking into a seedling pot, wherein the seedling pot is filled with matrix soil fully mixed with 50mM saline-alkali Hoagland according to the weight ratio of 1: 1(v/m) (the matrix soil is sterilized for 60min at 121 ℃ in a vertical steam autoclave before being mixed), 3 seeds are sown in each seedling raising pot, and each group is repeated five times. The blank was treated with an equal amount of normal Hoagland soil. Placing the mixture in a greenhouse at 25 ℃ for 12h each day, and carrying out saline-alkali treatment. After sowing for 1-5 days, irrigating 20mL of 100mM saline-alkali Hoagland in every cup of the experimental group every other day; blank treatment 20mL of normal Hoagland was poured per cup. 30mL of 100mM haloglan hydrochloride is poured into the experimental group at 8-12 days; blank treatment 30mL of normal Hoagland was poured per cup. Pouring 40mL of 100mM haloglan hydrochloride into the experimental group of 15-22 days every other day; blank treatment 40mL of normal Hoagland was poured per cup. The soil salinity of the experimental group potted soil is in a heavily salinized state, and the blank control group is in a non-salinized state.

After the corn seeds are sowed for 23 days, corn plants are harvested to measure the average fresh weight, the surface area, the dry weight and the saline-alkali resistance grade of the plants, and index results are shown in table 7.

The salinity content distinguishes the soil salinization degree (saturated leachate 0-2 is non-salinization, 2-4 is salinization, 4-8 is medium salt, 8-16 is heavy saline soil, and >16 is extremely heavy saline soil).

The evaluation criteria for saline and alkaline resistance rating are as follows:

a1-5 grade evaluation system is adopted, with grade 5 being the best and grade 1 being the worst.

The leaves of the whole plant of the 5-grade plant are emerald green or the leaf tips of the plant are slightly withered and yellow

4-grade plant with large withered and yellow leaf area and withered heart leaves

The heart leaves of the 3-grade plants die and the whole leaves of the plants die, and the heart leaves are not unfolded yet and die

The 2-grade plant has severe withering and all leaves have withered and shriveled conditions

All leaves of 1-grade plants are completely withered

TABLE 6 list of commercially available products

Commercially available product	Numbering	Manufacturer of the product	Composition (I)
				Potassium fulvate	Commercially available product	SHANXI HUIYINONG BIOLOGICAL TECHNOLOGY Co.,Ltd.	Bacillus amyloliquefaciens, fulvic acid and the like

TABLE 7 Harvest index of target strains in saline-alkali tolerance experiment

Treatment of	Fresh weight	Root surface area	Salt and alkali resistant grade	Dry weight of
					Blank control group	6.1	59.10	5	0.4
Negative control	3.37	29.64	3.24	0.24
					Positive control	3.61	28.25	4.22	0.26
MN110495 processing group	3.74	36.44	3.59	0.25

Comparing the blank and negative control groups, it can be seen that the growth of maize seedlings is not favored in the heavily salinized environment. After the severe salinization treatment, the growth indexes of the corn seedlings of the negative control group in the experimental group are lower than those of the corn seedlings of other experimental groups, and the growth speed of the plant seedlings can be effectively increased by microbial fertilizer and chemical fertilizer.

In addition, when the MN110495 treated group and the negative control group are independently compared, the fresh weight, the root surface area, the saline-alkali resistance grade and the dry weight of the seedlings of the MN110495 treated group are respectively improved by 11 percent, 22.9 percent, 10.8 percent and 4.1 percent compared with those of the negative control group under the heavy salinization environment. Therefore, the MN110495 treatment group has the effect of promoting the growth of plants in a salinization environment state.

Example 7

This example performs an indoleacetic acid (IAA) production test on the strain.

Inoculating the strain (spore or hypha) into AGPS culture medium containing 0.1% L-tryptophan, placing in a constant temperature shaking incubator, and culturing at 30 deg.C and 200rpm for 2 d. 50 μ L of the strain fermentation liquid was dropped on a white ceramic plate, and 200 μ L of Salkowski colorimetric solution (1: 4) was added simultaneously, and 50mg/L of IAA and AGPS medium were used in place of the strain fermentation liquid as positive and negative controls. The white porcelain plate is placed at room temperature and is protected from light for 30min, and then the color development result is observed.

And if the chromogenic reaction result is obvious, performing further quantitative test, uniformly mixing the treatment solution (the strain fermentation supernatant, 50mg/L IAA and AGPS culture medium) with the Salkowski colorimetric solution 1:1, reacting for 30min at room temperature in a dark environment, and quickly measuring the light absorption value of the mixed solution at the wavelength of 530nm of a spectrophotometer. Calculating the content of the indoleacetic acid according to a standard curve. The standard curve is prepared by pure 3-indoleacetic acid, and the range of measuring the indoleacetic acid is 5-200 mu g/mL.

