CN113234143A

CN113234143A - Nucleic acid antibody kit for rapidly detecting virus

Info

Publication number: CN113234143A
Application number: CN202110502996.6A
Authority: CN
Inventors: 马红妙; 张玲
Original assignee: Beijing Baotu Biotechnology Co ltd
Current assignee: HEFEI JINYU MEDICAL EXAMINATION LABORATORY Co.,Ltd.
Priority date: 2021-05-10
Filing date: 2021-05-10
Publication date: 2021-08-10
Anticipated expiration: 2041-05-10
Also published as: CN113234143B

Abstract

The invention discloses a nucleic acid antibody kit for rapidly detecting viruses. The invention obtains HBsAg monoclonal antibody by screening, prepares HBV fluorescent quantum dot rapid detection test paper by using the monoclonal antibody to mark quantum dots and nitrocellulose membrane marked by other antibodies, analyzes aiming at HBV-DNA sequence, selects a conserved region to design an RPA primer and a probe, and prepares the RPA primer and the probe into corresponding detection test paper; the two detection methods are combined for use, so that the detection accuracy can be further improved, and the virus replication state is reflected by the DNA content, so that the early diagnosis is realized, the patient can be treated as soon as possible, and the method is suitable for large-scale popularization and use.

Description

Nucleic acid antibody kit for rapidly detecting virus

Technical Field

The invention relates to the field of virus diagnosis, and more particularly relates to a nucleic acid antibody kit for rapidly detecting viruses.

Background

Hepatitis B is a disease mainly manifested by damage of liver cells due to infection of Hepatitis B Virus (HBV), and has the characteristics of high cure difficulty, infectivity, easy recurrence and the like, and about 100 million people die of liver failure, cirrhosis and primary hepatocellular carcinoma due to HBV infection every year.

HBV belongs to hepadnaviruses, complete HBV is a double-layer capsid particle called Dane particle, the outer layer is a lipoprotein envelope, and the inside of the envelope is a viral capsid or called core particle, wherein the envelope consists of HBsAg; the nucleocapsid consists of hepatitis b core antigen (HBcAg), which contains the viral genome and polymerase.

At present, the main detection methods for detecting HBV comprise etiology detection and serology detection. Wherein the pathogenic detection mainly comprises nucleic acid detection (RT-qPCR, LAMP), and the serological detection comprises the following steps: five markers such as HBs Ag, anti-HBS, HBe Ag, anti-HBe and anti-HBc. The pathogeny detection accuracy is high, the detection time is short, but the equipment is expensive, and false positive is easy to appear; under the condition of drug or virus variation, the five indexes of hepatitis B are restricted in detection, so that the condition of hepatitis B virus cannot be detected early and accurately, the detection rate is influenced, and early treatment of patients is not facilitated.

Disclosure of Invention

In order to better avoid the defects and provide an early and accurate diagnosis result for a patient, the detection kit is simple to prepare, low in cost, convenient to use, free of a high-precision instrument and more accurate and efficient. The kit detects the hepatitis B virus by a nucleic acid-antibody double detection method, can more effectively detect the hepatitis B virus and the replication state thereof, thereby diagnosing as early as possible and being beneficial to the treatment of patients as soon as possible.

The invention provides the following technical scheme:

the invention provides a monoclonal antibody 7E5 specifically binding to HBV surface antigen (HBsAg), which comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises a CDR1 region, a CDR2 region and a CDR3 region, and the amino acid sequences of the heavy chain CDR1 region, the CDR2 region and the CDR3 region are respectively shown as SEQ ID NO 1, 2 and 3; the light chain variable region comprises a CDR1 region, a CDR2 region and a CDR3 region, wherein the amino acid sequences of the light chain CDR1 region, the CDR2 region and the CDR3 region are shown in

SEQ ID NO

4, 5 and 6, respectively.

In another aspect, the invention provides a monoclonal antibody 7E5 that specifically binds to HBsAg, comprising a heavy chain variable region comprising the amino acid sequence SEQ ID No. 7 and a light chain variable region comprising the amino acid sequence SEQ ID No. 8.

