CN116836824A

CN116836824A - Candida elseta Y19 and application thereof

Info

Publication number: CN116836824A
Application number: CN202310765895.7A
Authority: CN
Inventors: 杜木英; 黄璐晗; 阚建全; 胡伟中
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2023-06-27
Filing date: 2023-06-27
Publication date: 2023-10-03

Abstract

The invention discloses candida utilis Y19 with a preservation number of CGMCC No.26383, classified and named candida utilis (Candida etchellsii) and application of the candida utilis in preparation of fermented soybeans. The strain is separated from the traditional fermentation Mucor type Yongchuan fermented soybean, has excellent fermentation performance and can obviously shorten the fermentation time. The mucor fermented soybean prepared by mixed fermentation of the aroma-producing strain and bacillus has stronger aroma and pleasant flavor, and has the special aroma of the traditional fermented mucor fermented soybean. Compared with the non-fungus-added mucor fermented soybean and the fermented soybean fermented by pure strain of bacillus, the variety and content of the characteristic volatile flavor substances are obviously increased, the sensory evaluation is good, the product safety can be further improved, and the method has good popularization and application value in the field of food fermentation.

Description

Candida elseta Y19 and application thereof

Technical Field

The invention relates to the technical field of microorganisms and food fermentation, in particular to candida elvan Y19 and application thereof.

Background

Fermented soybean is a traditional fermented food prepared by taking soybeans or black beans as raw materials, soaking, steaming, culturing bacteria, making starter, mixing materials and fermenting, and has black brown or yellow brown color, delicious taste and strong aroma, can be taken as a seasoning or directly eaten, and is also called as four traditional fermented bean products in China together with soy sauce, fermented bean curd and bean paste. The variety of fermented soybeans is large, and it can be classified into aspergillus type fermented soybeans, mucor type fermented soybeans, bacterial type fermented soybeans and rhizopus type fermented soybeans according to the type of microorganism used. Under the action of microorganisms, protease, lipase, cellulase, amylase and the like are generated in the fermented soybean fermentation process, protein in soybean is hydrolyzed into micromolecular soluble protein, polypeptide and amino acid, fat is degraded into fatty acid, starch is hydrolyzed into sugar, and the substances interact with each other to gradually form the color, aroma and taste of the fermented soybean. In addition, fermented soybeans produce many active substances with important physiological functions in the fermentation process.

One of the special products of Yongchuan fermented soya beans. Chongqing is known for producing fermented soybeans, and is known as a county name of fermented soybeans. The traditional Yongchuan fermented soya beans are representative of Mucor type fermented soya beans, have the characteristics of rich soya bean fragrance, black and bright black, and the texture of dissolving residues in the mouth, and are widely popular with people in Chongqing areas. The traditional Mucor fermented soybean is naturally fermented by contacting with microorganisms in the air, is influenced by various factors such as environment, seasons and the like, has long fermentation period and is not beneficial to industrial production. Under the condition, the quick Yongchuan fermented soybean produced by the aspergillus starter propagation and low-salt high-temperature fermentation technology is produced, the post-fermentation time can be shortened to about 30 days, and the production efficiency is greatly improved. However, the pure fermentation mode shortens the fermentation period and simultaneously leads to the fragrance of fermented soybeans to be insufficient and the flavor to be inferior to that of the traditional fermented soybeans. Therefore, the addition of the aroma-enhancing saccharomycetes while shortening the fermentation period has practical significance for producing the mucor-type fermented soybeans with high product quality and good flavor.

Disclosure of Invention

Accordingly, one of the purposes of the present invention is to provide a strain of candida elvata (Candida etchellsii) Y19, which is preserved in the China general microbiological culture Collection center with the preservation number of CGMCC No.26383.

Still another object of the present invention is to provide a microbial agent, the active ingredient of which comprises the above candida elvan (Candida etchellsii) Y19; preferably, the microbial inoculum is a freeze-dried powder.

Still another object of the present invention is to provide the use of candida utilis (Candida etchellsii) Y19 as described above or the microbial inoculum as described above in the preparation of fermented soybeans.

In the technical scheme of the application, the fermented soybeans are mucor-type fermented soybeans, and preferably mucor-type quick fermented soybeans.

In the technical scheme, the mucor fermented soya beans are prepared by mixed fermentation of candida utilis Y19 and bacillus amyloliquefaciens.

In the technical scheme of the application, the application comprises the following steps:

1) Pretreatment of raw materials: soaking semen glycines in water until semen glycines fully absorbs water, and boiling;

2) Starter propagation: inoculating Mucor total strain culture into cooked soybean, and making yeast to obtain fermented soybean yeast;

3) Fermentation: adding a fermentation additive into the fermented soybean yeast, stirring uniformly to obtain a mixed material, inoculating a bacillus amyloliquefaciens culture at the weight of 1-2% of the mixed material, culturing for 9-11d at the temperature of 43-46 ℃, inoculating a candida epothilone Y19 culture at the weight of 1-2% of the mixed material, and culturing for 19-21d at the temperature of 28-31 ℃ to obtain the fermented soybean yeast.

In the technical scheme of the application, the inoculum size of the Mucor racemosus strain culture in the step 2) is calculated according to 0.3-0.5 weight percent of soybean, the temperature is kept at 23-27 ℃, and the starter propagation is carried out for about 3.5-4.5 days;

the fermentation additive in the step 3) comprises salt and white wine, and preferably comprises fermented glutinous rice.