TABLE 8 Strain Indolylacetic acid (IAA) production test data

As shown in Table 8, the strain GDMCC 61363 produces IAA and acts on the surface area of the plant to promote the growth of the plant. The capability of the plants to absorb nutrients from soil is improved, and the survival rate of the plants is obviously improved under the drought stress condition.

Example 8

This example carried out EPS exopolysaccharide activity assay on the strains. 10 mu L of the bacterial liquid is dripped on a sterile filter paper sheet with the diameter of 5mm in an EPS-producing special culture medium and cultured for 2d at room temperature. Whether EPS is produced is judged according to the colony size around the filter paper and a transparent ring.

TABLE 9 Exopolysaccharide (EPS) Activity assay data (clear circles for secretion of the strains are indicated by "+")

Test number	Bacterial name	Diameter/cm of bacterial colony	Transparent secretion ring
				GDMCC
61363	Chaetomium globosum	3.27	+

From table 9, it is known that GDMCC 61363 can produce Extracellular Polysaccharide (EPS) to improve tolerance to drought stress, maintain soil and moisture stability, better adhere to plant roots, and increase available moisture of plant roots.

Example 9

In this example, the proline (Pro) content in the leaves of the plant was first determined.

Proline was assayed using a proline kit, and sample pretreatment and assay were performed according to the methods described in the kit instructions. The proline test box manufacturer establishes a bioengineering institute for Nanjing, and has the following goods number: a is 107-1-1, and,

TABLE 10 measurement data of proline (Pro) content in plant leaves

Proline (PRO) test kit

The blank tube is adjusted to zero by sterile water, the optical path is 1cm, and the wavelength is 520nm for color comparison.

Proline (PRO) test formula ═ ((assay OD value-blank OD value)/(standard OD value-blank OD value)). standard concentration 5 ug/ml/homogenate concentration (g tissue wet weight/ml). sample dilution factor before test.

In this example, the extraction and activity of antioxidants (SOD, CAT, POD) in plant leaves were further measured.

The SOD activity is measured by adopting a kit for measuring superoxide dismutase by a hydroxylamine method, and sample pretreatment and measurement are carried out according to the method for measuring SOD in plant tissues in the instruction of a test kit.

CAT (EC 1.11.1.6) Activity measurement Using a catalase measurement kit by visible light method, sample pretreatment and measurement were performed according to the method for tissue sample detection described in the kit.

POD (EC 1.11.1.7) activity was measured using a peroxidase test kit, and sample pretreatment and measurement were carried out according to the method described in the specification of the test kit.

TABLE 11 determination of superoxide dismutase (SOD) content in plant leaves

TABLE 12 determination of Catalase (CAT) content in plant leaves

TABLE 13 determination of Peroxidase (POD) content in plant leaves

From tables 10 to 13, it was found that the GDMCC 61363 secretes a large amount of enzyme system and antioxidant substance capable of scavenging active oxygen and proline against stress when applied to plants.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Muen (Guangzhou) Biotechnology Ltd

<120> chaetomium globosum, microbial inoculum, seed soaking liquid and application

