CN113201462B

CN113201462B - Candida erickii ZB432 and application thereof

Info

Publication number: CN113201462B
Application number: CN202110674420.8A
Authority: CN
Inventors: 侯莎; 童星; 梁贵江
Original assignee: Foshan Haitian Flavoring and Food Co Ltd; Guangdong Haitian Innovation Technology Co Ltd
Current assignee: Foshan Haitian Flavoring and Food Co Ltd; Guangdong Haitian Innovation Technology Co Ltd
Priority date: 2021-06-17
Filing date: 2021-06-17
Publication date: 2022-07-26
Anticipated expiration: 2041-06-17
Also published as: CN113201462A

Abstract

The invention provides Candida ericae (Candida etchellsii) ZB432, wherein the Candida ericae ZB432 is preserved in Guangdong province microbial strain preservation center with the preservation number of GDMCC No: 61293. the Candida ericae ZB432 disclosed by the invention can inhibit the proliferation of bacillus in the low-salt soy sauce brewing process, can obviously improve the flavor quality of the reduced-salt fermented soy sauce in the soy sauce fermentation process, has a certain salt-resistant characteristic, is suitable for being used in a fermentation system of the reduced-salt soy sauce, and has a wide application prospect.

Description

Candida anglica ZB432 and application thereof

Technical Field

The invention belongs to the technical field of industrial microorganisms, and particularly relates to Candida albicans (Candida etchellsii) ZB432 capable of inhibiting proliferation of bacillus subtilis and application thereof, and further relates to an effect of the Candida albicans in production of salt-reduced soy sauce.

Background

The traditional production of high-salt dilute soy sauce is carried out by adopting an open and semi-open fermentation mode, comprises two stages of starter propagation and fermentation, and is subjected to a co-fermentation process of multiple microorganisms for several months to generate flavor substances such as aliphatic compounds, aromatic compounds, ketones, pyrazine and the like, so as to form the seasoning with special taste and flavor. Wherein, the high-concentration salt is crucial to the maintenance of functional flora in the fermentation process, and effectively inhibits microorganisms which are easy to generate bad flavor in the fermentation system, so that the microorganisms are difficult to survive or maintained at a low level, and the salt concentration of the high-salt dilute soy sauce is about 16-18%. However, as people are increasingly concerned about health, the salt intake tends to be reduced, and therefore, salt-reduced soy sauce is increasingly favored by consumers.

The prior commercial salt-reducing soy sauce is mostly obtained by adopting an electrodialysis desalination technology, which not only influences the flavor of the soy sauce and reduces the quality of the soy sauce, but also greatly increases the production cost. It has also been reported that the salt-reduced fermentation process is used, but when the salinity in the fermentation system is reduced, microorganisms such as bacillus, putrefying lactic acid bacteria, etc. are excessively propagated due to lack of inhibition of high salt, which may lead to rancidity of the fermentation system or deterioration of the flavor of the crude oil. The temperature in a fermentation system is further increased to inhibit the generation of mixed bacteria, however, the fermentation system is only suitable for the living fermentation of a few high temperature resistant microorganisms, and the flavor of the salt-reduced soy sauce product is often insufficient. Therefore, the problem that the fermentation system is rancid due to the fact that infectious microbes are easily infected in the fermentation process of the low-salt soy sauce is solved, the good flavor of the soy sauce product is kept, the method has important significance for popularization of the low-salt soy sauce product, and the low-salt dietary habit of consumers can be effectively promoted to form.

Therefore, it is necessary to find a new salt-reduced soy sauce fermenting strain capable of solving the above problems.

Disclosure of Invention

The invention provides a Candida acinosa (Candida etchellsii) ZB432 which is obtained by separating and screening the high-salt dilute fermentation soy sauce mash at present, has wide adaptability to salinity, is inoculated into low-salt soy sauce mash for fermentation, has strong bacillus inhibition capability, and does not need to add a bacteriostatic agent or change a production process to inhibit the multiplication of bacillus. And the color, aroma, body state and taste of the low-salt soy sauce obtained by adopting the Candida ericae strain for fermentation are obviously improved, and the defect that the excessive proliferation of the bacillus cannot be effectively inhibited during the fermentation of the low-salt soy sauce is overcome.

Based on the findings, the invention provides a strain of Candida anomala (Candida escheri) ZB432, the deposit number of which is as follows: GDMCC No: 61293.

the specific strain preservation information is as follows:

name of the depository: guangdong province microbial strain preservation center

The preservation address is as follows: 5 th floor of 100 th courtyard of Xieli Zhonglu, Guangdong province

The preservation date is as follows: 12 days in 2021 s

The preservation number is: GDMCC No: 61293

The colony characteristics of Candida ericae (Candida etchellsii) ZB432 of the present invention are as follows: the method is characterized in that the colony cultured for 48 hours on a PDA solid medium at 30 ℃ is circular or oval, the diameter is 3-5 mm, the colony is white and opaque, the surface is smooth and moist, the colony is glossy and easy to pick up, the texture of the colony is uniform, and the edge is neat.

The invention also provides a screening method of the candida aegypti ZB432, which comprises the following steps:

1) diluting the high-salt soy sauce mash fermented and cultured for 60 days according to the conventional soy sauce fermentation process;

2) coating the diluent obtained in the step 1) on a PDA plate culture medium for primary screening;

3) inoculating the primary screened strain obtained in the step 2) and fermenting to obtain fermentation liquor;

4) carrying out bacteriostasis test and re-screening on the fermentation liquor obtained in the step 3) and bacteriostasis indicating bacteria, and screening out a yeast strain with the best bacillus resisting effect;

5) and (4) carrying out morphological, physiological and biochemical analysis and ITS sequence analysis and identification on the yeast strains screened in the step (4).

In certain embodiments, the screening method of the present invention, wherein the morphological feature of the primary screened strain in step 2) is: the bacterial colony is round or oval, milky white, moist and smooth in surface, ellipsoidal under microscope, and has the characteristics of budding or splitting reproduction.

In certain embodiments, the screening method of the present invention, wherein step 3) further comprises a method for preparing a fermentation broth:

a) inoculating the primary screened strain into an YPD culture medium for culture;

b) centrifuging the culture solution obtained in a), taking the supernatant and filtering.

In certain embodiments, the screening method according to the present invention, wherein step 4) further comprises that the bacteriostatic indicator is Bacillus (Bacillus).

In certain embodiments, the screening method according to the present invention, wherein step 4) further comprises that the bacteriostatic indicator is one or more of Bacillus subtilis, Bacillus megaterium, and Bacillus pumilus.

In certain embodiments, the screening method of the present invention, wherein the bacillus subtilis is isolated from the low-salt fermented acidified moromi in step 4).

In certain embodiments, the screening method according to the present invention, wherein the bacteriostatic test of the fermentation broth in step 4) is performed by oxford cup agar diffusion.

The invention also provides fermentation liquor fermented by the Candida ericae (Candida etchellsii) ZB 432.

The invention also provides application of the Candida anomala (Candida etchellsii) ZB432 or fermentation liquor thereof in preparing the salt-reduced and/or low-salt fermented soy sauce.

Preferably, the concentration of sodium chloride in the reduced-salt and/or low-salt fermented soy sauce is 5-15%. Specifically, the concentration of sodium chloride in the low-salt fermented soy sauce is 5-9%, and the concentration of sodium chloride in the reduced-salt fermented soy sauce is 9-15%.

Preferably, the Candida ericae (Candida etchellsii) ZB432 or the fermentation liquid thereof is used for inhibiting bacillus. The fermentation liquor of the candida albicans ZB432 can inhibit the proliferation of bacillus in the fermentation process of the reduced-salt soy sauce.

The invention also provides a method for preparing salt-reduced and/or low-salt soy sauce by adopting the candida aegypti ZB432, which comprises the following steps:

i) inoculating candida albicans ZB432 to the fermented soy sauce mash;

ii) continuing fermenting the soy sauce mash obtained in i) for 60 days;

iii) squeezing, filtering and sterilizing the fermented soy mash obtained in ii) to obtain the soy sauce crude oil.

In certain embodiments, the preparation process according to the invention, wherein the number of fermentation days of the fermented moromi in step i) is from 2d to 25d (e.g. 5d, 10d, 15d, 20 d).

In some embodiments, the preparation method according to the invention, wherein step i) further comprises inoculating candida antarctica ZB432 with a bacterial solution concentration of 10 ⁷ ～10 ⁹ CFU/mL。

In some embodiments, the preparation method according to the invention, wherein step i) further comprises inoculating Candida antarctica ZB432 with a bacterial solution in an amount of 10 ⁴ 、10 ⁵ 、10 ⁶ CFU/g yeast material.

In certain embodiments, the method of the invention, wherein step i) further comprises fermenting the moromi sodium chloride at a concentration of 5% to 15%.

In certain embodiments, the preparation process according to the invention, wherein the temperature of the moromi fermentation in steps i) and ii) is between 25 ℃ and 30 ℃.

The invention has the beneficial effects that:

(1) the Candida ericae (Candida etchellsii) ZB432 strain provided by the invention is adopted for fermentation, and the obtained fermentation liquor has better bacillus inhibition capability.

(2) The Candida etichellsii ZB432 strain provided by the invention has wider salinity adaptability, is inoculated into the existing salt-reduced soy sauce fermentation process, and does not need to add a bacteriostatic agent or change the production process to remove the influence of mixed bacteria bacillus in the fermentation process, thereby obviously improving the quality of low-salt soy sauce products and making up the defect that the existing low-salt soy sauce fermentation process cannot effectively resist the bacillus.

Drawings

FIG. 1 is a schematic diagram showing colony morphology of Candida aegypti ZB432 and cell morphology under a microscope

FIG. 2 is a schematic diagram showing the alignment of ITS sequences of Candida ericae ZB432 and Candida etchellsii

Fig. 3 is a growth graph.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples, but those skilled in the art will appreciate that the following drawings and examples are only illustrative of the present invention and are not intended to limit the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the accompanying drawings and the following detailed description of the preferred embodiments.

The invention will now be described with reference to the following examples, which are intended to illustrate the invention, but not to limit it.

The reagents, methods and apparatus employed in the present invention are conventional food grade reagents, methods and apparatus in the art, unless otherwise specified.

Unless otherwise indicated, the test conditions used in the examples of the present invention are those conventional in the art. The reagents used in the examples of the present invention were all commercially available unless otherwise specified.

Example 1Separation and screening of Candida ericae ZB432

1. Primary screening of strains

Shaking the high-salt sauce mash which is placed in a fermentation tank of a thermostatic chamber with the temperature of 30 ℃ for 60 days, taking 0.5-1mL to 15mL of centrifuge tube from a super clean bench, adding a proper amount of sterile glass beads, shaking for 5-10 minutes, diluting the sample to 10 percent by using sterile water ^-2 ，10 ^-3 ，10 ^-4 Concentration gradient for later use;

coating the diluted samples on a PDA (personal digital assistant) flat plate, wherein each sample is three in parallel; sucking 100 mu L of diluent into a plate culture medium containing 6-10 sterile glass beads, horizontally moving and shaking left and right to uniformly coat the bacterial liquid on a plate, and pouring out the glass beads; and (3) placing the inoculated PDA culture medium in a constant temperature incubator at 30 ℃ for culturing for 2-3 days.

Selecting single colonies with circular or elliptical, milky white or light yellow colonies and wet and smooth surfaces in the PDA culture medium for microscopic examination, and selecting 67 single colonies from the PDA culture medium for microscopic examination and rescreening. The strains which are in an ellipsoid shape under a microscope and have the characteristics of budding or split reproduction are screened and subjected to streak purification for multiple times, and 17 strains with typical yeast forms are obtained, namely Y1, Y2, Y3, Y4, Y5, Y6, Y7, Y8, Y9, Y10, Y11, Y12, Y13, Y14, Y15, Y16 and Y17.

2. Rescreening of bacterial strains

Activating 17 strains of yeast obtained by primary screening, fermenting to prepare metabolites, and further re-screening by detecting bacteriostatic active substances produced in the metabolites.

Preparation of yeast metabolites: proper amount of the above yeast is selected and cultured in a test tube containing 5mL YPD medium at 30 ℃ for 24h at 210 r/min. After 24h, the yeast was activated for the second generation, and 200ul (2% inoculum size by volume fraction) of the bacterial solution was pipetted into a test tube containing 10mL of YPD medium and cultured by air shaking at 30 ℃ and 210r/min for 163 h. Taking 1.5mL fermentation liquid in a 2mL sterilized centrifuge tube, centrifuging at 10000r/min for 5min, filtering the supernatant with a 0.22 μm pore size bacteria filter, collecting the cell-free fermentation supernatant filtrate to obtain the yeast metabolite, and storing in a refrigerator at 4 ℃ for later use.

Preparing an indicator bacterium suspension: (1) the method comprises the steps of separating an indicator bacterium from a strain of bacillus subtilis 12-3 separated from low-salt fermented and acidified soy sauce mash, wherein the bacillus subtilis is a common abnormal proliferation mixed bacterium in a soy sauce brewing process, and obtaining the low-salt fermented and acidified soy sauce mash by a conventional technical means, namely dissolving 1g of the low-salt fermented and acidified soy sauce mash in 5mL of physiological saline, fully shaking and uniformly mixing, then coating 100uL of mixed solution on a PCA (principal component analysis) plate solid culture medium, and culturing for 12 hours at 37 ℃. (2) Preparation of bacterial suspension indicator bacteria were inoculated in LB broth medium, cultured at 37 ℃ for 12h, continuously activated for two generations, and each strain was prepared to a final concentration of 10 using sterile physiological saline by flat viable count method ⁴ CFU/mL of bacterial suspension is used as an indicator bacterial suspension for standby.

YPD medium: 1% (W/V) yeast powder, 2% (W/V) peptone and 2% (W/V) glucose.

LB broth culture medium: 1% (W/V) peptone, 1% (W/V) sodium chloride, 0.5% (W/V) glucose, 0.1% yeast extract powder, final pH7.0 + -0.2;

PCA solid culture medium: 5g/L of tryptone, 2.5g/L of yeast extract powder, 1.0g/L of glucose, 15g/L of agar and 7.0 of pH.

Secondary screening of yeast producing bacteriostatic active substances: screening is carried out by adopting an oxford cup agar diffusion method. The indicator bacterium culture medium adopts semi-solidAnd (3) preparing a nutrient agar culture medium (0.7%), preparing a semi-solid nutrient agar culture medium, subpackaging in test tubes, sterilizing each test tube at 115 ℃ for 15min, and placing in an oven at 45-55 ℃ for later use. Adding diluted indicator bacteria (12-3) into solid nutrient agar culture medium to make viable bacteria concentration be 10 ⁴ CFU/mL. Shaking uniformly with a vortex oscillator, pouring the mixture obliquely into a nutrient agar culture medium poured in advance (7 oxford cups are placed on each plate before the semisolid is poured), and taking out the oxford cups after the semisolid nutrient agar is solidified to form a double-layer culture medium (0.7% of agar on the upper layer and 1.5% of agar on the lower layer). Adding 100uL of yeast metabolite into a small hole by taking a culture medium as a blank control, culturing a plate containing the bacillus subtilis 12-3 at 30 ℃ for 16h, measuring the diameter of a bacteriostatic circle by using a vernier caliper and a cross method, and expressing the size of the bacteriostatic circle by using the diameter. Each experiment was performed 2 replicates and the average was taken and the results are given in table 1.

Table 1: bacteriostatic results of different yeasts

As can be seen from Table 1, most yeast strains have no obvious bacteriostatic effect, have no inhibitory effect on the growth of the Bacillus subtilis 12-3, Y3 shows an obvious bacteriostatic zone, the diameter of the bacteriostatic zone is 13.98 +/-0.13 mm, and the yeast strain Y3 has better capability of inhibiting the Bacillus.

Double-layer culture medium; the lower layer is nutrient agar culture medium (NA) containing 0.5% (W/V) peptone, 0.3% (W/V) beef extract powder, 1.5% (W/V) agar, and pH 7.3; the upper layer culture medium is semisolid nutrient agar culture medium containing 0.5% (W/V) peptone, 0.3% (W/V) beef extract powder, 0.7% (W/V) agar, and pH 7.3.

3. Verification of bacteriostatic performance of yeast strain Y3

Pure culture system: picking fermentInoculating single parent Y3 colony to YPD liquid culture medium, culturing at 30 deg.C and 210r/min, respectively activating and culturing single Bacillus subtilis 12-3 colony in LB liquid culture medium at 37 deg.C and 210r/min for 12 hr, and preparing seed solution. Respectively inoculating yeast Y3 and Bacillus subtilis in 50mL culture medium (YPD + 15% soy sauce) to perform pure culture, wherein the inoculation concentrations of yeast Y3 and Bacillus subtilis are 1 × 10 ⁷ cfu/mL, the culture conditions are 30 ℃, 200r/min and the culture time is 72 h. The culture conditions are 30 ℃, 200r/min and the culture time is 72 h.

Mixed culture system: after the activation culture of yeast and spore respectively, the yeast Y3 and the Bacillus subtilis are inoculated in a culture medium (YPD + 15% soy sauce) at the same time, and then a sodium chloride solution is added to adjust the salt concentration of the system to 6%. Inoculation concentration of bacterial liquid is 1 × 10 ⁷ cfu/mL, the culture condition is 30 ℃, 210r/min, and the culture time is 72 h.

And (3) viable count determination: and respectively taking fermentation liquor of 12h, 24h, 36h, 48h, 60h and 72h from the pure culture system and the mixed culture system for fermentation viable count determination. Viable count was tested as follows: adding 100 μ L fermentation liquid into 900 μ L sterile water, sequentially performing 10 times gradient dilution, respectively selecting 10 ^-3 、10 ^-4 、10 ^-5 、10 ^-6 Gradient broth 100 μ L was spread evenly on plate medium and each gradient was repeated 3 times. Culturing in a 30 ℃ constant temperature incubator for 12-3 h, culturing the bacillus subtilis for 3 days by using yeast Y3, and counting the number of colonies by selecting a culture dish with the number of colonies between 30 and 300. Yeast Y3 was inoculated on PDA plate medium and counted, and Bacillus subtilis 12-3 was inoculated on LB plate medium and counted. The test results are shown in fig. 3:

the reference numbers in FIG. 3 are given as follows: c12-3 is the growth curve of pure culture of Bacillus subtilis 12-3; C-Y3 is the growth curve of pure culture of yeast Y3 (strain ZB 432); g12-3 is the growth curve of Bacillus subtilis 12-3 when Bacillus subtilis 12-3 and yeast Y3 are co-cultured; G-Y3 is the growth curve for yeast Y3 (strain ZB432) when Bacillus subtilis 12-3 and yeast Y3 were co-cultured.

The results in FIG. 3 show that: the growth performance of the yeast Y3 under pure culture and mixed culture systems is consistent, and no difference exists, which indicates that the bacillus subtilis 12-3 has no influence on the growth of the yeast Y3; the bacillus subtilis 12-3 grows well in a pure culture system, the highest biomass reaches 126330CFU/mL when no salt is added externally, and the viable count of the bacillus subtilis 12-3 in a mixed culture system keeps a descending trend, which shows that the growth of the bacillus subtilis is inhibited by yeast Y3.

4. Molecular identification of Yeast Strain Y3

The ITS sequence of Y3 was amplified using the universal primers ITS4 (5'-TCCTCCGCTTATTGATATGC-3') and ITS86 (5'-GTGAATCATCGAATCTTTGAAC-3'), and sequenced from Huada gene, the sequence shown in SEQ ID NO: 1:

5’-AGGACTTCGGATCTTGCTTGATTGGGGGCATAAAATATTACTGCACAGAGTTATTAACGTGTGCTGTTCCATTTCTTTGACTCCAATAAGGAGCAACACCTCGTAATCCACAAGAAGTAGATTAGAGAGAAAGTTCGGCGCTCCAACAAGCATGCTACTAGGAGATCCTAGAAGCGCAATGTGCGTTCAAAGATTCGATGATTCACAAA-3’(SEQ ID NO:1)

the coverage with the Candida etchellsii sequence is 93 percent in the database NCBI through BLAST, the similarity is over 97 percent, and the sequence has individual base difference, so that the yeast Y3 is a new Candida ericae strain. The yeast Y3 obtained by the breeding of the embodiment has been deposited by the inventor in the culture Collection of microorganisms in Guangdong province at 12.1.2021, and is named as Candida erethii ZB432, and the deposit numbers are: GDMCC No: 61293 yeast Y3 is the same strain as Candida antarctica (Candida escher) ZB 432.