At the upper partIn the technical scheme, the concentration of the bacillus amyloliquefaciens in the bacillus amyloliquefaciens culture is 2.5x10 ⁸ ～5×10 ⁸ cfu/g；

The preparation method of the bacillus amyloliquefaciens culture comprises the following steps: preparing a bacillus amyloliquefaciens culture medium, and inoculating bacillus amyloliquefaciens into the culture medium for shake culture for 18-24 hours at the temperature of 35-40 ℃ and at the speed of 150-180 r/min; the bacillus amyloliquefaciens culture medium is an LB liquid culture medium, or is prepared from raw material peptone, beef extract powder, naCl and water; preferably, the bacillus amyloliquefaciens culture medium is prepared by mixing 10g of peptone, 3g of beef extract powder, 5g of NaCl and 1000mL of water;

preferably, the bacillus amyloliquefaciens is B9, and the preservation number is CGMCC No.26384.

In the technical scheme of the application, the concentration of the candida angustifolia in the candida angustifolia culture is 0.5 multiplied by 10 ⁷ ～1.5×10 ⁷ cfu/g；

The preparation method of the candida utilis Y19 culture comprises the following steps: preparing a candida utilis culture medium, inoculating candida utilis Y19 strain into the culture medium, and culturing for 36-48h at 25-30 ℃; the candida utilis culture medium is YPD liquid culture medium.

In the technical scheme of the application, the step 3) is as follows: adding fermentation additive into the fermented soybean yeast, and stirring uniformly; inoculating 1-1.5 wt% of bacillus amyloliquefaciens culture, culturing at 44-46 deg.c for 9-11d, inoculating 1-1.5 wt% of candida elvata culture, and culturing at 29-31 deg.c for 19-21 d.

The invention uses candida utilis Y19 and bacillus amyloliquefaciens to mix and ferment mucor fermented soya beans: during the fermentation process, bacillus amyloliquefaciens secretes protease and amylase to accumulate premier substances for fermented soybean flavor generation; meanwhile, candida utilis Y19 is utilized for fermentation to generate fermented soybean aroma substances, so that volatile aroma substances are accumulated, and the overall aroma of the product is improved.

The invention adopts the Mucor fermented soybean prepared by mixed strain fermentation, the fermentation time of the Mucor fermented soybean is shortened to about 30d, and the amino acid nitrogen content in the fermented soybean is 0.83g/100g and the total ester content is 35.93mg/g through detection by a chemical method; the content of characteristic volatile substances in the fermented soybeans is obviously improved, the content of phenethyl alcohol is 283.36 mug/kg, the content of 1-nonanol is 32.41 mug/kg, the content of ethyl isovalerate is 66.66 mug/kg, the content of guaiacol is 450.41 mug/kg, the content of guaiacol is 94.27 mug/kg, the content of 2-octanone is 521.58 mug/kg, and the content of 2, 5-dimethyl pyrazine is 584.09 mug/kg through detection of a gas chromatography mass spectrometry method.

The invention has the beneficial effects that:

1) According to the invention, the candida epothilone Y19 with the fragrance and ester producing capacity is screened from the traditional fermented mucor epothilone fermented soybeans, so that the yeast strain resource library is enriched, the application of candida epothilone in the food field is widened, and a novel fermentation method is provided for the production of mucor epothilone fermented soybeans;

2) According to the invention, the mucor-type fermented soybeans are prepared by mixed fermentation of the candida utilis Y19 and the bacillus amyloliquefaciens, and the mixed fermentation of the mucor-type fermented soybeans is performed by adopting the candida utilis Y19, so that the fermentation time can be obviously shortened, various aroma substances are produced, the quality is excellent, and the production efficiency is greatly improved compared with that of the traditional fermented mucor-type fermented soybeans;

3) According to the invention, the mucor-type fermented soybeans are prepared by fermenting mixed strains, and the bacillus amyloliquefaciens is used for strengthening fermentation, so that compared with the traditional fermented mucor-type fermented soybeans, the fermentation period is shortened, the safety of the product is ensured, the fermentation success rate is improved, the probability of pollution of the product is reduced, the quality of the product is obviously improved and improved, and the requirements of the market on the quality of the mucor-type fermented soybeans can be met;

4) The prepared Mucor type fermented soybean has dark brown color, bright and glossy color, rich fermented soybean fragrance, good flavor, delicious taste, no bitter taste, mildewing taste or other peculiar smell, palatable salty taste, granular grains, softness and no hard core, proper ester fragrance and mellow fragrance peculiar to Mucor type fermented soybean, rich fragrance, and popularization and application value in the technical field of food fermentation.

Drawings

FIG. 1 is a cell morphology of the Y19 strain of Candida utilis of the present invention.

FIG. 2 is a phylogenetic tree of the Y19 strain of Candida utilis of the invention.

FIG. 3 is a diagram showing the morphology of Bacillus amyloliquefaciens B9 strain and the result of gram-color staining in example 2 of the present invention.

FIG. 4 is a diagram of a product of the mixed fermented soybean of Mucor type in example 3, wherein M1-is not inoculated from the fermented soybean; m2-bacillus amyloliquefaciens pure post-fermentation fermented soybean; and (3) fermenting fermented soybeans after mixed inoculation of M3-bacillus amyloliquefaciens and candida utilis.

