CN113186192B - CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell - Google Patents

CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell Download PDF

Info

Publication number
CN113186192B
CN113186192B CN202110487575.0A CN202110487575A CN113186192B CN 113186192 B CN113186192 B CN 113186192B CN 202110487575 A CN202110487575 A CN 202110487575A CN 113186192 B CN113186192 B CN 113186192B
Authority
CN
China
Prior art keywords
crybb2
gene
mutant
nucleic acid
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110487575.0A
Other languages
Chinese (zh)
Other versions
CN113186192A (en
Inventor
丰岱荣
张亚宁
李金云
刘慧泽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Weifang Medical University
Original Assignee
Weifang Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Weifang Medical University filed Critical Weifang Medical University
Priority to CN202110487575.0A priority Critical patent/CN113186192B/en
Publication of CN113186192A publication Critical patent/CN113186192A/en
Application granted granted Critical
Publication of CN113186192B publication Critical patent/CN113186192B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention belongs to the technical field of biological genetic engineering, and discloses a CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell, wherein the nucleic acid of the CRYBB2 gene mutant is 223 th nucleotide of exon 4, and G-A mutation exists; the polypeptide has p.E75K mutation and is obtained by encoding the nucleic acid encoding the CRYBB2 mutant; the kit for screening biological samples susceptible to congenital cataract comprises a reagent for specifically detecting CRYBB2 gene mutant p.E75K; the nucleic acid construct contains CRYBB2 gene p.E75K mutant; the recombinant cell is obtained by transfecting a receptor cell with the nucleic acid construct containing the CRYBB2 gene p.E75K mutant. The invention can be used for auxiliary diagnosis of congenital cataract, is used for finding potential carriers of hereditary cataract, and provides basis for prenatal gene diagnosis of the disease.