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 539

<212> DNA

<213> Artificial sequence

<400> 1

acattacaga gttgcaaaac tccctaaacc attgtgaacg ttacctatac cgttgcttcg 60

gcgggcggcc ccggggttta ccccccgggc gcccctgggc cccaccgcgg gcgcccgccg 120

gaggtcacca aactcttgat aatttatggc ctctctgagt cttctgtact gaataagtca 180

aaactttcaa caacggatct cttggttctg gcatcgatga agaacgcagc gaaatgcgat 240

aagtaatgtg aattgcagaa ttcagtgaat catcgaatct ttgaacgcac attgcgcccg 300

ccagcattct ggcgggcatg cctgttcgag cgtcatttca accatcaagc ccccgggctt 360

gtgttgggga cctgcggctg ccgcaggccc tgaaaagcag tggcgggctc gctgtcgcac 420

cgagcgtagt agcatacatc tcgctctggt cgcgccgcgg gttccggccg ttaaaccacc 480

ttttaaccca aggttgacct cggatcaggt aggaagaccc gctgaactta agcatatca 539

<210> 2

<211> 668

<212> DNA

<213> Artificial sequence

<400> 2

cgggcggaag agctggccga aggggccggc acggacggca tccatggtgc cgggctccaa 60

gtcgacgagg acagcgcgag gaacatactt gttgccggaa gcctgtataa tactatgagc 120

acgccatcac tcggtcgtgt aaaattattt gacccgactg acctcgttga agtacacgtt 180

catacgctcg agctggagct cggaggtgcc gttgtaccta tcgaagcggt gagcggggat 240

ttatcggttg ggaactgtca tgcccacata cacgccattg ctgtcgaggc cgtgctcgcc 300

agagatggtc tgcctgaaaa gaagtcagtc tcgattgtca tcagccaaga gtgtttgctt 360

tgcttggacg taccagaaag cggcaccgat ttggttaccc tagagagctc catgtcagtt 420

atcctgcgcg gccggtcggt cgtaatgttc gattcggtcc aacttacgca ctggccggtc 480

tggaggtgaa cctatagtac gaaaaagcag tcagcatcat caagcttcgc atcatcgtcg 540

tgttgctatc cgtcaggagc tgtggaaatg agggtcgtcc cgatgggtgg ggtagttcag 600

gggcccaaaa aaaaagctcc cagacgcgtc gtcgccgtgc ggctcaggaa tgtgcggggt 660

gacttaca 668

Claims

1. Application of fungal strain of Chaetomium globosum (Chaetomium globosum) species in preparation of seed soaking liquid, seed soaking powder or microbial agent is provided.

2. The use according to claim 1, wherein the chaetomium globosum is deposited at the Guangdong province culture Collection with the following addresses: the preservation date of the No. 59 building 5 of the No. 100 college of the Pieli Zhonglu city, Guangdong province microbial research institute: 12/10/2020, accession number GDMCC No: 61363 under the taxonomic name Chaetomium globosum.

3. Application of fungal strain of Chaetomium globosum (Chaetomium globosum) species in preparation of crop growth regulator or seed germination regulator is provided.

4. The use according to claim 3, wherein the crop growth regulator is suitable for the growth regulation of economic and food crops in saline-alkali soil, arid soil or fertile soil; the seed germination regulator is suitable for germination of seeds of economic crops and grain crops;

preferably, the commercial crop is selected from at least one of the following commercial crops: solanaceae, Rosaceae, Rutaceae, Musaceae, Cucurbitaceae, Papilionaceae, Compositae, Liliaceae, Zingiberaceae, Passifloraceae, Anacardiaceae, Araliaceae and Cactaceae; the grain crop is selected from gramineous crops;

5. The chaetomium globosum is characterized by being preserved in the Guangdong province microorganism strain preservation center at the preservation address: the preservation date of the No. 59 building 5 of the No. 100 college of the Pieli Zhonglu city, Guangdong province microbial research institute: 12/10/2020, accession number GDMCC No: 61363 under the taxonomic name Chaetomium globosum.

6. The chaetomium globosum according to claim 5, characterized in that the colony culture of chaetomium globosum is characterized by: the hypha on the fungus culture medium is white at first, is light brown at later stage, and the ascocarp shell is gray brown to olive brown, medium-sized, scattered or aggregated, and oval;

preferably, the fungus culture medium is a PDA culture medium, an SDAY culture medium, a liquid Sabouraud culture medium, a modified martin culture medium, a malt extract, corn meal agar, a high-salinity Chaudhuri culture medium or a Bengal culture medium;

preferably, the optimal growth temperature of the chaetomium globosum is 25-30 ℃.

7. A seed soaking liquid or powder comprising chaetomium globosum according to claim 5 or 6.

8. The seed soaking liquid or seed soaking powder as claimed in claim 7, wherein the chaetomium globosum is an effective component of the seed soaking liquid or seed soaking powder;

preferably, the effective amount of chaetomium globosum in the seed soaking liquid is 10⁴cfu/mL～10⁹cfu/mL；

Preferably, the effective amount of chaetomium globosum in the seed soaking liquid is 10⁶cfu/mL；

Preferably, the seed soaking liquid or seed soaking powder is suitable for seed soaking of crops;

preferably, the crop comprises at least one of a cash crop and a food crop;

preferably, the solanaceae is selected from at least one solanaceae crop of: potatoes, peppers and tomatoes; the Rosaceae is selected from at least one of the following Rosaceae crops: strawberry and papaya; the Rutaceae is selected from Rutaceae crops as follows: citrus; the Musaceae family is selected from the following Musaceae family crops: bananas; the Cucurbitaceae is selected from cucumber; the Papilionaceae family is selected from soybean, the Compositae family is selected from lettuce, the Liliaceae family is selected from garlic, the Zingiberaceae family is selected from ginger, the Passiflorae family is selected from passion fruit, the Anacardiaceae family is selected from golden pineapple, the Araliaceae family is selected from pseudo-ginseng, and the Cactaceae family is selected from dragon fruit.

9. A microbial preparation comprising chaetomium globosum according to any one of claims 5 to 6; preferably, the microbial inoculum takes the chaetomium globosum as a main effective component.

10. A fertilizer or a pesticide, characterized in that it comprises chaetomium globosum according to any one of claims 5 to 6 or a microbial agent according to claim 9;

preferably, the fertilizer or pesticide is applied to the foliage or roots of the crop.