FIG. 5 is the fermentation characteristics of yeast: a-yeast optimal growth salt concentration curve; b-yeast optimal growth pH curve; C-Yeast optimal growth temperature curve.

FIG. 6 shows the amino acid nitrogen content and total ester content of fermented soybean samples of different fermentation modes, wherein M1-is not inoculated from fermented soybean; m2-bacillus amyloliquefaciens pure post-fermentation fermented soybean; and (3) fermenting fermented soybeans after mixed inoculation of M3-bacillus amyloliquefaciens and candida utilis.

FIG. 7 is a diagram of a sensory evaluation radar of fermented soybean samples of different fermentation modes, wherein M1-is not inoculated from then fermented soybean; m2-bacillus amyloliquefaciens pure post-fermentation fermented soybean; and (3) fermenting fermented soybeans after mixed inoculation of M3-bacillus amyloliquefaciens and candida utilis.

Detailed Description

The present invention will be described in detail below with reference to the attached drawings, it being understood that the preferred embodiments are only for illustrating the present invention, and not for limiting the scope of the present invention.

Example 1

1. Separation and purification of aroma-producing saccharomycetes

Collecting 12 samples of semen Sojae Preparatum, soy sauce, and bean paste from traditional fermented food enterprises such as Chongqing City Yongchuan semen Sojae Preparatum Limited company, chongqing yellow garden soy sauce factory, pi county bean paste factory, etc., taking appropriate amount of sample, and placing into preparationIn YPD liquid medium of (C), and enrichment culturing at 30deg.C for 24 hr to obtain bacterial suspension. And (3) dilution coating: adding 1mL of the bacterial suspension into a 9mL sterile physiological saline test tube, sufficiently shaking, transferring 1mL of the diluent into another 9mL sterile physiological saline test tube, sufficiently shaking, and sequentially diluting to 10 ^-2 ～10 ^-8 Multiple of 10 times ^-4 、10 ^-5 、10 ^-6 Dilutions of 100 μl each were spread evenly on prepared WL nutrient agar solid plates, 3 replicates for each treatment, and three blank controls were set. The coated WL nutrient agar culture medium plate is placed in a constant temperature incubator at 30 ℃ for culturing for 24 hours, bacterial colonies of suspected saccharomycetes are selected for microscopic examination, bacterial strains conforming to the morphological description of the saccharomycetes are inoculated in the WL nutrient agar culture medium, the temperature is kept at 30 ℃ for culturing for 3 days, different saccharomycetes bacterial colonies are selected according to the color change condition of the WL culture medium, the culture is carried out for 48 hours at 30 ℃, and the transfer is carried out for 2-3 times by a plate streaking method until single bacterial colonies are obtained and are numbered in 20% glycerol for standby at-80 ℃.

8 strains of yeast are obtained from the sample through repeated plate separation and fluorescence forward microscopy by combining with the color change of the WL screening culture medium, and the bacterial colonies with the numbers of Y4, Y8, Y10, Y11, Y13, Y19, Y21, Y30, Y8 and Y13 are milky white, large, thick and opaque, have exquisite striations on the surface and swell in the middle. The colony of Y10, Y11, Y21 and Y30 is milky white, large, thick, opaque and smooth in surface, and the colony is round to the central bulge and flat in periphery. The colony of Y4 and Y19 is milky white, has smooth surface, round raised colony and flat periphery into hat edge shape. The cell morphology of the Y19 strain is shown in FIG. 1, and the cells of the Y19 strain are rod-shaped as can be seen from the analysis of FIG. 1.

2. Primary screening of aroma-producing saccharomycetes

2ml of a separated and purified yeast liquid (10) ⁷ cfu/mL) was inoculated into 100mL YPD liquid medium, inoculated without bacteria as a blank, placed in a constant temperature incubator at 30℃and cultured with shaking at 150r/min for 48h. Sensory evaluation is carried out on the fermentation liquor by adopting a sniffing method, and bacterial strains Y4, Y11 and Y30 with weak aroma producing capability and peculiar smell producing capability are abandoned.

3. Fermentation characteristics of Yeast

(1) Drawing optimal growth temperature curve

Inoculating the selected saccharomycetes into YPD liquid culture medium according to 1% (V/V) inoculum size, standing and culturing at 25 ℃,30 ℃, 35 ℃, 40 ℃ and 45 ℃ for 48 hours respectively, simultaneously performing 3 parallel experiments, taking the liquid culture medium without bacterial liquid as a blank control, measuring an OD600 nm value of the culture liquid, taking an average value as a final result, taking a culture temperature as an abscissa (x) and an OD600 nm value as an ordinate (y), and drawing a curve.

(2) Drawing optimal growth pH curve

YPD liquid culture mediums with pH values of 2.0, 3.0, 4.0, 5.0, 6.0 and natural pH are respectively prepared, 5mL of the culture medium is taken and put in a test tube, and after sterilization, saccharomycetes are inoculated into the YPD liquid culture mediums with different pH values according to an inoculum size of 1% (V/V) at 30 ℃ and are subjected to static culture for 48 hours. Then, the OD600 nm value is measured by an enzyme labeling method, a liquid culture medium without bacterial liquid is used as a blank control, the OD600 nm value of the culture liquid is measured and then is averaged to be used as a final result, and then, the pH abscissa (x) and the OD600 nm value are used as the ordinate (y) to draw a curve.