In some embodiments, the anti-HBsAg antibodies according to the invention comprise or consist of two heavy chains and two light chains, wherein each heavy chain comprises a heavy chain constant region sequence, a heavy chain variable region sequence, or a CDR sequence as described above, and each light chain comprises a light chain constant region sequence, a light chain variable region sequence, or a CDR sequence as described above. The antibody of the invention may be a full length antibody comprising a constant region, the full length antibody light chain constant region further comprising murine kappa, lambda chain sequences. The full-length antibody heavy chain constant region further comprises murine IgG1, IgG2a, IgG2b, IgG3, IgA or IgM sequences.

In some embodiments, the anti-HBsAg antibody of the present invention is an Fab fragment, Fab 'fragment, F (ab')2 fragment, Fv fragment, diabody, linear antibody, single chain antibody molecule, or multispecific antibody formed from the anti-HBsAg antibody or antibody fragment described above.

The invention also provides a hepatitis B virus fluorescent quantum dot rapid detection test paper, which is prepared by labeling the 7E5 monoclonal antibody with quantum dots.

The invention provides another test strip RPA (LFD RPA) detection kit for rapidly detecting hepatitis B virus, which comprises a lateral flow chromatography test strip (hybrid 2T, Milenia Biotec GmbH, Germany), a pair of primers and a probe, wherein the sequence of the upstream primer is shown as SEQ ID NO. 9, the sequence of the downstream primer is shown as SEQ ID NO. 10, and the sequence of the probe is shown as SEQ ID NO. 11.

Specifically, the upstream primer (SEQ ID NO: 9):

CTGGACTATCAAGGTATGTTGCCCGTTTGTC

downstream primer (SEQ ID NO: 10):

Biotin-CTGAGGCCCACTCCCATAGGAATTTTCCG

probe sequence (SEQ ID NO: 11):

FAM-CCTGCATGACTACTGCTCAAGGAACCTCTATGTATCCCTCCTGTTGC,

in some embodiments, the probes of the invention are modified with a dSpacer at a position 34bp from the middle to the 5' end, thymine (dT) at positions 33bp and 35bp from the 5' end on both sides of the dSpacer molecule are replaced with a fluorophore FAM and a quencher BHQ1, respectively, and are modified at the 3' end of the probe with a blocking group C3 Spacer.

In some embodiments, the fluorescent group can be replaced by TAMARA and the quencher group can be replaced by BHQ 2; the dealkalized site can be replaced by tetrahydrofuran; the C3Spacer modification at the 3' end of the probe can be replaced by phosphorylation design or connection of biotin-TEG.

The test strip is provided with a detection line, and a molecule A is fixed on the detection line;

the primer with the sequence as shown in SEQ ID No. 10 has molecule B combined specifically to the molecule A. The molecule A is a biotin ligand and the molecule B is biotin.

In the test strip RPA detection kit of the present invention, preferably, the kit further includes a hydrolysis buffer solution, magnesium acetate and ddH₂O。

In the test strip method provided by the invention, two thymine nucleotides at the middle position of an RPA probe are respectively marked with a fluorescent group and a fluorescence quenching group, an abasic site (dSpacer) is designed between the two thymine nucleotides, and the abasic site can be identified and cut by exonuclease III with 3'-5' exonuclease activity to free the fluorescent group, so that a fluorescent signal is emitted and then is detected by a fluorescence detector; meanwhile, the extensible 3' -OH is left, the DNA polymerase continues to extend and synthesize DNA by taking the probe as a ' forward primer ', and an amplification product with a double label (a fluorescent group label and an affinity label) is amplified together with a reverse primer (with an affinity label, such as biotin); the product is chromatographed on lateral flow test paper, and when encountering a test paper region (usually a line, i.e., "detection line", with streptavidin) that recognizes the affinity label, it is enriched, exhibiting a linear fluorescent signal. The test strip method does not depend on a fluorescent quantitative PCR instrument, so the cost and the application range are wider.