Description

CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell
Technical Field
The invention belongs to the technical field of biological genetic engineering, and particularly relates to a CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell.
Background
At present, congenital cataract is a serious blinding lens disease, which is a disease with reduced transparency due to abnormal metabolism of the crystalline lens in embryonic stage, and is mainly manifested by white pupil disease occurring in infant stage. Clinically congenital cataracts can manifest as crystalline opacification of various shapes such as nuclear, anterior and posterior. White pupil is the most common congenital cataract manifestation in newborns, and incomplete cataract is often diagnosed by abnormal vision, strabismus, nystagmus and the like. The incidence rate of the disease is about 0.01 to 0.06 percent, which accounts for the second position of blindness caused by children. Genetic, metabolic, traumatic, and infectious factors can all cause cataracts in children. Among these causes, hereditary cataracts account for 22.3% of global childhood cataracts, the most common genetic approach being autosomal dominant inheritance.
CRYBB2 is taken as one of pathogenic genes for causing congenital cataract, the pathogenic mutation is rare, so far, 32 pathogenic mutations are found at home and abroad, missense mutation and nonsense mutation caused by point mutation are mainly used, and nearly 90% of the mutations are positioned in 5 th and 6 th exons of the CRYBB2 gene, so that the stability of CRYBB2 coded protein products is affected.
A congenital cataract family is taken as a research object, and a novel heterozygous pathogenic mutation in the CRYBB2 gene is identified by using the whole exome sequencing, sanger sequencing and restriction enzyme fragment length polymorphism technology, wherein the coding nucleotide at 223 th position of the No. 4 exon is provided with G-A mutation. There is no international report on congenital cataract caused by mutation of the CRYBB2 gene E75K.
Through the above analysis, the problems and defects existing in the prior art are as follows: at present, no report of congenital cataract caused by CRYBB2 gene E75K mutation exists internationally, and functional data of polypeptide coded by the new mutation of the CRYBB2 gene is lacking, so that pathogenicity rating of the new mutation is influenced, and establishment of clinical diagnosis of the disease and progress of regeneration and prenatal gene diagnosis of related families are hindered.
The difficulty of solving the problems and the defects is as follows: currently, no directly available constructs of the CRYBB2 gene with specific mutations are used for in vitro functional studies; lack of CRYBB2 polypeptides with specific mutations; without recombinant cells with specific mutant constructs, these several problems have hindered the pathogenicity rating of new variants of the CRYBB2 gene.
The meaning of solving the problems and the defects is as follows: the solution of the problems can clearly determine the pathogenicity of new variation in CRYBB2 genes related to congenital cataract phenotype, and has important significance for clearly determining the molecular genetic diagnosis of patients, guiding the accurate treatment of the patients and avoiding the regeneration and breeding risks of the families.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention provides a CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell.
The invention is realized in such a way that a CRYBB2 gene mutant, the nucleic acid of which is 223 th nucleotide of the No. 4 exon, has G-A mutation, and has the sequence of SEQ ID NO:3.
another object of the present invention is to provide a polypeptide using the CRYBB2 gene mutant, wherein the polypeptide has a p.e75k mutation, and is encoded by a nucleic acid of the CRYBB2 mutant, and the amino acid sequence of the polypeptide is SEQ ID NO:4.
another object of the present invention is to provide a kit for screening a biological sample susceptible to congenital cataract using the CRYBB2 gene mutant, which contains a reagent for specifically detecting the CRYBB2 gene mutant p.e75k.
Further, primers for amplifying exon 4 of the CRYBB2 gene:
forward 5'-CACTTGGATTTGCTGTGCTAAG-3' (SEQ ID NO: 5) and reverse 5'-AGAGAGAGGGAGTAGGGTGATG-3' (SEQ ID NO: 6).
It is another object of the present invention to provide a nucleic acid construct comprising the mutant p.E75K of CRYBB2 gene using the mutant CRYBB2 gene.
Further, the nucleic acid is any polymer comprising deoxyribonucleotides or ribonucleotides, including modified or unmodified DNA, and the length is not particularly limited.
It is another object of the present invention to provide a construction method of the nucleic acid construct, the construction method comprising:
(1) Designing an upstream and downstream amplification primer aiming at the full-length open reading frame of the wild CRYBB2 gene, wherein the upstream primer is provided with a HindIII enzyme cutting site, the downstream primer is provided with a BamH I enzyme cutting site, and the PCR method is used for amplifying the open reading frame sequence of the CRYBB2 and carrying out HindIII and BamH I double enzyme cutting and purification; the commercialized pFLAG-CMV4 expression vector is subjected to double digestion and purification by HindIII and BamH I, is connected with the digested and purified CRYBB2 open reading frame fragment by T4 ligase to form circular double-stranded DNA, is transformed into DH5 alpha competent cells, is inoculated on an ampicillin-resistant agarose plate for overnight culture, and is subjected to Sanger sequencing to identify pFLAG-CMV4-CRYBB2-WT sequences.
(2) Designing an upstream and downstream amplification primer aiming at the full-length open reading frame of the wild CRYBB2 gene, wherein the upstream primer is provided with a Bgl II enzyme cutting site, the downstream primer is provided with a BamH I enzyme cutting site, and the PCR method is used for amplifying the CRYBB2 open reading frame sequence and carrying out Bgl II and BamH I double enzyme cutting and purification; the commercial pAcGFP1-C1 expression vector is subjected to double digestion and purification by Bgl II and BamH I, is connected with the digested and purified CRYBB2 open reading frame fragment by T4 ligase to form circular double-stranded DNA, is transformed into DH5 alpha competent cells, is inoculated on a kanamycin-resistant agarose plate for overnight culture, and is subjected to Sanger sequencing to identify pAcGFP1-C1-CRYBB2-WT sequences.