(3) Drawing optimal growth salt concentration curve

YPD liquid culture mediums containing different mass fractions (0%, 6%,8%,10%,12% and 15%) of NaCl are respectively prepared, 5mL of the culture medium is taken and put into a test tube, and yeast is inoculated into the YPD liquid culture mediums with different NaCl concentrations according to the inoculum size of 1% (V/V) after sterilization and is subjected to static culture at 30 ℃ for 48 hours. Then, the OD600 nm value is measured by an enzyme labeling method, a liquid culture medium without bacterial liquid is used as a blank control, the OD600 nm value of the culture liquid is measured and then is averaged to be used as a final result, and then, the NaCl concentration is used as an abscissa (x) and the OD600 nm value is used as an ordinate (y), so that a curve is drawn.

As can be seen from the analysis of FIG. 5, the remaining 4 aroma-producing yeasts, except the Y13 strain, can grow well under the condition of 10% salt concentration and can grow at 25-45 ℃. The optimal growth temperature of the other yeasts except for the yeast Y8 was 25℃and the optimal growth temperature of the other yeasts was 30 ℃.

4. Compound sieve for producing aroma yeasts

The total ester content was determined by reflux saponification. The results of the ester production are shown in Table 1, the strain Y19 with the highest total ester content reaches 31.13mg/g, the aroma is strongest, and various aroma characteristics are presented. Therefore, the saccharomycete Y19 is selected for subsequent test.

Table 1 screening strains for ester production and aroma evaluation

Note that: "-" indicates that the content is extremely low or undetected.

5. Identification of strains

The selected saccharomycetes are streaked and inoculated on YPD culture medium, and cultured for 36 hours at 28 ℃ to observe bacterial colony morphology. Bacterial strain DNA was extracted with T5Direct PCR Kit and amplified by PCR with 16S rDNA. Specific methods refer to the instructions for the kit. PCR primer: fungal universal primers ITS1 and ITS4. And (3) PCR amplification: in a 25.0. Mu.L polymerase chain reaction (polymerase chain reaction, PCR) system, 1.0. Mu.L each of the 10. Mu.M upstream and downstream primers, 12.5. Mu.L of 2×T5Direct PCR Mix, 1.0. Mu.L of bacterial DNA, ddH were added ₂ O9.5. Mu.L. PCR reaction conditions: pre-denaturation at 94℃for 5min, denaturation at 98℃for 10s, annealing at 57℃for 30s, extension at 72℃for 40s,34 cycles, and extension at 72℃for 5min. The PCR amplified product was sent to Beijing qingke biosciences, inc. for sequencing. The results of the candida elsev Y19 sequencing are as follows (SEQ ID No. 1):

ATTTTTTGAGGCTACCGAACGAATTGTGAACGCCAGAAGCGCGCAAGCGTGGAAGGCACTGCTTGGGTGGAGCCTAGCTCTACCCAACTTTTAAACTTTTACCAATTTATCTGAAAACTTGAAAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCACATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTGCGCTTCTAGGATCTCCTAGTAGCATGCTTGTTGGAGCGCCGAACTTTCTCTCTAATCTACTTCTTGTGGATTACGAGGTGTTGCTCCTTATTGGAGTCAAAGAAATGGAACAGCACACGTTAATAACTCTGTGCAGTAATATTTTTTATGGCCCCCAATCAAGCAAGATTACCCGCCGAACTTAAGCATATCAATAAGCGGAGGAA。

the sequencing results were entered into the national center for biological information technology (National Center of Biotechnology Information, NCBI) database for BLAST alignment and phylogenetic tree was constructed with MEGA software (FIG. 2), and Y19 was finally determined to be Candida utilis (Candida etchellsii).

The obtained candida elvan (Candida etchellsii) Y19 is sent to China general microbiological culture collection center (CGMCC) for preservation, and the preservation unit address is: the institute of microbiology, national academy of sciences, north chen xi lu 1, 3, the region of the morning sun in beijing; preservation date: 2023, 1, 03; preservation number: CGMCC No.26383; classification naming: candida elsedge Candida etchellsii.

Example 2

1. Screening of bacillus

12 samples of fermented soybeans, soy sauce, bean paste and the like are collected from traditional fermented food enterprises such as Chongqing city Yongchuan fermented soybean limited company, chongqing yellow garden soy sauce factory, pi county bean paste factory and the like, a proper amount of samples are taken and placed in a prepared LB liquid medium, and enrichment culture is carried out for 24 hours at 37 ℃ to prepare bacterial suspension. And (3) dilution coating: adding 1mL of the bacterial suspension into a 9mL sterile physiological saline test tube, sufficiently shaking, transferring 1mL of the diluent into another 9mL sterile physiological saline test tube, sufficiently shaking, and sequentially diluting to 10 ^-2 ～10 ^-8 Multiple of 10 times ^-4 、10 ^-5 、10 ^-6 Dilutions of 100 μl each were applied uniformly to the prepared sodium carboxymethylcellulose solid plates, 3 replicates were made for each treatment, and three blank controls were set. The coated sodium carboxymethylcellulose solid plate is placed in a temperature of 37 ℃ for culturing for 24 hours in an inverted mode, and colony growth is observed. Selecting strains with different colony morphologies, purifying for 3 times, and storing the purified strains in 20% glycerol at-80 ℃ for later use. 2 strains of Bacillus were isolated in total. In LB solid medium, the colony was observed to be pale yellow, opaque, rough, raised, and irregular in edge. Wherein the form of the bacillus with the number of B9 is shown in figure 3, and the bacillus is a gram positive bacterium and the colony form is in a rod shape through gram staining microscopic examination. Sequencing B9, and inputting the obtained strain 16S rDNA sequence (SEQ ID NO. 2) into the national bioinformatics technologyBLAST alignment was performed in the center (National Center of Biotechnology Information, NCBI) database and phylogenetic trees were constructed with MEGA software, with the final determination that B9 was bacillus amyloliquefaciens (Bacillus amyloliquefaciens).

Through detection, the bacillus amyloliquefaciens B9 can resist high-concentration salt, and the OD600 value in 12wt% of NaCl is 0.19; and can grow at a high temperature of 45-50 ℃, the D600 value is 0.16-0.19, and the optimal growth pH value is 5.

The obtained bacillus amyloliquefaciens (Bacillus amyloliquefaciens) B9 is sent to China general microbiological culture collection center (CGMCC) for preservation, and the preservation unit address is: the institute of microbiology, national academy of sciences, north chen xi lu 1, 3, the region of the morning sun in beijing; preservation date: 2023, 1, 03; preservation number: cgmccno.26384; classification naming: bacillus amyloliquefaciens Bacillus amyloliquefaciens.

2. B9 activation of Bacillus amyloliquefaciens

The 5mLLB liquid culture is sucked, sterilized in a bacteria liquid tube at 121 ℃ for 15min, and cooled to room temperature. 0.5mL of the glycerol-deposited B9 Bacillus amyloliquefaciens was removed from the sterile bench and cultured in 5mL of LB liquid medium at 37℃for 24 hours. And transferring to LB plate culture medium in streaking mode, horizontally placing for more than half an hour, and adsorbing bacteria on the culture medium. Sealing the culture dish with fresh-keeping film or sealing film, and culturing in an incubator at 37deg.C for 24 hr. The transfer was again performed in streaked fashion until a single colony was obtained.

3. B9 culture of Bacillus amyloliquefaciens seed bacteria

B9, culturing bacillus amyloliquefaciens seed bacteria: single colonies of the plate medium were picked up with a sterilized inoculating loop in an ultra clean bench, transferred into 5mL LB liquid medium, and cultured in an incubator at 37℃for 24 hours as primary seeds. Transferring 2mL of the primary seeds, adding into 50mL of LB liquid medium, culturing in an incubator at 37 ℃ for 24 hours, and adjusting the concentration to 1.00MCF (about 3×10) with a bacterial turbidimeter ⁸ cfu) as secondary seeds.

4. Activation of Y19A-cut candida

30mL of YPD liquid culture was pipetted into a 100mL centrifuge tube, sterilized at 121℃for 15min, cooled to room temperature, and 0.5mL of the glycerol-deposited Y19 yeast was removed in a sterile bench to 30mL of YPD liquid culture medium, and cultured at a constant temperature of 30℃and 180rpm/min for 48h under shaking. The strain is transferred to YPD plate culture medium in a streaking mode, and is horizontally placed for more than half an hour, and the strain is adsorbed on the culture medium. Culturing at 30℃for 48h. And transferring for 2-3 times in a streaking mode until a single colony is obtained.

5. Culture of Y19A candida utilis seed

Single colonies of the plate medium were picked up with an inoculating loop, transferred into 10ml YPD liquid medium, and cultured with shaking at a constant temperature of 30℃and 180rpm/min for 48 hours as primary seeds. Removing 2ml of primary seeds, adding into 30ml of YPD liquid culture medium, culturing under the same conditions for 48 hr, counting with a blood cell counting plate, and adjusting concentration to 10 ⁷ cfu as secondary seed.

Example 3

1. The preparation method for preparing mucor-type fermented soybeans by mixing and fermenting candida elvata Y19 obtained in the example 1 and bacillus amyloliquefaciens B9 obtained in the example 2 comprises the following steps:

1) Preparing a Mucor pulmonale seed culture solution: mixing potato extract 100mL, glucose 2g, and agar 1.5g, sterilizing at 121deg.C for 20min, preparing test tube slant, and cooling to room temperature. Inoculating 1 ring of Mucor pulmonale (commercially available conventional Mucor pulmonale, inoculating with conventional inoculating loop), and standing at 25deg.C for 5d to obtain Mucor pulmonale spores. Selecting a test tube inclined plane with good bacterial growth, adding sterile water into the test tube, and gently shaking to wash spores on the surface of the culture medium to form a suspension. 10g of bran and 10g of water are mixed, sterilized for 20min at 121 ℃, and cooled to room temperature to prepare a bran culture medium. The prepared total mucor spore suspension is mixed with bran culture medium uniformly, and cultured for about 3d in a constant temperature box at 25 ℃, and in order to prevent the culture medium from caking, the bottle is buckled for 1 time every 5-6 h. Adding sterile water and sterilized glass beads after culturing, slowly shaking, washing spores to obtain enriched spore suspension, filtering out large particles such as testa Tritici with sterilized gauze, counting, and adjusting concentration to 10 ⁷ The spores/mL is obtainedMucor tie seed culture solution.

2) Pretreatment of raw materials: the soybeans which are fully ripe, full and even in grain, thin in skin, more in meat, free of insect erosion and mildew and rot are selected, soaked for 12 hours to absorb certain moisture, steamed for 20 minutes under the condition of 0.14MPa, and cooled to room temperature. Inoculating 4mL of Mucor total strain culture solution into 1kg of soybean, maintaining room temperature at 25deg.C, and making yeast for about 4 d.

3) Mixing: according to the weight of the yeast blank, 1kg of yeast material is mixed with 30mL of white spirit, 30g of fermented glutinous rice, 100g of salt and a proper amount of sterile water, and the mixture is stirred uniformly.

4) Preparation of bacillus amyloliquefaciens culture: 5g of peptone, 1.5g of beef extract powder, 2.5g of NaCl and 500mL of water, mixing homogenate, sterilizing for 20min at 121 ℃, cooling to room temperature, inoculating 1-loop inclined plane bacillus amyloliquefaciens strain (inoculated by a conventional inoculating loop), and culturing for 24h in a shaking incubator at the constant temperature of 37 ℃ and 150r/min to obtain the bacillus amyloliquefaciens culture. The Bacillus amyloliquefaciens culture was adjusted with a bacterial turbidity meter so that the concentration of Bacillus amyloliquefaciens was 3X 10 ⁸ cfu/g, B9 B.amyloliquefaciens secondary seed solution in example 2.

5) Preparation of candida utilis Y19 cultures: 5g of yeast extract, 10g of peptone, 10g of glucose and 500mL of water are mixed, sterilized at 121 ℃ for 20min, and cooled to room temperature. Inoculating 1-loop inclined plane candida utilis Y19 strain (inoculating with a conventional inoculating loop), and standing at 30 ℃ for culturing for 48 hours to obtain candida utilis Y19 culture. The culture of Candida utilis Y19 was adjusted by microscopic counting so that the concentration of Candida utilis Y19 was 1X 10 ⁷ cfu/g, the Y19 A.angustifolia secondary seed solution in example 2.

6) Post-fermentation: the mixture from step 3) was divided into three portions of 400g each, designated M1, M2, M3. Adding 8g of sterile water into M1, fermenting at 45 ℃ for 10d, and fermenting at 30 ℃ for 20d; adding 8g of bacillus amyloliquefaciens B9 culture into M2, fermenting at 45 ℃ for 10d, and fermenting at 30 ℃ for 20d; to M3, 4g of Bacillus amyloliquefaciens B9 culture was added, and after fermentation at 45℃for 10d, 4g of Candida utilis Y19 culture was added, and fermentation at 30℃for 20d. Fermented soybeans are shown in figure 4.

2. Fermented soybean sample analysis of different strain combinations

(1) Analysis of amino acid nitrogen content

The specific operation is as follows: and (3) uniformly stirring the fermented soybean sample, putting the fermented soybean sample into a mortar, rapidly grinding the fermented soybean sample within 10min until no macroscopic particles exist, and putting the fermented soybean sample into a grinding bottle for standby. 5.0g of a uniformly stirred sample is weighed by a weighing bottle with known weight, washed into a 100mL beaker for several times by 50mL distilled water at about 80 ℃, cooled, transferred into a 100mL volumetric flask, washed into the beaker for several times by a small amount of water, and the washing solution is mixed into the volumetric flask, added with water to a scale, uniformly mixed and filtered. 10.0mL of filtrate is sucked, placed in a 200mL beaker, 60mL of water is added, a magnetic stirrer is started, and sodium hydroxide standard solution [ c (NaOH) =0.050 mol/L ] is used for titration until the pH value indicated by an acidometer is 8.2, and the milliliters of the sodium hydroxide standard titration solution consumed are recorded, so that the total acid content can be calculated. 10.0mL of formaldehyde solution was added and mixed well. The titration was continued with a standard titration solution of sodium hydroxide to a pH of 9.2, and the ml of the standard titration solution of sodium hydroxide consumed was counted. Meanwhile, 80mL of water is taken, the pH is adjusted to 8.2 by using a sodium hydroxide standard solution [ c (NaOH) =0.050 mol/L ], then 10.0mL of formaldehyde solution is added, and the pH is titrated to 9.2 by using a sodium hydroxide standard titration solution, so as to carry out a reagent blank test.

The amino acid nitrogen content of the sample is calculated as follows:

wherein: x is the content of amino acid nitrogen in the sample, and the unit is gram per hundred grams (g/100 g);

v1-the volume of the sodium hydroxide standard titration solution is consumed after formaldehyde is added into the sample diluent for measurement, and the unit is milliliter (mL);

v0-the volume of sodium hydroxide standard titration solution is consumed after formaldehyde is added in reagent blank experiments, and the unit is milliliter (mL);

c-concentration of sodium hydroxide standard titration solution in moles per liter (mol/L);

0.014—the mass of nitrogen equivalent to 1.00mL of sodium hydroxide standard titration solution [ c (NaOH) =1.000 mol/L ] in grams (g);

m-weighing the mass of the sample in grams (g);

v3-sample dilution in milliliters (mL);

v4-the constant volume of the sample diluent in milliliters (mL);

100-unit conversion factor.