The invention further provides a method for detecting hepatitis B virus, which comprises the steps of amplifying a sample by using the primer and the probe, and detecting an amplification product by using a nucleic acid detection test strip. And (4) detecting a result: and (3) combining with a test strip for color development, sucking 5-25 mu L of the amplification product, diluting the sucking product by 10-50 times with 1xPBST buffer solution, and detecting with the test strip marked correspondingly. And (4) interpretation of results: the positive (+) of the T line and the C line occurs at the same time, the negative (-) of the C line occurs only, and the effectiveness of the test strip needs to be considered when the T line occurs only.

In some embodiments, the invention provides a nucleic acid-antibody dual kit for detecting hepatitis b virus, which comprises an RPA kit for specifically detecting HBsAg nucleic acid and a test strip for specifically detecting HBsAg comprising a monoclonal antibody; the RPA kit contains primers of SEQ ID NO 9 and 10 and a probe of SEQ ID NO 11; the test strip of the monoclonal antibody is a fluorescent quantum dot rapid detection test strip prepared by labeling quantum dots with an anti-HBsAg monoclonal antibody 7E 5; wherein the anti-HBsAg monoclonal antibody 7E5 comprises a heavy chain variable region comprising CDR1 shown in SEQ ID NO. 1, CDR2 shown in SEQ ID NO. 2 and CDR3 shown in SEQ ID NO. 3, and a light chain variable region comprising CDR1 shown in SEQ ID NO. 4, CDR2 shown in SEQ ID NO. 5 and CDR3 shown in SEQ ID NO. 6.

In some embodiments, the invention provides a nucleic acid-antibody dual kit for detecting hepatitis b virus, which comprises an RPA kit for specifically detecting HBsAg nucleic acid and a test strip for specifically detecting HBsAg comprising a monoclonal antibody; the RPA kit contains primers of SEQ ID NO 9 and 10 and a probe of SEQ ID NO 11; the test strip of the monoclonal antibody is a fluorescent quantum dot rapid detection test strip prepared by labeling quantum dots with an anti-HBsAg monoclonal antibody 7E 5; wherein, the heavy chain variable region sequence of the anti-HBsAg monoclonal antibody 7E5 is shown as SEQ ID NO. 7, and the light chain variable region sequence is shown as SEQ ID NO. 8.

The kit is used for determining whether HBV surface antigen, HBV DNA and the content thereof exist in a biological sample from a subject in vitro.

In some embodiments, the biological sample of the invention is blood, plasma, serum, urine, or saliva.

Advantageous effects

The invention analyzes the DNA sequence of HBV to obtain the specific RPA primer and probe aiming at HBV-DNA, and prepares the HBV-DNA detection reagent; the test paper is used for diagnosing hepatitis B virus patients, can further improve the detection accuracy, and simultaneously reflects the virus replication state through the DNA content, so that the test paper can be diagnosed as soon as possible, is beneficial to treating patients as soon as possible, and is suitable for large-scale popularization and use.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention.

FIG. 1 mouse antibody subtype identification results

FIG. 2 is a graph showing the results of sensitivity evaluation of the RPA detection method

Detailed Description

The preferred embodiments of the present invention will be described in conjunction with the accompanying drawings, and it will be understood that they are described herein for the purpose of illustration and explanation and not limitation.

Example 1 preparation of anti-HBsAg antibody

Diluting the HBV surface antigen protein to 1mg/ml, mixing and emulsifying 50 mu l of antigen solution, 50 mu l of 0.01M PBS and 150 mu l of Freund's complete adjuvant for the first immunization, and carrying out subcutaneous multipoint immunization on male BALB/c mice of 6-8 weeks old. After the primary immunization, every two weeks, 25. mu.l of the antigen solution, 75. mu.l of 0.01M PBS and 100. mu.l of Freund's incomplete adjuvant were mixed and subjected to 5 additional immunizations. The spleen was harvested on the fourth day after the last immunization and cell fusion was performed. Taking immunized Balb/c mouse spleen cells, fusing the immunized Balb/c mouse spleen cells with a myeloma Sp2/0 cell line by using a PEG method, re-suspending the fused cells by using a 20% FBS-HAT-DMEM culture medium, then uniformly paving the cells in a 96-well plate at 37 ℃ and 5% CO₂And (5) culturing. After the fused cells are cultured for about one week, carrying out half-amount liquid change by using a 10% FBS-HT-DMEM culture medium, when the area of the cell colony covering the bottom of a hole reaches 1/3-1/2, taking culture supernatant, and carrying out indirect ELISA (enzyme-linked immunosorbent assay) methodDetection of positive clones was performed. Wells with higher OD450nm values and fewer colonies were selected and cloned by limiting dilution. Screening was also performed by ELISA method, and finally a positive hybridoma cell line was obtained and named 7E 5. After expansion culture, the hybridoma cells were cryopreserved.

EXAMPLE 2 purification of monoclonal antibodies

BALB/c mice were injected intraperitoneally with 0.5 ml/mouse, 1 week before hybridoma inoculation. After 1 week, each mouse was inoculated intraperitoneally at about 1X10⁶(ii) individual hybridoma cells; and after 7-10 days, collecting ascites. Centrifuging ascites at 10000 Xg for 30min, removing precipitate, salting out with 50% ammonium sulfate, coarse extracting, dissolving with PBS, and dialyzing with flowing water for 5 hr; dialyzing and equilibrating with 0.1mol/L phosphate buffer (pH8.0) overnight; and (3) loading, eluting the hybrid protein by using 0.1mol/L phosphate buffer solution (pH8.0), eluting by using citrate eluents with different pH values, collecting elution peaks in sections, and concentrating to obtain the purified anti-HBsAg antibody 7E 5.

Example 3 anti-HBsAg antibody subtype identification

The positive mouse monoclonal cell line selected by indirect ELISA was subjected to subclass measurement using a subclass measuring reagent (Sigma). The microplate provided in the kit was already pre-coated with specific antibodies against mouse IgG1, IgG2a, IgG2b, IgG3, IgA, IgM, kappa light chain, lambda light chain, and the anti-HBsAg antibody 7E5 sample purified in example 2 was added to the sample wells at 50 μ l per well without incubation. Adding 1X goat anti-mouse IgA + IgM + IgG-HRP into sample wells, mixing the sample wells with 50 μ l each, and incubating for 1 h. And (4) deducting liquid in the holes, adding 1XPBST to wash the holes for 3 times, and absorbing the excessive moisture by absorbent paper. Adding color development solution, and developing 100 μ l per well in dark at room temperature for 15 min. The color reaction was stopped by adding 100. mu.l of stop solution. As shown in FIG. 1, the monoclonal antibody of the present invention is IgG2b subtype.

Example 4 monoclonal antibody sequencing

Removing 7E5 hybridoma cell freezing tube from liquid nitrogen, rapidly thawing at 37 deg.C, centrifuging at 1000rpm for 5min to remove freezing medium, placing in 100mm well plate, culturing to 80% of the culture plate, adding 1ml Trizol reagent (Thermo Co.), and making into desired dosage formTotal RNA from hybridoma cells was extracted. Mu.g of the above total RNA was taken, DECP water was added thereto to make the volume 11. mu.l, 1.0. mu.l of oligo (dT) (10. mu.M) was added thereto, 1. mu.l of dNTPs (10mM) was added thereto, the mixture was mixed well, incubated at 65 ℃ for 5 minutes and then placed on ice for 1 minute, followed by addition of 4. mu.l of RT buffer (5X), 1.0. mu.l of DTT (100mM), 1. mu.l of Ribonucleae Inhibitor and 1. mu.l of reverse transcriptase (takara Co., Ltd.), and reacted at 50 ℃ for 10 minutes. The reaction was terminated by incubation at 80 ℃ for 10 minutes, and the obtained cDNA was stored at-20 ℃. Designing specific nested PCR primer, the primer sequence used in the amplification reaction is complementary with the first frame region and the constant region of the antibody variable region, and amplifying the target gene by adopting a conventional PCR method. Wherein the primer sequence is designed according to the literature (Bodo Brocks. Specifes-Cross reactive scFv Against the Tumor promoter Marker "fibrous Activation Protein" Selected by phase Display From an immobilized FAP-^/-Knock-Out Mouse).

Sequencing results show that the amino acid sequences of the heavy chain and light chain variable regions of the anti-HBsAg antibody 7E5 are respectively shown in SEQ ID NO:7 and SEQ ID NO:8 is shown in the specification; the amino acid sequences of 3 CDRs in the heavy chain variable region of the antibody are respectively shown as SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3; the amino acid sequences of 3 CDRs in the light chain variable region are shown in SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, respectively.

