CN113186284B

CN113186284B - Nucleic acid-antibody dual cancer detection kit

Info

Publication number: CN113186284B
Application number: CN202110487543.0A
Authority: CN
Inventors: 马红妙; 张玲
Original assignee: Zhejiang Orient Gene Biotech Co Ltd
Current assignee: Zhejiang Orient Gene Biotech Co Ltd
Priority date: 2021-05-06
Filing date: 2021-05-06
Publication date: 2022-01-07
Anticipated expiration: 2041-05-06
Also published as: CN113186284A

Abstract

The invention relates to a nucleic acid-antibody dual cancer detection kit. The invention obtains the specific RPA primer and probe aiming at CXCL1 detection by analyzing the CXCL1 gene sequence; meanwhile, monoclonal antibodies with good effects are screened and obtained aiming at the CXCL1 protein, and the monoclonal antibodies are used for preparing an immunodetection kit. The two detection methods are combined for use, so that the detection accuracy can be further improved, the cost is low, and the method is suitable for large-scale popularization and use.

Description

Nucleic acid-antibody dual cancer detection kit

Technical Field

The invention relates to the field of biological medicine, in particular to a nucleic acid-antibody dual cancer detection kit.

Background

Bladder cancer is the most common malignancy in the urinary system and urothelial cancer is the most common type of pathology worldwide. In male malignant tumors, the incidence rate of bladder cancer is 4 th, the mortality rate is 9 th, and the incidence rate ratio of male and female is 3: 1. Over 33 million patients with bladder tumors are newly diagnosed each year, and over 13 million die of bladder cancer. More than 2/3 patients are diagnosed with non-muscle invasive bladder urothelial cancer, but are highly recurrent post-operatively and 10% to 30% of recurrent patients will progress to muscle invasive bladder urothelial cancer, with about 30% of patients diagnosed with distant organ metastasis. Therefore, the method for quickly and accurately detecting the bladder cancer is established, and has great significance for clinical diagnosis and timely and effective treatment of bladder cancer patients.

CXCL1(Chemokine (C-X-C motif) ligand 1), Chemokine CXC motif ligand 1, is a cytokine belonging to the CXC Chemokine family, which was also previously known as GRO1(Human growth-regulated oncogene 1, growth-regulating oncogene 1), KC (Keratinocyte chemoattractant, Keratinocyte chemotaxis), NAP-3 (neutrophiling protein 3, Neutrophil activating protein 3) and MSGA-alpha (Melanoma growth stimulating hormone alpha). In humans, the protein is encoded by the cxcl1 gene and is located on human chromosome 4. CXCL1 is expressed in macrophages, neutrophils and epithelial cells and exhibits neutrophil chemotactic activity, CXCR2 is a chemokine receptor for CXCL and exhibits chemotactic effects upon binding to CXCL 1. Research shows that CXCL1 is highly expressed in bladder cancer, and in the case of poor differentiation, late clinical stage and recurrence, the expression degree is obviously higher than that in the case of good differentiation, early clinical stage and no recurrence, so CXCL1 can be used as a urothelial cell tumor marker for diagnosis, early intervention and treatment of bladder cancer. "W02007026895" discloses the use of CXCL1 protein as a tumor marker for detecting urothelial cancer, and W02010/050554 discloses CXCL1 antibody and a detection kit therefor, but there is still a great need for a new CXCL1 detection kit. Therefore, developing a detection method which is simple to prepare, low in cost, convenient to use and free of a high-precision instrument is an important aspect of the current research.

Disclosure of Invention

Based on the above findings, the primary object of the present invention is to provide a novel bladder cancer detection kit. The invention overcomes the defects of the prior art and provides the detection kit which has the advantages of simple preparation, low cost, convenient use and no need of a high-precision instrument. The kit detects the bladder cancer patient by a nucleic acid-antibody dual detection method, and further improves the detection accuracy.

The invention provides the following technical scheme:

the invention provides a nucleic acid detection reagent aiming at CXCL1, which comprises a detection primer pair and a probe, wherein the sequence of an upstream primer is shown as SEQ ID NO. 2, the sequence of a downstream primer is shown as SEQ ID NO. 3, and the sequence of the probe is shown as SEQ ID NO. 4.