Constructing p.E75K mutants (pFLAG-CMV 4-CRYBB2-E75K and pAcGFP1-C1-CRYBB 2-E75K) with FLAG tag and GFP tag respectively by using constructed pFLAG-CMV4-CRYBB2-WT and pAcGFP1-C1-CRYBB2-WT wild expression vectors through a site-directed mutagenesis method;
primers for construction of pFAG-CMV 4-CRYBB 2-WT:
forward direction 5'-AACGCGAAGCTTATGGCCTCAGATCACCAGAC-3' (SEQ ID NO: 7), reverse direction 5'-AACGCGGATCCCTAGTTGGAGGGGTGGAAGG-3' (SEQ ID NO: 8);
primers for construction of pAcGFP1-C1-CRYBB 2-WT:
forward direction 5'-AACGCGAAGCTTATGGCCTCAGATCACCAGAC-3' (SEQ ID NO: 9), reverse direction with SEQ ID NO:8, 8;
construction of the site-directed mutagenesis primer for the pFAG-CMV 4-CRYBB2-E75K, pAcGFP1-C1-CRYBB2-E75K mutant (c.223 G.fwdarw.A):
forward 5'-CGAGCAGTTTGTGTTTAAGAAGGGTGAGT-3' (SEQ ID NO: 10), reverse 5'-TAAACACAAACTGCTCGCCCTTGCAGTTG-3' (SEQ ID NO: 11);
another object of the present invention is to provide a recombinant cell obtained by transfection of the nucleic acid construct, which is obtained by transfection of the receptor cell with the nucleic acid construct containing the CRYBB2 gene p.E75K mutant.
Further, the recipient cells were derived from E.coli cells (DH 5. Alpha. Competent cells, purchased from Tiangen Biochemical technology Co., ltd.) or mammalian cells (HEK 293T cells, purchased from national biomedical laboratory cell resource library). Immunoblotting and immunofluorescence detected protein expression levels and subcellular localization of CRYBB2 wild-type and E75K mutants.
Another object of the present invention is to provide an application of the recombinant cell in screening drugs for treating congenital cataract.
Further, four small molecule drugs MG132, 3-MA, trichostatin A (TSA) and C646 (all purchased from Selleck corporation) capable of regulating protein expression are selected to treat HEK293T cells recombined by the CRYBB2 wild type and E75K construct, the protein expression of the wild type and mutant CRYBB2 is detected by an immunoblotting method, and the drugs with potential therapeutic effects are screened according to the degree of the rising expression of the E75K mutant protein.
By combining all the technical schemes, the invention has the advantages and positive effects that: the invention provides a CRYBB2 gene mutant, a polypeptide, a kit, a construct and a recombinant cell, and relates to a method for separating nucleic acid for encoding the CRYBB2 mutant, the separated polypeptide and screening a biological sample susceptible to congenital ichthyosis, the kit for screening the biological sample susceptible to congenital ichthyosis, the construct and the recombinant cell. Can be used for auxiliary diagnosis of congenital cataract, is used for finding potential carriers of congenital cataract pathogenic mutation, and provides basis for prenatal gene diagnosis of the disease.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
Fig. 1 is a lineage diagram and onset schematic of a congenital cataract family according to an embodiment of the invention.
Fig. 2 is a photograph of cataract manifestations of congenital cataract family patients provided by an embodiment of the invention.
FIG. 3 is a schematic representation of the c.223 locus of the wild-type and mutant CRYBB2 provided by the examples of the present invention.
Fig. 4 is a schematic diagram showing a conservation analysis of amino acid position 75 of CRYBB2 in different vertebrates according to the present invention.
FIG. 5 is a schematic representation of CRYBB2 p.E75K mutant construct protein expression provided by an embodiment of the present invention.
FIG. 6 is a schematic representation of a recombinant mammalian cell provided in an example of the present invention with a CRYBB2 p.E75K mutant construct.
FIG. 7 shows the protein expression patterns of the wild type CRYBB2 and the mutant CRYBB2 detected by immunoblotting by selecting 4 small molecule drugs MG132, 3-MA, trichlostatin A (TSA) and C646 which can regulate and control the protein expression to treat HEK293T cells recombined by the wild type CRYBB2 and E75K constructs according to the embodiment of the invention.
Detailed Description
The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
Aiming at the problems existing in the prior art, the invention provides a CRYBB2 gene mutant, a polypeptide, a kit, a construct and a recombinant cell, and the invention is described in detail below with reference to the accompanying drawings.
1. The invention relates to a human CRYBB2 gene mutation and application thereof. In particular, the invention relates to isolated nucleic acids encoding CRYBB2 mutants, isolated polypeptides, methods of screening biological samples for susceptibility to congenital cataracts, kits, constructs, and recombinant cells for screening biological samples for susceptibility to congenital cataracts. The strains used in the invention are all purchased commercially and purchased from Tiangen Biochemical technology (Beijing) limited company.
The invention determines the mutation of c.223G-A on the 4 # exon of the new pathogenic mutation CRYBB2 gene of congenital cataract by a target region capturing and sequencing combined candidate gene mutation verification method.
According to a first aspect of the present invention, the present invention proposes an isolated nucleic acid encoding a CRYBB2 mutant. According to an embodiment of the invention, the nucleic acid hybridizes with SEQ ID NO:1, i.e., the 223 rd base of the CRYBB2 gene mutant of the invention is mutated from G to A relative to the wild-type CRYBB2 gene. According to the embodiments of the present invention, the inventors have determined a novel mutant of the CRYBB2 gene, which is closely related to the onset of congenital cataract, so that by detecting whether the novel mutant exists in a biological sample, it is possible to effectively detect whether the biological sample is susceptible to congenital cataract.
According to a second aspect of the invention, the invention provides an isolated polypeptide. According to an embodiment of the invention, the sequence of seq id NO:2, i.e. the mutation is due to a missense mutation of c.223g→a, in particular the mutation represents: the isolated polypeptide has been mutated to a Lys codon due to the mutation of the codon for Glu75 of wild type CRYBB 2. By detecting whether the polypeptide is expressed in the biological sample, whether the biological sample is susceptible to congenital cataract can be effectively detected.