Example 5 affinity assay for anti-HBsAg antibodies

An antibody capture Antibody (AHC) is coated on the surface of a CM5 chip by means of amino coupling, chip activation buffer solution N-ethyl-N' - (3-dimethylaminopropyl) -carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS), AHC and ethanolamine for blocking are prepared according to the specifications of an amino coupling kit and an anti-capture kit, a coating program in a Biacore3000 system is selected, and AHC amino is coupled on the surface of a CM5 chip. The anti-HBsAg antibody 7E5 obtained in example 2 was captured on the chip surface. The antibody was diluted to 1. mu.g/mL with HBS-EP + buffer, set at a flow rate of 10. mu.l/min, and coated to a response value of 100 RU. HBsAg antigen was set in 7 different concentration gradients, and was serially diluted in HBS-EP buffer in 2-fold gradients from 40nM to 0 nM. The flow rate of HBsAg antigen was set at 30. mu.l/min and the binding time was set at 3 min. Setting HBSThe flow rate of EP + buffer was 30. mu.l/min and the dissociation time was 10 min. Use of 3M MgCl₂As a regeneration buffer, the chip was regenerated according to the regeneration procedure. Calculation of binding Rate (K) by Simultaneous fitting of binding and dissociation sensorgrams_a) And dissociation Rate (K)_d). Equilibrium dissociation constant (K)_d) Using dissociation rate (K)_d) Rate of binding (K)_a) And (4) calculating. The results are shown in table 1: the antibody of the invention has high affinity, and the affinity K_DValue up to 2.15x10-⁸M。

TABLE 1

Antibodies	K_a(1/Ms)	K_d(1/s)	K_D(M)
				7E5	2.07x10⁴	4.45x10^-4	2.15x10^-8

Example 6 preparation of anti-HBsAg polyclonal antibody

HBsAg antigen was collected and immunized with 1mg protein per rabbit. 1mg of protein is dissolved in 500 mul of sterile PBS, then an adjuvant with the same volume is added, the mixture is evenly mixed on a vortex oscillator for 1h, and then the mixture is evenly blown and sucked by an injector and then is injected subcutaneously at multiple points. After 14 days the experiment was repeated and after several immunizations, the antiserum titer was determined by taking the auricular peripheral venous blood. When the titer of the antiserum reaches the fusion standard, performing one-time boosting immunization, selecting a one-time total blood collection method, aseptically discharging blood from carotid artery, separating serum, adding a proper amount of preservative, subpackaging in small bottles, and storing in a low-temperature refrigerator. Precipitating with 50% ammonium sulfate once and 33% ammonium sulfate twice, and purifying rabbit serum by DEAE chromatography to obtain IgG. The purified IgG titer was measured by indirect ELISA to obtain an anti-HBsAg polyclonal antibody.

Example 7 preparation and verification of hepatitis B virus fluorescent quantum dot rapid detection test paper

The 7E5 monoclonal antibody purified in example 2 is labeled with quantum dots, and the anti-HBsAg polyclonal antibody purified in example 2 is coated on a nitrocellulose membrane for detection. After the test paper is prepared into the rapid test paper, the cross reaction test is carried out on the test paper. Diluting a hepatitis B vaccine stock solution, a hepatitis A inactivated vaccine stock solution, a Coxsackie A16(CA16) inactivated vaccine stock solution and an enterovirus 71 (EV71) inactivated vaccine stock solution, detecting by using the hepatitis B virus fluorescent quantum dot rapid detection test paper, and observing whether cross reaction exists. (+) represents positive result, and (-) represents negative result. The detection result shows that the rapid test paper for the hepatitis B virus fluorescent quantum dots has no cross reaction with the detected sample and has good specificity.