In some embodiments, the probe of the invention is modified with dSpacer at a position 36bp apart from the 5 ' end in the probe, thymine (dT) at positions 34bp and 39bp apart from the 5 ' end on both sides of the dSpacer molecule is replaced with a fluorophore FAM and a quencher BHQ1, respectively, and is modified at the 3 ' end of the probe with a blocking group C3 Spacer.

A monoclonal antibody that specifically binds to CXCL1, comprising a heavy chain variable region comprising a CDR1 region, a CDR2 region and a CDR3 region, the amino acid sequences of the heavy chain CDR1 region, CDR2 region and CDR3 regions are set forth in SEQ ID NOs 7, 8 and 9, respectively; the light chain variable region comprises a CDR1 region, a CDR2 region and a CDR3 region, wherein the amino acid sequences of the light chain CDR1 region, the CDR2 region and the CDR3 region are shown in SEQ ID NOs 10, 11 and 12, respectively.

In another aspect, the invention provides a monoclonal antibody that specifically binds CXCL1, comprising a heavy chain variable region comprising the amino acid sequence SEQ ID No. 5 and a light chain variable region comprising the amino acid sequence SEQ ID No. 6.

In some embodiments, the anti-CXCL 1 antibodies of the invention comprise or consist of two heavy chains and two light chains, wherein each heavy chain comprises a heavy chain constant region sequence, a heavy chain variable region sequence, or a CDR sequence as described above, and each light chain comprises a light chain constant region sequence, a light chain variable region sequence, or a CDR sequence as described above. The antibody of the invention may be a full length antibody comprising a constant region, the full length antibody light chain constant region further comprising murine kappa, lambda chain sequences. The full-length antibody heavy chain constant region further comprises murine IgG1, IgG2a, IgG2b, IgG3, IgA or IgM sequences.

In some embodiments, an anti-CXCL 1 antibody of the invention is a Fab fragment, Fab 'fragment, F (ab')2 fragment, Fv fragment, diabody, linear antibody, single chain antibody molecule, or multispecific antibody formed from an anti-CXCL 1 antibody or antibody fragment described above.

In some embodiments, the anti-CXCL 1 antibody of the invention is used for the preparation of a diagnostic kit for bladder cancer.

In some embodiments, the nucleic acid detection reagent for CXCL1 described in the present invention is used for preparing a bladder cancer diagnostic kit.

In some embodiments, the invention provides a nucleic acid-antibody dual detection kit for bladder cancer, comprising an RPA kit for specifically detecting CXCL1 nucleic acid and an ELISA kit for specifically detecting CXCL1 comprising a monoclonal antibody;

in some embodiments, the invention provides a nucleic acid-antibody dual detection kit for bladder cancer, comprising an RPA kit for specifically detecting CXCL1 nucleic acid and an ELISA kit for specifically detecting CXCL1 comprising a monoclonal antibody; wherein the RPA kit comprises SEQ ID NO:2 and 3 and SEQ ID NO: 4; the ELISA kit comprises an ELISA plate coated by an anti-CXCL 1 monoclonal antibody and an anti-CXCL 1 ELISA-labeled antibody; the anti-CXCL 1 monoclonal antibody includes a heavy chain variable region comprising CDR1 shown in SEQ ID NO:7, CDR2 shown in SEQ ID NO:8 and CDR3 shown in SEQ ID NO:9, and a light chain variable region comprising CDR1 shown in SEQ ID NO:10, CDR2 shown in SEQ ID NO:11 and CDR3 shown in SEQ ID NO: 12.

In some embodiments, the invention provides a nucleic acid-antibody dual detection kit for bladder cancer, comprising an RPA kit for specifically detecting CXCL1 nucleic acid and an ELISA kit for specifically detecting CXCL1 comprising a monoclonal antibody; wherein the RPA kit comprises SEQ ID NO:2 and 3 and SEQ ID NO: 4; the ELISA kit comprises an ELISA plate coated by an anti-CXCL 1 monoclonal antibody and an anti-CXCL 1 ELISA-labeled antibody; the anti-CXCL 1 monoclonal antibody includes a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO. 5 and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO. 6.

Use of a kit for detecting bladder cancer by in vitro determination of the expression of CXCL1 protein, or a gene encoding the protein, in a biological sample from a subject.

In some embodiments, the biological sample of the invention is blood, plasma, serum, urine, bladder tissue or cells.

Advantageous effects

The invention prepares CXCL1 nucleic acid detection reagent by specific RPA primer and probe aiming at CXCL 1; meanwhile, a monoclonal antibody with a good effect is screened and obtained aiming at the CXCL1 antigen, the monoclonal antibody is prepared into a kit for detecting the CXCL1 protein, and the two detection methods are combined for use in the diagnosis of patients with bladder cancer, so that the detection accuracy can be further improved, the cost is low, and the method is suitable for large-scale popularization and use.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention.

Figure 1RPA method detects CXCL1 mRNA expression in cells.

Fig. 2CL107 specifically binds to CXCL 1.

Figure 3ELISA method detects CXCL1 protein.

Detailed Description

The preferred embodiments of the present invention will be described in conjunction with the accompanying drawings, and it will be understood that they are described herein for the purpose of illustration and explanation and not limitation.

Example 1 design of RPA-specific detection primers

The gene sequence of CXCL1 is compared with the homologous sequence thereof, and a more specific region is selected as a target region for primer detection, and the sequence of the region is shown as SEQ ID NO. 1.

According to the rule of RPA primer design and the optimization of the primer, a specific primer sequence is obtained, and the sequence is shown as follows:

upstream primer (SEQ ID NO: 2):

CGAGTGGCACTGCTGCTCCTGCTCCTGGTAGCCG

downstream primer (SEQ ID NO: 3):

CTATGGGGGATGCAGGATTGAGGCAAGCTTTCC

probe sequence (SEQ ID NO: 4):

GAATTCACCCCAAGAACATCCAAAGTGTGAACGTGAAGTCCCCCGGACCC, dSpacer modification is adopted at the position 36bp apart from the 5 ' end in the probe, thymine (dT) at the positions 34bp and 39bp apart from the 5 ' end on both sides of dSpacer molecule is replaced by a fluorescent group FAM and a quenching group BHQ1 respectively, and the 3 ' end of the probe is modified by a blocking group C3 Spacer.

Example 2 detection of CXCL1 Gene expression by RPA method

Separately culturing the bladder cancer cell strain T24 and normal bladder epithelial cell SV-HUC-1. Total RNA from cells was extracted using Trizol reagent (Thermo Co.) and following the instructions. Taking the extracted RNA as a template, carrying out an RPA test, carrying out RPA amplification by using the primer designed in the embodiment 1, and simultaneously setting ultrapure water as a negative control, wherein the reaction time (namely the amplification cycle number) at 40 ℃ is 25min respectively, and the RPA reaction system is 50 mul, wherein 2 mul of forward and reverse primers (10 mul), 2 mul of reverse primer (10 mul), 0.6 mul of probe, 25 mul of buffer solution containing recombinase, DNA polymerase, single-strand binding protein, endonuclease IV and reverse transcriptase, 1 mul of template and 17.9 mul of lddH2O are fully oscillated, uniformly mixed and instantaneously separated, and finally 2.5 mul of 280mM magnesium acetate (MgOAc) is added, and the reaction tube is placed in a real-time fluorescence PCR instrument for a corresponding time at 40 ℃; as shown in fig. 1, the CXCL1 gene was highly expressed in the bladder cancer cell line T24, and CXCL1 expression could be detected in the human normal bladder epithelial cells SV-HUC-1, but the mRNA level of CXCL1 in the bladder cancer cell line was significantly higher than that of the human normal bladder epithelial cells.

Example 3 anti-CXCL 1 antibody preparation

100 μ g of CXCL1 antigen was mixed well with an equal volume of Complete Freund's Adjuvant (CFA) to form a water-like oil bag, and then injected intraperitoneally to initially immunize BALB/C mice. After 3 weeks 100 μ g of CXCL1 was emulsified in equal volumes with Incomplete Freund's Adjuvant (IFA) and boosted by back-injection. Thereafter, the immunization was performed every 2 weeks, and tail blood was collected 7 days after each immunization, and the antibody titer was measured by ELISA. When the antibody titer is appropriate, 100 μ g of CXCL1 antigen and Incomplete Freund's Adjuvant (IFA) are mixed in equal volumes and emulsified, and the last immunization is performed by back multi-point injection. Spleens were harvested on day four and subjected to cell fusion. Spleen cells of immunized Balb/c mice were fused with a myeloma Sp2/0 cell line, and the fused cells were diluted to an appropriate concentration in Iscove's medium (0.1mM hypoxanthine, 0.4. mu.M aminopterin and 16. mu.M thymidine) containing 10% serum, and then cultured in a 96-well plate. After 10 days, cell supernatants were removed and primary cultures showing a positive reaction with CXCL1 protein in the supernatants were examined by high throughput ELISA. The hybridoma cells in the wells were diluted and subcloned, and similarly screened by ELISA, to finally obtain a positive hybridoma cell line, which was named CL-107. After expansion culture, the hybridoma cells were cryopreserved.