Example 2 identification of the salt tolerance of the Candida antarctica ZB432 Strain

A single colony of yeast ZB432 was picked and inoculated into YPD medium, and cultured overnight at 30 ℃ at 210r/min to obtain a seed solution. Inoculating 10% seed solution to YPD liquid culture medium containing 5% (M/M), 8% (M/M), 10% (M/M), 12% (M/M), 15% (M/M) and 18% (M/M) NaCl, culturing at 30 deg.C and 210r/min for 72 hr, and determining OD at 12h, 24h, 48h and 72h respectively ₆₀₀ 。

As shown in Table 2, the OD600 was reduced after Y3 was cultured for 72 hours with increasing salinity, but the normal growth was still achieved, indicating that Y3 has better salt tolerance. In low salt system, such as 5% (M/M) and 8% (M/M), the addition of salt in early growth stage has certain promotion effect on cell growth, and shows certain halophilicity. The Y3 has good salt tolerance, is suitable for being applied in a low-salt fermentation system and a fermentation system with higher salt content, and has wider application range.

Table 2: growth of Y3 at different salinity

Example 3 demonstration of the Effect of Candida Angericae ZB432 Strain in Low salt fermentation

Soy sauce fermentation: 250g of the disc koji is taken and placed in a 900mL sauce bottle, 450g of 15% (M/M) saline is added, the mixture is fully mixed and recorded as a low-salt control group, and after fermentation is carried out in a thermostatic chamber at 30 ℃ for 2 days, the saline is supplemented to 500 g. And setting a high-salt control group, adding 18% (M/M) saline, and keeping the other fermentation conditions consistent with those of the low-salt control group.

Culturing the strain ZB 432: ZB432 after activating one generation is transferred to YPD medium containing 15% (M/M) sodium chloride, and cultured for 3 days at 30 ℃, 210r/min and constant temperature in air shaking bed.

Backfilling strain ZB 432: the seed solution of ZB432 cultured for 3 days was mixed at a ratio of 10 ⁴ (level 1), 10 ⁵ (level 2) and 10 ⁶ (level 3) backfilling the inoculation amount of the CFU/g yeast material into sauce mash containing 15% (M/M) saline water at the 2 nd day of fermentation, adding 15% (M/M) saline water until the total weight is 500g (the total mass of the bacterial liquid accounts for the total mass of the saline water), and recording as a low-salt backfilling group (level 1), a low-salt backfilling group (level 2) and a low-salt backfilling group (level 3).

Sampling and counting the total number of colonies and the number of yeasts after fermenting for 15 days, 25 days and 60 days, filtering soy sauce mash after fermenting for 60 days to obtain crude oil, and measuring the physicochemical indexes such as total acid, ammonia nitrogen, total nitrogen and the like.

Total colony and yeast count method: shaking up the fermented soy sauce mash in a fermentation tank of a constant temperature room at 30 ℃, and taking 0.5-1mL to 15mL of centrifuge tube in a super clean bench for later use; the samples were diluted to a 10-1, 10-2, 10-3, 10-4 concentration gradient with sterile saline for inoculation. Coating the diluted samples on PDA and PCA plates (Kjeldahl biology) respectively, wherein each sample is in parallel with three samples; sucking 100 μ L of the diluted solution into a flat plate medium containing sterile glass beads, horizontally moving and shaking left and right to uniformly coat the bacterial solution on a flat plate, pouring out the glass beads, and culturing in an environment at 30 ℃. The total number of colonies is counted after the PCA culture medium is inoculated for about 16h, the yeast is counted after the PDA culture medium is inoculated and cultured for 2-3 days, the concentration gradient of the colony number between 30-300 is counted and selected, and the result is the average value of three parallels.

The results are shown in tables 3 and 4. The total number of colonies of the low-salt control group is higher than that of the high-salt control group, the total number of the colonies is in a descending trend after the ZB432 is added, and the inhibition effect on the total number of the colonies is more obvious along with the increase of the addition amount, so that the ZB432 has a certain inhibition effect on bacteria in a low-salt fermentation system. In addition, the total acid of the low-salt fermentation crude oil is obviously higher, and the total acid level of the backfill group gradually approaches the high-pressure control group along with the increase of the addition amount, which shows that ZB432 has a certain inhibiting effect on the spoilage bacteria of the low-salt fermentation system.