TABLE 2

Example 8 design of RPA-specific detection primers

The gene sequences of common strains of hepatitis B virus are compared, a specific conserved region is selected, and an RPA primer group for detecting the hepatitis B virus is designed, wherein the sequences of the RPA primer group are as follows:

upstream primer (SEQ ID NO: 9):

CTGGACTATCAAGGTATGTTGCCCGTTTGTC

downstream primer (SEQ ID NO: 10):

Biotin-CTGAGGCCCACTCCCATAGGAATTTTCCG

probe sequence (SEQ ID NO: 11):

FAM-CCTGCATGACTACTGCTCAAGGAACCTCTATGTATCCCTCCTGTTGC, the probe is modified by dSpacer at the position 34bp away from the 5' end in the middle, thymine (dT) at the positions 33bp and 35bp away from the 5' end on both sides of dSpacer molecule are respectively replaced by a fluorescent group FAM and a quenching group BHQ1, and the 3' end of the probe is modified by a blocking group C3 Spacer.

Example 9 detection of sensitivity of RPA reaction

Performing an RPA test by using hepatitis B virus DNA as a template, performing RPA amplification by using a screened primer, setting ultrapure water as a negative control, controlling the reaction temperature to be 38 ℃ and the reaction time to be 20min, wherein the RPA reaction system is 50 mul, 2 mul of forward and reverse primers (10 mul), 2 mul of reverse primers (10 mul), 0.6 mul of probe, 25 mul of buffer solution containing recombinase, DNA polymerase, single-strand binding protein and endonuclease IV, 1 mul of template and 17.9 mul of lddH2O, fully oscillating, uniformly mixing and instantaneously separating, finally adding 2.5 mul of 280mM magnesium acetate, and placing a reaction tube in a real-time fluorescence PCR instrument for constant temperature reaction for a corresponding time at 38 ℃; the results are shown in FIG. 2. As shown in FIG. 2, when the template concentration is 1ng, 100pg and 10pg, a significant amplification curve and a target band are present, but when the template concentration is less than 1pg, no significant amplification curve and a target band are present, i.e., the detection of RPA is at least 10pg, and the detection precision is better.

Example 10 preparation and detection of hepatitis B Virus RPA test strip

The RPA kit for hepatitis B virus comprises the primers and probes designed in example 8, a positive control plasmid (SEQ ID NO:12), a hydrolysis buffer solution, an enzyme mixture, magnesium acetate (280mM), nuclease-free pure water and a lateral chromatography test strip, wherein the test strip is provided with a detection line, and molecular streptavidin is fixed on the detection line and can be specifically combined with biotin at the tail end of the primer SEQ ID NO: 10.

The test strip is used for respectively detecting DNA, positive control plasmid and negative control ddH of a sample to be detected₂And O. The RPA reaction system was 50. mu.l, 2. mu.l of forward primer (10. mu.M), 2. mu.l of reverse primer (10. mu.M), 0.6. mu.ll probe, 25. mu.l containing recombinase, DNA polymerase, single-strand binding protein, endonuclease IV, 1. mu.l sample and 17.9. mu.lddH 2O, mixed well with vigorous shaking and flash-separated, and finally 2.5. mu.l of 280mM magnesium acetate was added. The reaction was carried out in a water bath at 38 ℃ for 20 min. The results show that the sample containing hepatitis B virus DNA and the positive control sample both have a positive (+) line and a negative (-) line, and the test strip kit can effectively detect HBV, and the results are shown in the following table 3.

TABLE 3

Example 11 actual sample detection

200 patients with hepatitis B confirmed by clinical symptoms and experimental examination and 200 healthy patients are taken for detection, and the samples are provided by Tianjin hospital. The serum of the patient is taken and detected by adopting fluorescent quantum dot rapid detection test paper and test paper strip RPA respectively, and the detection result is shown in Table 4. As can be seen from the results in Table 4, the antibody fluorescent quantum dot test strip and the RPA test strip can better detect hepatitis B virus, but some hepatitis B patients still have negative HBsAg antigens due to virus variation or other factors. The HBsAg antigen detection and the hepatitis B DNA detection are combined, so that good supplement can be realized, and the accuracy of the detection result is enhanced.