According to a third aspect of the invention, the invention provides a kit for screening a biological sample susceptible to congenital cataract. According to an embodiment of the invention, the kit contains: reagents suitable for detecting mutants of the CRYBB2 gene, wherein the sequences corresponding to SEQ ID NO:1, the CRYBB2 gene mutant has a c.223 G.fwdarw.A mutation. By using the kit according to the embodiment of the invention, biological samples which are susceptible to congenital cataract can be effectively screened.
According to a fourth aspect of the invention, the invention also proposes a construct. According to an embodiment of the invention, the construct comprises the isolated nucleic acid encoding a CRYBB2 mutant as described previously. Thus, the recombinant cells obtained by transfecting the receptor cells with the construct of the present invention can evaluate the protein expression level of the mutant.
According to a fifth aspect of the present invention, there is provided a method for constructing a nucleic acid construct, comprising designing an amplification primer having a specific cleavage site according to the open reading frame of CRYBB2 gene, double-cleaving the amplified product, and connecting the amplified product to an expression vector having a specific tag polypeptide sequence according to the need of the study, and constructing a nucleic acid construct having a specific site mutation by combining the site-directed mutation primer.
According to a sixth aspect of the invention, the invention also provides a recombinant cell. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with a construct as described above. According to some embodiments of the present invention, drugs for treating congenital cataract can be effectively screened by using the recombinant cells of the present invention.
2. The invention creates the key points and the protection points.
A nucleic acid encoding a mutant of CRYBB2, characterized in that the g→a mutation is present at nucleotide 223 of exon 4.
A polypeptide characterized as a CRYBB2 mutant, the isolated polypeptide having a p.e75k mutation.
A kit for screening a biological sample susceptible to congenital cataract contains a reagent for specifically detecting CRYBB2 gene mutant p.E75K, wherein the reagent is a nucleic acid primer.
Nucleic acid construct comprising a CRYBB2 gene p.e75k mutant.
A method for constructing a nucleic acid construct containing a mutant p.E75K of CRYBB2 gene.
Recombinant cells obtained by transfecting recipient cells with a CRYBB2 gene construct.
The technical scheme of the invention is further described below by combining the embodiments.
According to a first aspect of the present invention, the present invention proposes an isolated nucleic acid encoding a CRYBB2 mutant. According to an embodiment of the invention, the nucleic acid hybridizes with SEQ ID NO:1, the inventor determines new mutants of CRYBB2 genes, which are closely related to the onset of congenital cataract, so that whether the biological sample is susceptible to congenital cataract can be effectively detected by detecting whether the new mutants exist in the biological sample.
The cDNA of the wild CRYBB2 gene has the sequence shown in SEQ ID NO:1, the protein encoded by the cDNA of the wild CRYBB2 gene has a nucleotide sequence shown in SEQ ID NO:2, and a polypeptide having the amino acid sequence shown in 2.
The cDNA sequence of the CRYBB2 gene mutant is shown as SEQ ID NO:3.
The protein coded by the mutant CRYBB2 gene cDNA has the sequence shown in SEQ ID NO:4, and a polypeptide having the amino acid sequence shown in (a) and (b).
SEQ ID NO：1
atggcctcagatcaccagacccaggcgggcaagccacagtccctcaaccccaagatcatcatctttgagcaggaaaactttcaaggccactcgcatgagctcaatgggccctgccccaacctgaaggaaactggcgtggagaaggcaggttctgtcctagtgcaggctggaccctgggtgggctatgaacaggccaactgcaagggcgagcagtttgtgtttgagaagggtgagtacccccgctgggactcatggaccagcagccgaaggacggactccctcagctccctgaggcccatcaaagtggacagccaagagcacaagatcatcctctatgaaaaccccaacttcaccgggaagaagatggaaatcatagatgacgatgtacccagcttccacgcccatggctaccaggagaaggtgtcatctgtgcgggtgcagagtggcacgtgggttggctaccagtaccccggctaccgtgggctgcagtacctgctggagaagggagactacaaggacagcagcgactttggggcccctcacccccaggtgcagtccgtgcgccgtatccgcgacatgcagtggcaccaacgtggtgccttccacccctccaactag
SEQ ID NO：2
Met Ala Ser Asp His Gln Thr Gln Ala Gly Lys Pro Gln Ser Leu Asn Pro Lys Ile Ile Ile Phe Glu Gln Glu Asn Phe Gln Gly His Ser His Glu Leu Asn Gly Pro Cys Pro Asn Leu Lys Glu Thr Gly Val Glu Lys Ala Gly Ser Val Leu Val Gln Ala Gly Pro Trp Val Gly Tyr Glu Gln Ala Asn Cys Lys Gly Glu Gln Phe Val Phe Glu Lys Gly Glu Tyr Pro Arg Trp Asp Ser Trp Thr Ser Ser Arg Arg Thr Asp Ser Leu Ser Ser Leu Arg Pro Ile Lys Val Asp Ser Gln Glu His Lys Ile Ile Leu TyrGlu Asn Pro Asn Phe Thr Gly Lys Lys Met Glu Ile Ile Asp Asp Asp Val Pro Ser Phe His Ala His Gly Tyr Gln Glu Lys Val Ser Ser Val Arg Val Gln Ser Gly Thr Trp Val Gly Tyr Gln Tyr Pro Gly Tyr Arg Gly Leu Gln Tyr Leu Leu Glu Lys Gly Asp Tyr Lys Asp Ser Ser Asp Phe Gly Ala Pro His Pro Gln Val Gln Ser Val Arg Arg Ile Arg Asp Met Gln Trp His Gln Arg Gly Ala Phe His Pro Ser Asn SEQ ID NO：3
atggcctcagatcaccagacccaggcgggcaagccacagtccctcaaccccaagatcatcatctttgagcaggaaaactttcaaggccactcgcatgagctcaatgggccctgccccaacctgaaggaaactggcgtggagaaggcaggttctgtcctagtgcaggctggaccctgggtgggctatgaacaggccaactgcaagggcgagcagtttgtgtttaagaagggtgagtacccccgctgggactcatggaccagcagccgaaggacggactccctcagctccctgaggcccatcaaagtggacagccaagagcacaagatcatcctctatgaaaaccccaacttcaccgggaagaagatggaaatcatagatgacgatgtacccagcttccacgcccatggctaccaggagaaggtgtcatctgtgcgggtgcagagtggcacgtgggttggctaccagtaccccggctaccgtgggctgcagtacctgctggagaagggagactacaaggacagcagcgactttggggcccctcacccccaggtgcagtccgtgcgccgtatccgcgacatgcagtggcaccaacgtggtgccttccacccctccaactag
SEQ ID NO：4
Met Ala Ser Asp His Gln Thr Gln Ala Gly Lys Pro Gln Ser Leu Asn Pro Lys Ile Ile Ile Phe Glu Gln Glu Asn Phe Gln Gly His Ser His Glu Leu Asn Gly Pro Cys Pro Asn Leu Lys Glu Thr Gly Val Glu Lys Ala Gly Ser Val Leu Val Gln Ala Gly Pro Trp Val Gly Tyr Glu Gln Ala Asn Cys Lys Gly Glu Gln Phe Val Phe Lys Lys Gly Glu Tyr Pro Arg Trp Asp Ser Trp Thr Ser Ser Arg Arg Thr Asp Ser Leu Ser Ser Leu Arg Pro Ile Lys Val Asp Ser Gln Glu His Lys Ile Ile Leu Tyr Glu Asn Pro Asn Phe Thr Gly Lys Lys Met Glu Ile Ile Asp Asp Asp Gly Leu Gln Tyr Leu Leu Glu Lys Gly Asp Tyr Lys Asp Ser Ser Asp Phe Gly Ala Pro His Pro Gln Val Gln Ser Val Arg Arg Ile Arg Asp Met Gln Trp His Gln Arg Gly Ala Phe His Pro Ser Asn
The novel mutants found by the inventors have the nucleotide sequences shown in SEQ ID NO:1, i.e. the 223 rd base of the CRYBB2 gene mutant of the invention is mutated from G to a relative to the wild-type CRYBB2 gene. Thus, the product encoded by it has a p.glu75lys mutation compared to wild-type CRYBB2, in particular, the mutation represents: the 75 th amino acid Glu of the wild CRYBB2 is mutated to amino acid Lys.