Table 3: microbial enumeration during fermentation of different groups

Table 4: comparison of physical and chemical indexes of crude oils of different groups

Sensory evaluation of soy sauce: filtering fermented soy sauce mash for 60 days to obtain crude oil, performing pasteurization, and scoring the soybean sauce by 10 appraisers with rich tissue experience from four aspects of color, aroma, body form and taste, wherein each term is 10 points, the weights are respectively 20%, 30%, 20% and 30%, and the final result is averaged.

The experimental results are as follows: the aroma, the taste and the like of the crude oil obtained by the low-salt control group are not ideal, the sensory quality is obviously lower than that of the high-salt control group, and after the strain ZB432 seed solution with different concentrations is added for backfilling, the total acid of the crude oil obtained by the low-salt backfilling group is obviously reduced, particularly the total acid is obviously reduced by the low-salt backfilling group (level 3). The fragrance and the taste of the crude oil obtained by the low-salt backfill group (level 3) and the low-salt control group are obviously improved, the comprehensive evaluation is also improved, and the ZB432 strain has larger application potential in low-salt fermentation.

Table 5: sensory evaluation results of different groups

The volatile flavor components of the crude oil of the low-salt control group and the low-salt backfill group (level 3) are analyzed by adopting an SPME-GC-MS mode, the analysis result is shown in Table 6, the flavor components of esters, alcohols, acids, aldehydes, ketones and the like of the crude oil added with the strain ZB432 are improved, particularly the alcohols are improved by more than 50%, the esters are improved by more than 20%, and the integral flavor of the crude oil is better, full and mellow.

Table 6: total peak area of flavor substances of crude oil of different groups

Therefore, the Candida albicans (Candida etchellsii) ZB432 can inhibit common contaminated bacillus in the soy sauce fermentation process in a low-salt environment, obviously improves the quality and flavor of crude oil from the aspects of color, aroma, posture and taste, and has wide application prospect.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> Haitian seasoned food GmbH in Foshan City

<120> Candida anglica ZB432 and application thereof

<130> 5.13

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 209

<212> DNA

<213> candida etchellsii

<400> 1

aggacttcgg atcttgcttg attgggggca taaaatatta ctgcacagag ttattaacgt 60

gtgctgttcc atttctttga ctccaataag gagcaacacc tcgtaatcca caagaagtag 120

attagagaga aagttcggcg ctccaacaag catgctacta ggagatccta gaagcgcaat 180

gtgcgttcaa agattcgatg attcacaaa 209

Claims

1. Candida antarctica strain (Candida etchellsii) ZB432, wherein Candida antarctica ZB432 is deposited in Guangdong province culture collection center with the deposit number GDMCC No: 61293.

2. candida erethii (C.erickii) as claimed in claim 1Candida etchellsii) Use of ZB432 for the preparation of reduced-salt and/or low-salt fermented soy sauce;

the concentration of sodium chloride in the reduced-salt and/or low-salt fermented soy sauce is 5-15%.

3. The use according to claim 2, characterized in that said Candida antarctica (C. antarctica), (C. antarctica) is administered in a medium containing a mixture of two or more different pharmaceutically acceptable carriersCandida etchellsii) ZB432 inhibiting Bacillus subtilis during soy sauce fermentationUse of bacterium 12-3.

4. A preparation method of salt-reduced and/or low-salt soy sauce is characterized by comprising the following steps:

i) inoculating candida albicans ZB432 as defined in claim 1 into the fermented mash;

ii) continuing fermenting the soy sauce mash obtained in i) for 60 days;

5. The method of claim 4, wherein the fermentation time of the fermented moromi of step i) is 2d to 25 d.

6. The process according to claim 4, wherein the Candida antarctica ZB432 inoculated in step i) has a bacterial suspension concentration of 10 ⁷ ~10 ⁹ CFU/mL。

7. The process according to claim 4, wherein the Candida antarctica ZB432 obtained in step i) is inoculated in an amount of 10 ⁴ 、10 ⁵ Or 10 ⁶ CFU/g yeast material.

8. The method of claim 4, wherein the fermented soy mash sodium chloride concentration in step i) is between 5% and 15%.

9. The method of claim 4, wherein the temperature of the moromi fermentation in steps i) and ii) is from 25 ℃ to 30 ℃.