(2) Analysis of total ester content

The specific operation is as follows: accurately weighing 2.00g of fermented soybean sample, adding 60mL of pure water, homogenizing, and titrating to pH 8.2 with 0.1mol/L NaoH standard solution. Transferring the titrated fermented soybean sample into a round bottom flask, accurately adding 25mL of 0.1mol/L NaoH standard solution, connecting a condensing reflux pipe, refluxing and saponifying in boiling water for 0.5h (counting from the first drop of liquid after boiling), taking down and cooling to room temperature, quantitatively transferring into a 250mL beaker, immediately titrating to pH9.20 with 0.1mol/L H2SO4 standard solution, recording the dosage of the standard solution, and thus calculating the total ester content in the sample.

Wherein, the mass concentration of the X-total ester is calculated by ethyl acetate, mg/g;

c-sulfuric acid concentration, mol/L;

v0-blank consumed sulfuric acid volume, mL;

v1-sample consumed sulfuric acid volume, mL;

88-ethyl acetate mole number, g/mol;

m-sample mass, g.

The determination results of the amino acid nitrogen and the total ester content are shown in figure 6, the amino acid nitrogen content in the mixed fermented soybeans is 0.83g/100g, and the total ester content is 35.93mg/g, which is respectively improved by 0.42g/100g, 0.18g/100g compared with the non-added fermented soybeans and the pure fermented soybeans.

(3) Sensory evaluation analysis

The specific operation is as follows: the group was rated by 10 (5 men, 5 women) food professional study groups according to the fermented soybean sensory rating table of table 2. And the food with strong irritation such as no smoking and drinking is in the first 60 minutes of assessment. The appropriate soda biscuits were eaten between the two samples and rinsed with clear water for 5min intervals.

TABLE 2 organoleptic evaluation criteria for fermented soybeans

As can be seen from the sensory evaluation results, the sensory evaluation radar chart of the fermented soybean samples with different fermentation modes is shown in fig. 7, and the mucor-type fermented soybean prepared by mixed fermentation is bright and glossy, has dark brown color, strong fermented soybean fragrance, good flavor, stronger delicate flavor, palatable salty taste and moderate hardness.

(4) SPME-GC-MS analysis

The specific operation is as follows: accurately weighing 5g fermented soybean sample into 20mL headspace bottle, adding 5mL 0.1g/mL NaCl solution and 10 μL 2-octanol (100 mg/L), and sealing with polytetrafluoroethylene heat insulation pad. Heating in constant temperature water bath, balancing at 60deg.C for 15min, vertically inserting extraction head into headspace bottle with solid phase microextraction device, pushing out extraction needle, and extracting at constant temperature for 30min. After extraction was completed, the extraction head was inserted into the GC inlet and resolved at 250 ℃ for 5min for data acquisition.

GC conditions: DB-5MS capillary column (30 m x 0.25mm x 0.25 μm); heating program: the initial temperature of the column temperature box is 40 ℃, the column temperature box is kept for 5min, the temperature is increased to 100 ℃ at 5 ℃/min, the temperature is kept for 5min, the temperature is increased to 180 ℃ at 8 ℃/min, the temperature is kept for 5min, and finally the temperature is increased to 250 ℃ at 10 ℃/min, and the temperature is kept for 2min; column flow 1mL/min; the temperature of the sample inlet is 250 ℃; and the sample injection is not split.

MS conditions: electron bombardment (EI) ion source, electron energy 70eV; the interface temperature is 250 ℃; the temperature of the ion source is 250 ℃; delaying the solvent for 3min; the mass scanning range is 40-400 m/z. And (3) adopting NIST17-1 spectrum library to search, wherein the similarity is more than 80%, and carrying out qualitative and internal standard quantitative analysis by combining the retention index. The results are shown in Table 3.

TABLE 3 analysis results of volatile substances in fermented soybeans by combination fermentation of different strains

/>

Note that: nd represents undetected; m1-non-inoculated and then fermented soybean; m2-bacillus amyloliquefaciens pure post-fermentation fermented soybean; and (3) fermenting fermented soybeans after mixed inoculation of M3-bacillus amyloliquefaciens and candida utilis.

As shown in table 3, 81 volatile compounds were detected in total in the 3 groups of samples, which mainly included 23 alcohols, 19 esters, 9 acids, 14 aldehydes, 4 phenols, 9 ketones, 1 pyrazine, and 2 other compounds. M1 contains 44 volatile compounds, M2 contains 49 volatile compounds, and M3 contains 57 volatile compounds.

The alcohol substances mainly originate from fermentation metabolism of microorganisms on sugar and amino acid, and 5 common alcohol substances in 3 kinds of salted chilli are contained, wherein the content of ethanol and isoamyl alcohol is the highest, so that the fermented soya beans have bouquet, fruit aroma and flower aroma. The phenethyl alcohol with the highest content in the M3 mixed bacteria fermented black beans endows the black beans with rose fragrance. The esters mainly give fruit fragrance, and 19 esters are detected in 3 fermented soybeans, wherein ethyl 2-methylbutyrate, ethyl phenylacetate, ethyl isovalerate, ethyl tridecanoate and ethyl palmitate are detected together to give fragrance to fermented soybeans such as fruits, honey and cream.