EXAMPLE 4 purification of monoclonal antibodies

BALB/c mice were injected intraperitoneally with 0.5 ml/mouse, 1 week before hybridoma inoculation. After 1 week, each mouse was inoculated intraperitoneally at about 1X10⁶(ii) individual hybridoma cells; and after 7-10 days, collecting ascites. Centrifuging ascites at 10000 Xg for 30min, removing precipitate, salting out with 50% ammonium sulfate, coarse extracting, dissolving with PBS, and dialyzing with flowing water for 5 hr; dialyzing and equilibrating with 0.1mol/L phosphate buffer (pH8.0) overnight; and (3) loading, eluting the hybrid protein by using 0.1mol/L phosphate buffer solution (pH8.0), eluting by using citrate eluents with different pH values, collecting elution peaks in sections, and concentrating to obtain the purified anti-CXCL 1 antibody CL-107.

Example 5 anti-CXCL 1 antibody subtype identification

The positive mouse monoclonal cell line selected by indirect ELISA was subjected to subclass measurement using a subclass measuring reagent (Sigma). The microplate provided in the kit had been pre-coated with specific antibodies against mouse IgG1, IgG2a, IgG2b, IgG3, IgA, IgM, kappa light chain, lambda light chain, and the anti-CXCL 1 antibody sample purified in example 4 was added to the sample wells at 50 μ l per well without incubation. Adding 1X goat anti-mouse IgA + IgM + IgG-HRP into sample wells, mixing the sample wells with 50 μ l each, and incubating for 1 h. And (4) deducting liquid in the holes, adding 1XPBST to wash the holes for 3 times, and absorbing the excessive moisture by absorbent paper. Adding color development solution, and developing 100 μ l per well in dark at room temperature for 15 min. The color reaction was stopped by adding 100. mu.l of stop solution. The results showed that the monoclonal antibody of the present invention was a murine monoclonal antibody of the IgG2b type, designated CL-107.

EXAMPLE 6 monoclonal antibody sequencing

The CL-107 hybridoma cell cryopreservation tube is taken out from liquid nitrogen, rapidly thawed at 37 ℃, centrifuged at 1000rpm for 5min to remove the cryopreservation liquid, placed in a 100mm pore plate, cultured until the culture plate accounts for about 80%, added with 1ml Trizol reagent (Thermo company), and extracted with total RNA of hybridoma cells according to the instructions.

Mu.g of the above total RNA was taken, DECP water was added to make the volume 11. mu.l, 1.0. mu.l of oligo (dT) (10. mu.M) was added, 1. mu.l of dNTPs (10mM) was added, and mixed well,after incubation at 65 ℃ for 5 minutes, the cells were placed on ice for 1 minute, and then 4. mu.l of RT buffer (5X), 1.0. mu.l of DTT (100mM), 1. mu.l of Ribonucleae Inhibitor and 1. mu.l of reverse transcriptase (takara Co.) were added and reacted at 50 ℃ for 10 minutes. The reaction was terminated by incubation at 80 ℃ for 10 minutes, and the obtained cDNA was stored at-20 ℃. Designing specific nested PCR primer, the primer sequence used in the amplification reaction is complementary with the first frame region and the constant region of the antibody variable region, and amplifying the target gene by adopting a conventional PCR method. Wherein the primer sequence is designed according to the literature (Bodo Brocks. Specifes-Cross reactive scFv Against the Tumor promoter Marker "fibrous Activation Protein" Selected by phase Display From an immobilized FAP-^/-Knock-Out Mouse).

Sequencing results show that the amino acid sequences of the heavy chain and light chain variable regions of the anti-CXCL 1 antibody CL-107 are respectively shown in SEQ ID NOs: 5 and SEQ ID NO:6 is shown in the specification; the amino acid sequences of 3 CDRs in the heavy chain variable region of the antibody are respectively shown as SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9; the amino acid sequences of 3 CDRs in the light chain variable region are shown as SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12, respectively.