The CRYBB2 gene is positioned at 22q11.23, the full length 12231bp is composed of 6 exons, the full length cDNA thereof comprises 1721 nucleotides, and the coding product is a 23kD beta-family crystal protein comprising 205 amino acids. Beta-crystallins form aggregates of different sizes that self-associate to form homodimers or heterodimers with other beta-crystallins in the same family, maintaining transparency and refractive index of the lens. Mutations in CRYBB2 have been found to cause congenital cataracts. However, the CRYBB2 gene mutation site c.G223A of the invention is not reported.
According to a second aspect of the invention, the invention provides an isolated polypeptide. According to an embodiment of the invention, the isolated polypeptide has a p.e75k mutation compared to wild-type CRYBB2, i.e. the mutation is due to a missense mutation of c.g223a, in particular the mutation is indicative of: the 75 th amino acid Glu of the isolated polypeptide wild-type CRYBB2 is mutated to Lys. According to some specific examples of the invention, the polypeptide is encoded by the aforementioned isolated nucleic acid encoding a mutant of CRYBB 2. By detecting whether the polypeptide is expressed in the biological sample, whether the biological sample is susceptible to congenital cataract can be effectively detected, and whether the polypeptide exists in the organism can be effectively predicted whether the organism is susceptible to congenital cataract.
According to a third and fourth aspect of the invention, the invention provides a kit for screening a biological sample susceptible to congenital cataract. According to an embodiment of the present invention, the kit for screening a biological sample susceptible to congenital cataract comprises: reagents suitable for detecting mutants of the CRYBB2 gene are nucleic acid probes or primers, preferably having the sequence as set forth in SEQ ID NO: 5-6. Thus, a biological sample susceptible to congenital cataract can be efficiently screened. The inventors found that by using these primers, amplification of CRYBB2 exon 4 can be accomplished significantly efficiently in a PCR reaction system.
Forward direction 5'-CACTTGGATTTGCTGTGCTAAG-3' (SEQ ID NO: 5)
Reverse direction 5'-AGAGAGAGGGAGTAGGGTGATG-3' (SEQ ID NO: 6)
According to a fifth aspect of the invention, the invention also proposes a construct. According to an embodiment of the invention, the construct comprises the isolated nucleic acid encoding the CRYBB2 mutant described previously, i.e. the CRYBB2 gene mutant of the invention. Thus, the recombinant cells obtained by transforming the receptor cells with the construct of the present invention can be effectively used for screening drugs for treating congenital cataract. The type of the receptor cell is not particularly limited, and may be, for example, an E.coli cell or a mammalian cell, and preferably the receptor cell is derived from a mammal.
The term "construct" as used in the present invention refers to a genetic vector which comprises a specific nucleic acid sequence and is capable of transferring the nucleic acid sequence of interest into a host cell to obtain a recombinant cell. The form of the construct is not particularly limited according to the embodiments of the present invention. According to an embodiment of the invention, it is at least one of a plasmid, a virus, preferably a plasmid. As a genetic carrier, the plasmid has the characteristics of simple operation and capability of carrying larger fragments, and is convenient to operate and process. The form of the plasmid is not particularly limited either, and may be a circular plasmid or a linear plasmid, i.e., may be single-stranded or double-stranded. Those skilled in the art can make selections as desired. The term "nucleic acid" as used in the present invention may be any polymer comprising deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RNA, the length of which is not subject to any particular limitation. For constructs used to construct recombinant cells, it is preferred that the nucleic acid is DNA, as DNA is more stable relative to RNA and is easy to handle.
According to a sixth aspect of the present invention, there is provided a method of constructing the nucleic acid construct according to an embodiment of the present invention:
(1) Designing an upstream and downstream amplification primer aiming at the full-length open reading frame of the wild CRYBB2 gene, wherein the upstream primer is provided with a HindIII enzyme cutting site, the downstream primer is provided with a BamH I enzyme cutting site, and the PCR method is used for amplifying the open reading frame sequence of the CRYBB2 and carrying out HindIII and BamH I double enzyme cutting and purification; the commercialized pFLAG-CMV4 expression vector is subjected to double digestion and purification by HindIII and BamH I, is connected with the digested and purified CRYBB2 open reading frame fragment by T4 ligase to form circular double-stranded DNA, is transformed into DH5 alpha competent cells, is inoculated on an ampicillin-resistant agarose plate for overnight culture, and is subjected to Sanger sequencing to identify pFLAG-CMV4-CRYBB2-WT sequences.
(2) Designing an upstream and downstream amplification primer aiming at the full-length open reading frame of the wild CRYBB2 gene, wherein the upstream primer is provided with a Bgl II enzyme cutting site, the downstream primer is provided with a BamH I enzyme cutting site, and the PCR method is used for amplifying the CRYBB2 open reading frame sequence and carrying out Bgl II and BamH I double enzyme cutting and purification; the commercial pAcGFP1-C1 expression vector is subjected to double digestion and purification by Bgl II and BamH I, is connected with the digested and purified CRYBB2 open reading frame fragment by T4 ligase to form circular double-stranded DNA, is transformed into DH5 alpha competent cells, is inoculated on a kanamycin-resistant agarose plate for overnight culture, and is subjected to Sanger sequencing to identify pAcGFP1-C1-CRYBB2-WT sequences.
Constructing p.E75K mutants (pFLAG-CMV 4-CRYBB2-E75K and pAcGFP1-C1-CRYBB 2-E75K) with FLAG tag and GFP tag respectively by using constructed pFLAG-CMV4-CRYBB2-WT and pAcGFP1-C1-CRYBB2-WT wild expression vectors through a site-directed mutagenesis method;
primers for construction of pFAG-CMV 4-CRYBB 2-WT:
forward direction 5'-AACGCGAAGCTTATGGCCTCAGATCACCAGAC-3' (SEQ ID NO: 7), reverse direction 5'-AACGCGGATCCCTAGTTGGAGGGGTGGAAGG-3' (SEQ ID NO: 8);
primers for construction of pAcGFP1-C1-CRYBB 2-WT:
forward direction 5'-AACGCGAGATCTATGGCCTCAGATCACCAGAC-3' (SEQ ID NO: 9), reverse direction with SEQ ID NO:8, 8;
construction of the site-directed mutagenesis primer for the pFAG-CMV 4-CRYBB2-E75K, pAcGFP1-C1-CRYBB2-E75K mutant (c.223 G.fwdarw.A):
forward 5'-CGAGCAGTTTGTGTTTAAGAAGGGTGAGT-3' (SEQ ID NO: 10), reverse 5'-TAAACACAAACTGCTCGCCCTTGCAGTTG-3' (SEQ ID NO: 11);
according to a seventh aspect of the invention, the invention also provides a recombinant cell. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with a construct as described above. Thus, the recombinant cells of the invention are capable of expressing CRYBB2 gene mutants carried by the constructs. According to some embodiments of the present invention, the recombinant cells of the present invention can be used to effectively analyze the expression difference of the CRYBB2 gene E75K mutant protein and the wild-type protein, and evaluate the biological harmfulness of the mutant.
According to an eighth aspect of the present invention, there is provided a method for screening a drug for treating congenital cataract using recombinant cells of the construct. According to the embodiment of the invention, four small molecular medicines MG132, 3-MA, triclosatin A (TSA) and C646 (all purchased from Selleck corporation) capable of regulating protein expression are selected to treat HEK293T cells of the CRYBB2 wild type and E75K construct recombination, the protein expression of the wild type and mutant CRYBB2 is detected by an immunoblotting method, and the medicines with potential therapeutic effects can be effectively screened according to the rising degree of the expression of the E75K mutant protein.
The foregoing is merely illustrative of specific embodiments of the present invention, and the scope of the invention is not limited thereto, but any modifications, equivalents, improvements and alternatives falling within the spirit and principles of the present invention will be apparent to those skilled in the art within the scope of the present invention.
Sequence listing
<110> Weifang medical college
<120> CRYBB2 Gene mutant, polypeptide, kit, construct and recombinant cell
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 618
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atggcctcag atcaccagac ccaggcgggc aagccacagt ccctcaaccc caagatcatc 60
atctttgagc aggaaaactt tcaaggccac tcgcatgagc tcaatgggcc ctgccccaac 120
ctgaaggaaa ctggcgtgga gaaggcaggt tctgtcctag tgcaggctgg accctgggtg 180
ggctatgaac aggccaactg caagggcgag cagtttgtgt ttgagaaggg tgagtacccc 240
cgctgggact catggaccag cagccgaagg acggactccc tcagctccct gaggcccatc 300
aaagtggaca gccaagagca caagatcatc ctctatgaaa accccaactt caccgggaag 360
aagatggaaa tcatagatga cgatgtaccc agcttccacg cccatggcta ccaggagaag 420
gtgtcatctg tgcgggtgca gagtggcacg tgggttggct accagtaccc cggctaccgt 480
gggctgcagt acctgctgga gaagggagac tacaaggaca gcagcgactt tggggcccct 540
cacccccagg tgcagtccgt gcgccgtatc cgcgacatgc agtggcacca acgtggtgcc 600
ttccacccct ccaactag 618
<210> 2
<211> 205
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Ala Ser Asp His Gln Thr Gln Ala Gly Lys Pro Gln Ser Leu Asn
1 5 10 15
Pro Lys Ile Ile Ile Phe Glu Gln Glu Asn Phe Gln Gly His Ser His
20 25 30
Glu Leu Asn Gly Pro Cys Pro Asn Leu Lys Glu Thr Gly Val Glu Lys
35 40 45
Ala Gly Ser Val Leu Val Gln Ala Gly Pro Trp Val Gly Tyr Glu Gln
50 55 60
Ala Asn Cys Lys Gly Glu Gln Phe Val Phe Glu Lys Gly Glu Tyr Pro
65 70 75 80
Arg Trp Asp Ser Trp Thr Ser Ser Arg Arg Thr Asp Ser Leu Ser Ser
85 90 95
Leu Arg Pro Ile Lys Val Asp Ser Gln Glu His Lys Ile Ile Leu Tyr
100 105 110
Glu Asn Pro Asn Phe Thr Gly Lys Lys Met Glu Ile Ile Asp Asp Asp
115 120 125
Val Pro Ser Phe His Ala His Gly Tyr Gln Glu Lys Val Ser Ser Val
130 135 140
Arg Val Gln Ser Gly Thr Trp Val Gly Tyr Gln Tyr Pro Gly Tyr Arg
145 150 155 160
Gly Leu Gln Tyr Leu Leu Glu Lys Gly Asp Tyr Lys Asp Ser Ser Asp
165 170 175
Phe Gly Ala Pro His Pro Gln Val Gln Ser Val Arg Arg Ile Arg Asp
180 185 190
Met Gln Trp His Gln Arg Gly Ala Phe His Pro Ser Asn
195 200 205
<210> 3
<211> 618
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atggcctcag atcaccagac ccaggcgggc aagccacagt ccctcaaccc caagatcatc 60
atctttgagc aggaaaactt tcaaggccac tcgcatgagc tcaatgggcc ctgccccaac 120
ctgaaggaaa ctggcgtgga gaaggcaggt tctgtcctag tgcaggctgg accctgggtg 180
ggctatgaac aggccaactg caagggcgag cagtttgtgt ttaagaaggg tgagtacccc 240
cgctgggact catggaccag cagccgaagg acggactccc tcagctccct gaggcccatc 300
aaagtggaca gccaagagca caagatcatc ctctatgaaa accccaactt caccgggaag 360
aagatggaaa tcatagatga cgatgtaccc agcttccacg cccatggcta ccaggagaag 420
gtgtcatctg tgcgggtgca gagtggcacg tgggttggct accagtaccc cggctaccgt 480
gggctgcagt acctgctgga gaagggagac tacaaggaca gcagcgactt tggggcccct 540
cacccccagg tgcagtccgt gcgccgtatc cgcgacatgc agtggcacca acgtggtgcc 600
ttccacccct ccaactag 618
<210> 4
<211> 173
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
Met Ala Ser Asp His Gln Thr Gln Ala Gly Lys Pro Gln Ser Leu Asn
1 5 10 15
Pro Lys Ile Ile Ile Phe Glu Gln Glu Asn Phe Gln Gly His Ser His
20 25 30
Glu Leu Asn Gly Pro Cys Pro Asn Leu Lys Glu Thr Gly Val Glu Lys
35 40 45
Ala Gly Ser Val Leu Val Gln Ala Gly Pro Trp Val Gly Tyr Glu Gln
50 55 60
Ala Asn Cys Lys Gly Glu Gln Phe Val Phe Lys Lys Gly Glu Tyr Pro
65 70 75 80
Arg Trp Asp Ser Trp Thr Ser Ser Arg Arg Thr Asp Ser Leu Ser Ser
85 90 95
Leu Arg Pro Ile Lys Val Asp Ser Gln Glu His Lys Ile Ile Leu Tyr
100 105 110
Glu Asn Pro Asn Phe Thr Gly Lys Lys Met Glu Ile Ile Asp Asp Asp
115 120 125
Gly Leu Gln Tyr Leu Leu Glu Lys Gly Asp Tyr Lys Asp Ser Ser Asp
130 135 140
Phe Gly Ala Pro His Pro Gln Val Gln Ser Val Arg Arg Ile Arg Asp
145 150 155 160
Met Gln Trp His Gln Arg Gly Ala Phe His Pro Ser Asn
165 170
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cacttggatt tgctgtgcta ag 22
<210> 6
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
agagagaggg agtagggtga tg 22
<210> 7
<211> 32
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
aacgcgaagc ttatggcctc agatcaccag ac 32
<210> 8
<211> 31
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
aacgcggatc cctagttgga ggggtggaag g 31
<210> 9
<211> 32
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
aacgcgagat ctatggcctc agatcaccag ac 32
<210> 10
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
cgagcagttt gtgtttaaga agggtgagt 29
<210> 11
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
taaacacaaa ctgctcgccc ttgcagttg 29