The acid substances are extremely volatile and usually have pungent smell, and play a role in harmonizing the flavor of fermented soybeans. Acetic acid and 3-methylpentanoic acid are the highest two acids, the former being metabolic byproducts resulting from anaerobic fermentation during fermentation. The aldehydes are mainly derived from oxidative degradation of fat, bring nut and sweet fragrance to fermented soybeans, and have a non-negligible effect on the flavor composition of the fermented soybeans although the content of the aldehydes in the volatile compound composition of the fermented soybeans is not particularly high. Benzaldehyde is a substance common to 3 fermented soybeans, imparting a taste to fermented soybean nuts and almonds. The ketone compounds have stable property and lasting fragrance, the content of the ketone compounds in the 3 types of fermented soybeans is 255.37 mug/kg, 61.43 mug/kg and 561.67 mug/kg respectively, wherein the highest content is 2-octanone, and the content of the ketone compounds in M3 reaches 521.58 mug/kg, so that the fermented soybeans are endowed with mushroom flavor and yeast fragrance.

Phenols and pyrazines are very important compounds in fermented bean products. Phenolic compounds are typically produced by thermal degradation of phenolic acids associated with lignin. The guaiacol and the guaiacol have the highest detection content in the vinyl, and are detected in 3 samples, so that the content in the M3 mixed bacteria fermented soybeans is obviously improved, and the fermented soybeans are endowed with various flavors. 2, 5-dimethylpyrazine, which was co-detected in 3 fermented soybeans, imparted a fermented soybean chocolate and cream flavor, and the content in M3 reached 584.09. Mu.g/kg.

(5) Characteristic aroma component analysis

Fermented soybean aroma is composed of multiple volatile components, and only the concentration of the components is larger than the threshold value of the components. The aroma activity value (odor activity value, OAV) is the ratio of the compound concentration to the olfactory threshold of the substance, so when OAV >1 for a volatile substance, the component is considered to be a characteristic aroma component of fermented soybeans, and the greater the OAV, the greater the contribution to the fermented soybean overall flavor. The test results are shown in Table 4.

TABLE 4 OAV values of the main ingredient in fermented soybeans fermented by combination of different strains

From the analysis in table 4, it was found that isoamyl alcohol, 1-octen-3-ol, ethyl 2-methylbutanoate, ethyl isovalerate, guaiacol, p-vinylguaiacol, OAV >1 of 2, 5-dimethylpyrazine, provides characteristic aroma common to 3 groups of fermented soybeans, and provides the fermented soybeans with fruit aroma, floral aroma and nut aroma. 2-phenylcrotonaldehyde was detected only in the control group, and had the fragrance of mould, floral, sweet and black tea. The 3-methyl ethyl valerate is a unique characteristic aroma component in M3, and the OAV is more than 1000, so that the fermented soya beans are endowed with strong fruit aroma. In addition, 2-methyl-1-butanol (sweet, fragrant and malt aroma), isovaleraldehyde (fruit aroma) and 4-ethyl guaiacol (spice and herbal aroma) with OAV >1 were also detected in M3, which improved the richness of fermented soybean aroma.

According to the embodiment, the invention provides the candida utilis Y19 separated from the traditional fermented Mucor pulmonale, and the candida utilis Y19 and the bacillus amyloliquefaciens are subjected to mixed fermentation, so that the amino acid nitrogen content of the prepared Mucor pulmonale reaches 0.83g/100g, the product is black and glossy in color, rich in black beans and fragrant in flavor, and the flavor is coordinated.

Claims

1. Candida elvata (Candida etchellsii) Y19 is preserved in the China general microbiological culture collection center with the preservation number of CGMCC No.26383.

2. A microbial agent comprising the candida utilis (Candida etchellsii) Y19 of claim 1 as an active ingredient; preferably, the microbial inoculum is a freeze-dried powder.

3. Use of candida utilis (Candida etchellsii) Y19 as claimed in claim 1 or a microbial inoculum as claimed in claim 2 in the preparation of fermented soya beans.

4. A use according to claim 3, characterized in that: the fermented soya beans are mucor-type fermented soya beans, preferably mucor-type quick fermented soya beans.

5. The use according to claim 4, characterized in that: the mucor-containing fermented soya beans are prepared by mixed fermentation of candida utilis Y19 and bacillus amyloliquefaciens.

6. The use according to claim 5, characterized in that the use comprises the steps of:

7. The use according to claim 6, characterized in that: the inoculum size of the Mucor pulmonale strain culture in the step 2) is calculated according to 0.3 to 0.5 weight percent of soybean, the temperature is kept at 23 to 27 ℃, and the starter propagation is carried out for about 3.5 to 4.5 days;

8. The use according to claim 6, characterized in that: the concentration of Bacillus amyloliquefaciens in the Bacillus amyloliquefaciens culture was 2.5X10 ⁸ ～5×10 ⁸ cfu/g；

9. The use according to claim 6, characterized in that: the concentration of the candida angustifolia in the candida angustifolia culture is 0.5 multiplied by 10 ⁷ ～1.5×10 ⁷ cfu/g；

10. The use according to claim 6, characterized in that: the step 3) is as follows: adding fermentation additive into the fermented soybean yeast, and stirring uniformly; inoculating 1-1.5 wt% of bacillus amyloliquefaciens culture, culturing at 44-46 deg.c for 9-11d, inoculating 1-1.5 wt% of candida elvata culture, and culturing at 29-31 deg.c for 19-21 d.