Example 7 identification of antibody specificity

The monoclonal antibody purified in example 4 was cross-reacted with ELISA plates coated with CXCL2, CXCL5 and CXCL8, which are homologous proteins of CXCL1, respectively, by an indirect ELISA method, and the specificity was analyzed. The specific experimental process is that CXCL1, CXCL2, CXCL5 and CXCL8 are respectively coated, the concentration is 0.1mg/ml, the antibodies obtained in the embodiment 3 are respectively added into four different coating antigens, and the degree of cross reaction is detected by indirect ELISA. As shown in fig. 2, the anti-CXCL 1 monoclonal antibody CL-107 reacted only with CXCL1 and did not cross-react with CXCL2, CXCL5 and CXCL 8.

Example 8 anti-CXCL 1 antibody affinity assay

Coating an antibody capture Antibody (AHC) on the surface of a CM5 chip by an amino coupling mode, preparing chip activation buffer solution N-ethyl-N' - (3-dimethylaminopropyl) -carbodiimide (EDC) and N-hydroxysuccinimide (NHS) by referring to the specifications of an amino coupling kit and an anti-capture kit, and selecting Biacore300 and ethanolamine for blocking0 system, AHC amino group was coupled to the surface of CM5 chip. The anti-CXCL 1 antibody CL-107 obtained in example 4 was captured on the chip surface. The antibody was diluted to 1. mu.g/mL with HBS-EP + buffer, set to a flow rate of 5. mu.l/min, and coated to a response value of 300 RU. CXCL1 antigen was applied in 7 different concentration gradients and serially diluted 2-fold in HBS-EP buffer from 40nM to 0 nM. The CXCL1 antigen flow rate was set at 30. mu.l/min and the binding time was set at 3 min. The flow rate of HBS-EP + buffer was set at 30. mu.l/min, and the dissociation time was set at 10 min. Use of 3M MgCl₂As a regeneration buffer, the chip was regenerated according to the regeneration procedure. In addition, affinity assays were performed following the same procedure as for the control antibody IgG1-14 (see CN103408663B patent page 20, line 4). Calculation of binding Rate (K) by Simultaneous fitting of binding and dissociation sensorgrams_a) And dissociation Rate (K)_d). Equilibrium dissociation constant (K)_d) Using dissociation rate (K)_d) Rate of binding (K)_a) And (4) calculating. The results are shown in table one: the antibody of the invention has high affinity, and the affinity K_DValue up to 1.21x10-⁸M。

Watch 1

Example 9 detection of CXCL1 by ELISA method

Diluting the anti-CXCL 1 monoclonal antibody CL-107 and the control antibody IgG1-14 obtained in example 4 to 2 mu g/ml, and respectively adding the diluted solutions into wells of an enzyme-labeled plate, wherein each well is 100 mu l; the enzyme label plate is placed in an environment of 4 ℃ for coating overnight; adding 100 mul of sealing liquid into each hole, placing in a 37 ℃ incubator for 30 minutes; and taking the enzyme label plate out of the incubator, and then discarding the sealing liquid. The CXCL1 protein was diluted with artificial serum to concentrations of 200, 100, 50, 25, 10, 5, 1pg/ml, respectively. Mu.l of the suspension was added to each well and incubated at 37 ℃ for 1 hour. The supernatant was removed, followed by PBST washing. The CXCL1 antigen is used to immunize rabbit to obtain polyclonal antibody of CXCL1, which is labeled with horseradish peroxidase to obtain enzyme labeled antibody. This was added to wells 100. mu.l per well and incubated at 37 ℃ for 30 minutes in an incubator. Removing supernatant, adding 200 μ l PBST lotion into each well, standing for 2min, removing lotion, and washing for 3 times. Mu.l TMB was added to each well and incubated for 15-30min at room temperature in the dark. The chromogenic reaction was stopped by adding 50. mu.l of stop solution to each well. And (3) placing the ELISA plate into an ELISA reader, and detecting the light absorption value at the wavelength of 450 nm. As shown in FIG. 3, the anti-CXCL 1 monoclonal antibody CL-107 of the present invention has higher signal intensity than the control antibody IgG1-14, and human CXCL1 has higher detection ability.

Sequence listing

<110> Beijing Bao Picture Biotechnology Ltd

<120> nucleic acid-antibody dual cancer detection kit

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 229

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgagtggcac tgctgctcct gctcctggta gccgctggcc ggcgcgcagc aggagcgtcc 60

gtggccactg aactgcgctg ccagtgcttg cagaccctgc agggaattca ccccaagaac 120

atccaaagtg tgaacgtgaa gtcccccgga ccccactgcg cccaaaccga agtcatagcc 180

acactcaaga atgggcggaa agcttgcctc aatcctgcat cccccatag 229

<210> 2

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgagtggcac tgctgctcct gctcctggta gccg 34

<210> 3

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctatggggga tgcaggattg aggcaagctt tcc 33

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaattcaccc caagaacatc caaagtgtga acgtgaagtc ccccggaccc 50

<210> 5

<211> 119

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Arg Ala

20 25 30

Glu Pro Asp Trp Val Arg Gln Ser His Gly Lys Ser Leu Glu Trp Ile

35 40 45

Gly Asn Ile Ala Gly Pro Thr Asn Lys Glu Tyr Met Thr Asp Ser Val

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn Thr Val Tyr

65 70 75 80

Met Glu Phe Arg Ser Leu Thr Leu Glu Asp Ser Ala Ile Tyr Phe Cys

85 90 95

Ala Arg Gly Gly Gln Pro Asp Thr Asn Tyr Met Asn Trp Gly Gln Gly

100 105 110

Thr Ile Phe Thr Val Ser Ser

115

<210> 6

<211> 107

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Asp Val Gln Met Thr Gln Thr Pro Ser Ala Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Arg Val Thr Ile Ser Cys Ala Arg Ile Thr Pro Lys Gly Asp Thr

20 25 30

Cys Ser Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile

35 40 45

Tyr Thr Ala Ile Asp Gly Cys Lys Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Pro

65 70 75 80

Glu Asp Ile Ala Thr Tyr Phe Cys Gly Ala Pro Ser Ile Asn Leu Cys

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 7

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Arg Ala Glu Pro Asp

1 5

<210> 8

<211> 17

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Asn Ile Ala Gly Pro Thr Asn Lys Glu Tyr Met Thr Asp Ser Val Lys

1 5 10 15

Gly

<210> 9

<211> 10

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Gly Gly Gln Pro Asp Thr Asn Tyr Met Asn

1 5 10

<210> 10

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Ala Arg Ile Thr Pro Lys Gly Asp Thr Cys Ser

1 5 10

<210> 11

<211> 7

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Thr Ala Ile Asp Gly Cys Lys

1 5

<210> 12

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Gly Ala Pro Ser Ile Asn Leu Cys Thr

1 5

Claims

1. A nucleic acid-antibody dual bladder cancer detection kit, which comprises an RPA kit for specifically detecting CXCL1 nucleic acid and an ELISA kit containing monoclonal antibody for specifically detecting CXCL 1; wherein the RPA kit comprises SEQ ID NO:2 and 3 and SEQ ID NO: 4; the ELISA kit comprises an ELISA plate coated by an anti-CXCL 1 monoclonal antibody and an anti-CXCL 1 ELISA antibody, wherein the anti-CXCL 1 monoclonal antibody comprises a heavy chain variable region which comprises a CDR1 shown in SEQ ID NO. 7, a CDR2 shown in SEQ ID NO. 8 and a CDR3 shown in SEQ ID NO. 9, and a light chain variable region which comprises a CDR1 shown in SEQ ID NO. 10, a CDR2 shown in SEQ ID NO. 11 and a CDR3 shown in SEQ ID NO. 12.

2. A nucleic acid-antibody dual bladder cancer detection kit, which comprises an RPA kit for specifically detecting CXCL1 nucleic acid and an ELISA kit containing monoclonal antibody for specifically detecting CXCL 1; wherein the RPA kit comprises SEQ ID NO:2 and 3 and SEQ ID NO: 4; the ELISA kit comprises an ELISA plate coated by an anti-CXCL 1 monoclonal antibody and an anti-CXCL 1 enzyme-labeled antibody, wherein the heavy chain variable region sequence of the anti-CXCL 1 monoclonal antibody is shown as SEQ ID NO. 5, and the light chain variable region sequence is shown as SEQ ID NO. 6.