TABLE 4

Sequence listing

<110> Beijing Bao Picture Biotechnology Ltd

<120> nucleic acid antibody kit for rapidly detecting virus

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Ala Arg Gly Tyr Asn

1 5

<210> 2

<211> 17

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Gly Ile Asn Cys Arg Pro Thr Ala Met Ser Pro Glu Asp Leu Val Lys

1 5 10 15

Asp

<210> 3

<211> 10

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Arg Glu Cys Pro Ile Asn Gln Gly Asp Tyr

1 5 10

<210> 4

<211> 12

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Gly Cys Ala Arg Asn Thr Ile Trp Asn Asn Val Gly

1 5 10

<210> 5

<211> 7

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Trp Ala Ser Leu Phe Gly Lys

1 5

<210> 6

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Gln Asp Ile Gln Glu Asn Trp Thr Pro

1 5

<210> 7

<211> 119

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ala Arg

20 25 30

Gly Tyr Asn Trp Val Arg Gln Ser His Gly Lys Ser Leu Glu Trp Ile

35 40 45

Gly Gly Ile Asn Cys Arg Pro Thr Ala Met Ser Pro Glu Asp Leu Val

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn Thr Val Tyr

65 70 75 80

Met Glu Phe Arg Ser Leu Thr Leu Glu Asp Ser Ala Ile Tyr Phe Cys

85 90 95

Ala Arg Arg Glu Cys Pro Ile Asn Gln Gly Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Ile Phe Thr Val Ser Ser

115

<210> 8

<211> 108

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Glu Ile Val Leu Thr Gln Ser Pro Ala Leu Met Ala Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Ile Thr Cys Gly Cys Ala Arg Asn Thr Ile Trp Asn

20 25 30

Asn Val Gly Trp Tyr Gln Gln Lys Ser Glu Thr Ser Pro Lys Pro Trp

35 40 45

Ile Tyr Trp Ala Ser Leu Phe Gly Lys Gly Val Pro Val Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu

65 70 75 80

Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp Ile Gln Glu Asn Trp

85 90 95

Thr Pro Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

100 105

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctggactatc aaggtatgtt gcccgtttgt c 31

<210> 10

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctgaggccca ctcccatagg aattttccg 29

<210> 11

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cctgcatgac tactgctcaa ggaacctcta tgtatccctc ctgttgc 47

<210> 12

<211> 211

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctggactatc aaggtatgtt gcccgtttgt cctctaattc caggatcctc aacaaccagc 60

acgggaccat gccggacctg catgactact gctcaaggaa cctctatgta tccctcctgt 120

tgctgtacca aaccttcgga cggaaattgc acctgtattc ccatcccatc atcctgggct 180

ttcggaaaat tcctatggga gtgggcctca g 211

Claims

1. An antibody specifically binding to HBsAg, wherein the anti-HBsAg monoclonal antibody comprises a heavy chain variable region comprising CDR1 shown in SEQ ID NO. 1, CDR2 shown in SEQ ID NO. 2 and CDR3 shown in SEQ ID NO. 3, and a light chain variable region comprising CDR1 shown in SEQ ID NO. 4, CDR2 shown in SEQ ID NO. 5 and CDR3 shown in SEQ ID NO. 6.

2. An antibody specifically binding to HBsAg, characterized in that the anti-HBsAg monoclonal antibody comprises a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO. 7 and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO. 8.

3. A kit for detecting HBV, characterized in that the kit comprises a fluorescent quantum dot rapid detection test strip prepared from the monoclonal antibody-labeled quantum dot of claim 1 or 2.

4. A test strip RPA detection kit for rapidly detecting HBV comprises a pair of primers and a probe, wherein the sequences of the pair of primers are shown as SEQ ID NO. 9 and 10, and the sequence of the probe is shown as SEQ ID NO. 11.

5. The test strip RPA detection kit of claim 4, wherein said kit further comprises a hydrolysis buffer, magnesium acetate and ddH₂O。

6. The test strip RPA detection kit of claim 4 or 5, wherein the RPA amplification reaction is performed in a water bath at a temperature of 38 ℃ for 20 min.

7. Use of the test strip RPA detection kit of any one of claims 4 or 5 in the preparation of a reagent for detecting HBV.

8. A kit for detecting HBV through nucleic acid-antibody dual, wherein the kit comprises an antibody detection kit of claim 3 and a test strip RPA detection kit of any one of claims 4 to 7.