Claims (5)

1. A CRYBB2 gene mutant, wherein the nucleic acid sequence of the CRYBB2 gene mutant is SEQ ID NO:3.
2. a nucleic acid construct comprising the CRYBB2 gene of claim 1.
3. A method of constructing the nucleic acid construct of claim 2, comprising:
(1) Designing an upstream and downstream amplification primer aiming at the full-length open reading frame of the wild CRYBB2 gene, wherein the upstream primer is provided with a HindIII enzyme cutting site, the downstream primer is provided with a BamH I enzyme cutting site, and the PCR method is used for amplifying the open reading frame sequence of the CRYBB2 and carrying out HindIII and BamH I double enzyme cutting and purification; the commercialized pFLAG-CMV4 expression vector is subjected to HindIII and BamH I double digestion and purification, then is connected with an enzyme-digested and purified CRYBB2 open reading frame fragment through T4 ligase to form circular double-stranded DNA, so that a wild type expression vector of pFLAG-CMV4-CRYBB2-WT is obtained, DH5 alpha competent cells are transformed, and the cells are inoculated in ampicillin resistant agarose plates for overnight culture, and a monoclonal is selected for Sanger sequencing to identify pFLAG-CMV4-CRYBB2-WT sequences;
(2) Designing an upstream and downstream amplification primer aiming at the full-length open reading frame of the wild CRYBB2 gene, wherein the upstream primer is provided with a Bgl II enzyme cutting site, the downstream primer is provided with a BamH I enzyme cutting site, and the PCR method is used for amplifying the CRYBB2 open reading frame sequence and carrying out Bgl II and BamH I double enzyme cutting and purification; the commercial pAcGFP1-C1 expression vector is subjected to Bgl II and BamH I double-enzyme digestion and purification, then is connected with an enzyme-digested and purified CRYBB2 open reading frame fragment through T4 ligase to form circular double-stranded DNA, so that a pAcGFP1-C1-CRYBB2-WT wild-type expression vector is obtained, DH5 alpha competent cells are transformed, inoculated in a kanamycin-resistant agarose plate for overnight culture, and monoclonal is selected for Sanger sequencing to identify pAcGFP1-C1-CRYBB2-WT sequences;
the constructed pFLAG-CMV4-CRYBB2-WT and pAcGFP1-C1-CRYBB2-WT wild expression vectors are utilized to respectively construct pFLAG-CMV4-CRYBB2-E75K and pAcGFP1-C1-CRYBB2-E75K with FLAG tags and GFP tags by a site-directed mutagenesis method;
primers for construction of pFAG-CMV 4-CRYBB 2-WT:
forward direction 5'-AACGCGAAGCTTATGGCCTCAGATCACCAGAC-3' (SEQ ID NO: 7), reverse direction 5'-AACGCGGATCCCTAGTTGGAGGGGTGGAAGG-3' (SEQ ID NO: 8);
primers for construction of pAcGFP1-C1-CRYBB 2-WT:
forward direction 5'-AACGCGAGATCTATGGCCTCAGATCACCAGAC-3' (SEQ ID NO: 9), reverse direction with SEQ ID NO:8, 8;
construction of the site-directed mutagenesis primer for pFAG-CMV 4-CRYBB2-E75K, pAcGFP1-C1-CRYBB 2-E75K:
forward 5'-CGAGCAGTTTGTGTTTAAGAAGGGTGAGT-3' (SEQ ID NO: 10) and reverse 5'-TAAACACAAACTGCTCGCCCTTGCAGTTG-3' (SEQ ID NO: 11).
4. A recombinant cell transfected with the nucleic acid construct of any one of claims 2 to 3, wherein the recombinant cell is obtained by transfecting a recipient cell with the nucleic acid construct comprising the CRYBB2 gene mutant.
5. Use of the recombinant cell of claim 4 in screening for a drug for treating congenital cataract.
CN202110487575.0A 2021-05-06 2021-05-06 CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell Active CN113186192B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110487575.0A CN113186192B (en) 2021-05-06 2021-05-06 CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110487575.0A CN113186192B (en) 2021-05-06 2021-05-06 CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell

Publications (2)

Publication Number Publication Date
CN113186192A CN113186192A (en) 2021-07-30
CN113186192B true CN113186192B (en) 2023-05-02

Family

ID=76983456

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110487575.0A Active CN113186192B (en) 2021-05-06 2021-05-06 CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell

Country Status (1)

Country Link
CN (1) CN113186192B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114134212A (en) * 2021-12-16 2022-03-04 青岛汉唐生物科技有限公司 Primer probe combination and kit for plasmid quantification

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001259595A1 (en) * 2000-05-05 2001-11-20 Genaissance Pharmaceuticals, Inc. Haplotypes of the crybb1 gene
CN103045722B (en) * 2012-08-30 2015-03-25 山西省眼科医院 Detection kit of disease-causing gene CRYGD of crystalline congenital cataract
CN104906125B (en) * 2015-04-15 2018-03-02 中国人民解放军第二军医大学 Application of microRNA 326 inhibitor in the medicine for preparing treatment cataract
CN107312053B (en) * 2016-04-27 2020-01-31 清华大学 compounds and application thereof in treating cataract
CN106434933A (en) * 2016-10-11 2017-02-22 青岛大学 Application of CRYBB2 gene in preparation of product for detecting congenital cataract
CN106701925B (en) * 2016-12-08 2020-02-07 福建医科大学 Cataract pathogenic gene detection kit and detection method thereof
CN107904160A (en) * 2017-12-05 2018-04-13 北京军秀咨询有限公司 A kind of cataract Disease-causing gene detection kit and its detection method
CN111607641B (en) * 2019-02-26 2022-08-09 中国人民解放军第四军医大学 Molecular marker of new gene mutation site causing congenital membrane cataract and kit thereof

Also Published As

Publication number Publication date
CN113186192A (en) 2021-07-30

Similar Documents

Publication Publication Date Title
US20040096886A1 (en) Loci for idiopathic generalized epilepsy, mutations thereof and method using same to assess, diagnose, prognose or treat epilepsy
KR20090087494A (en) Genetic markers for risk management of cardiac arrhythmia
Mirghomizadeh et al. Substitutions in the conserved C2C domain of otoferlin cause DFNB9, a form of nonsyndromic autosomal recessive deafness
JP5608863B2 (en) Methods for detecting refractory epilepsy from neonatal to infancy
CN103374575B (en) CYP4V2 gene mutant and application thereof
CN113186192B (en) CRYBB2 gene mutant, polypeptide, kit, construct and recombinant cell
KR20200081380A (en) Genetic regulation
CN104120133A (en) Gene mutant and application thereof
CN106536753B (en) Methods for determining responsiveness to MEK/ERK inhibitors
CN103555829A (en) Probe, kit and method for detecting R47H mutation of TREM2 gene
CN109402132A (en) It is a kind of encode SCN1A gene mutation body nucleic acid and its application
CN114045292B (en) MAF gene mutant, polypeptide, kit, construct, recombinant cell and application for causing congenital cataract
JP5695719B2 (en) CC2D2A gene mutation associated with Joubert syndrome and its diagnostic method
CN110684834B (en) Genotyping kit for detecting GP IV deletion caused by 6 CD36 mutant genes
Zhang et al. Progressive sutural cataract associated with a BFSP2 mutation in a Chinese family
CN104745592A (en) CYP4V2 gene mutant and application thereof
CN104745594B (en) CYP4V2 gene mutation body and its application
CN114032219A (en) CYP4F22 gene mutant, polypeptide, kit, construct and recombinant cell
Liu et al. Clinical and genetic analysis of a compound heterozygous mutation in the thyroglobulin gene in a Chinese twin family with congenital goiter and hypothyroidism
CN111662372B (en) CAPSL mutant gene, reagent, kit and application thereof
Hunter et al. Novel mutations in the GALK1 gene in patients with galactokinase deficiency
CN104774840B (en) Gene mutation body and its application
Zhou et al. Identification of a missense mutation in MIP gene via mutation analysis of a Guangxi Zhuang ethnic pedigree with congenital nuclear cataracts
KR20160088996A (en) Mutations Related to Severe Avellino Corneal Dystrophies and Use Thereof
CN114605524B (en) GPR143 gene mutant causing albinism type I, polypeptide, kit, construct, recombinant cell and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant