CN113151566A

CN113151566A - Industrial hemp sex-linked SNP molecular marker, screening method and application thereof

Info

Publication number: CN113151566A
Application number: CN202110544993.9A
Authority: CN
Inventors: 张从省; 王喜萍
Original assignee: Weifang Xingwang Bioseed Co ltd
Current assignee: Weifang Xingwang Bioseed Co ltd
Priority date: 2021-05-19
Filing date: 2021-05-19
Publication date: 2021-07-23
Anticipated expiration: 2041-05-19
Also published as: CN113151566B

Abstract

The invention provides an industrial hemp sex-linked SNP molecular marker, a screening method and application thereof, belongs to the technical field of molecular markers, and can solve the problems of low accuracy and unsatisfactory identification result of the existing SNP molecular marker. The technical scheme comprises the following steps: comparing the male specific sequence fragment with sequences in a hemp genome database to obtain the difference of comparison of X chromosome and Y chromosome fragments of industrial hemp; according to the difference of comparison of X chromosome and Y chromosome segments of industrial hemp, a plurality of pairs of specific primers and a plurality of pairs of random degenerate primers are designed by taking male specific sequence segments as templates, and are taken as primers to carry out multiple PCR amplification reactions; sequencing and analyzing PCR products obtained by multiple rounds of PCR amplification reactions, and screening out flanking sequences of male specific sequence fragments; and comparing the flanking sequences with sequences in a hemp genome database, and determining SNP molecular marker sites according to the comparison result. The invention has the characteristics of high accuracy, high sex discrimination and the like.

Description

Industrial hemp sex-linked SNP molecular marker, screening method and application thereof

Technical Field

The invention belongs to the technical field of molecular markers, and particularly relates to an industrial hemp sex-linked SNP molecular marker, a screening method and application thereof.

Background

Cannabis sativa is an annual upright herb plant belonging to the genus cannabis of the family of the order nettle, the family of the orders urticaceae, is a heterogynic plant (XY sex pattern), with the ratio of the offspring gynic and androecial plants approaching 1: 1. according to the content of cannabinoid, hemp is classified into drug hemp and industrial hemp, wherein the industrial hemp is widely used in fields such as textile, paper making, medicine, hygiene, daily chemicals, leather, automobile, building, decoration, etc.

Cannabis contains cannabinoids, also known as cannabinoids, which have wide medicinal value, and have been developed and used for treating anxiety, depression, mood disorders, chronic pain, arthritis, cancer, parkinson and other diseases. Cannabinoids mainly exist in flowers and leaves of female plants, and the content of cannabinoids in the female plants after pollination to form seeds is obviously reduced, so that male plants need to be pulled out and the female plants are reserved in the process of planting industrial hemp, but the male plants and the female plants cannot be judged before the hemp flowers are formed, the male plants need to be pulled out after the hemp flowers grow to the extent that the sex of the male plants and the female plants can be judged, the processing mode consumes a large amount of labor cost, and the growth vigor of the hemp is influenced.

The molecular marker is a specific DNA fragment capable of reflecting certain difference in genome of biological individuals or populations, and provides possibility for the molecular marker in marijuana sex identification due to the difference of marijuana X chromosome and Y chromosome, but the research on the molecular marker for marijuana sex identification is still in the initial stage at present, available SNP is less, accuracy is lower, and the identification result is not ideal. Therefore, how to develop an industrial hemp sex-linked SNP molecular marker with high accuracy and high sex discrimination is the key to solve the problems.

Disclosure of Invention

Aiming at the technical problems of low accuracy, unsatisfactory identification result and the like of the existing SNP molecular marker, the invention provides an industrial hemp gender linkage SNP molecular marker with high accuracy and high gender discrimination, a screening method and application thereof.

In order to achieve the purpose, the invention adopts the technical scheme that:

the method for screening the industrial hemp sex-linked SNP molecular marker comprises the following steps:

comparing the male specific sequence fragment with sequences in a hemp genome database to obtain the difference of comparison of X chromosome and Y chromosome fragments of industrial hemp;

according to the difference of the comparison of the X chromosome and the Y chromosome of the industrial hemp, a plurality of pairs of specific primers and a plurality of pairs of random degenerate primers are designed by taking the male specific sequence fragment as a template, and are taken as primers to carry out a plurality of rounds of PCR amplification reactions;

sequencing and analyzing PCR products obtained by the multiple rounds of PCR amplification reactions, and screening out the flanking sequence of the male specific sequence fragment;

and comparing the flanking sequences with sequences in a hemp genome database, and determining SNP molecular marker sites according to the comparison result.

Preferably, the male-specific sequence fragment is a fragment MADC6, the sequence of which is shown in SEQ ID NO.1, and the flanking sequence is WBSDMY604, the sequence of which is shown in SEQ ID NO. 2.

Preferably, the multiple pairs of specific primers are six forward and reverse specific primers, which are respectively SP1F and SPF1, SP2F and SPF2, and SP3F and SPF3, and the sequences of SP1F and SPF1, SP2F and SPF2, and SP3F and SPF3 are shown in SEQ ID NO. 3-8.

Preferably, the multiple pairs of random degenerate primers are six forward and reverse degenerate primers, which are AD1 and AD2, AD3 and AD4 and AD5 and AD6 respectively, and the sequences of the AD1 and AD2, the AD3 and AD4, and the AD5 and AD6 are shown in SEQ ID NO. 9-14.

Preferably, the multiple PCR amplification reactions are three PCR amplification reactions, namely a first PCR amplification reaction, a second PCR amplification reaction and a third PCR amplification reaction.

Preferably, the reaction system of the first round of PCR amplification reaction is: taq Mix 10. mu.l, SP1F and SPF 11. mu.l, random degenerate primer 4. mu.l, hemp genomic DNA 1. mu.l and ddH₂O4. mu.l, 20. mu.l in total; the reaction system of the second round of PCR amplification reaction is as follows: taq Mix 10. mu.l, SP2F and SPF 21. mu.l, random degenerate primer 4. mu.l, first round PCR amplification reaction product dilution 1. mu.l toAnd ddH₂O4. mu.l, 20. mu.l in total; the reaction system of the third round of PCR amplification reaction is as follows: taq Mix 10. mu.l, SP3F and SPF 31. mu.l, random degenerate primer 4. mu.l, second round PCR amplification reaction product dilution 1. mu.l and ddH₂O4. mu.l, totaling to 20. mu.l.

Preferably, the reaction conditions of the first round of PCR amplification reaction are:

s1, pre-denaturation at 94 ℃ for 2min, and pre-denaturation at 95 ℃ for 1 min;

s2, denaturation at 94 ℃ for 15S, annealing at 63 ℃ for 1min, extension at 72 ℃ for 2min, and 5 cycles;

s3, denaturation at 94 ℃ for 15S, annealing at 30 ℃ for 1min, and heating to 72 ℃ for 2min at the temperature of 0.2 ℃/S;

s4, denaturation at 94 ℃ for 5S, annealing at 63 ℃ for 1min, extension at 72 ℃ for 2min, and 2 cycles;

s5, denaturation at 94 ℃ for 5S, annealing at 44 ℃ for 1min, and extension at 72 ℃ for 2 min;

s6, extension at 72 ℃ for 2min, wherein steps S4 and S5 total 15 cycles;

the reaction conditions of the second round of PCR amplification reaction and the third round of PCR amplification reaction are as follows:

s1, denaturation at 94 ℃ for 5S, annealing at 63 ℃ for 1min, extension at 72 ℃ for 2min, and 2 cycles;

s2, denaturation at 94 ℃ for 5S, annealing at 44 ℃ for 1min, and extension at 72 ℃ for 2 min;

s3, extension at 72 ℃ for 2min, wherein steps S1 and S2 are 15 cycles in total.

Preferably, the method further comprises the step of verifying the accuracy of the SNP molecular marker, and specifically comprises the following steps:

designing a plurality of SNP primers by taking the flanking sequences as templates according to a KASP primer design principle;

carrying out PCR amplification reaction by taking the plurality of SNP primers as primers and genome DNA of different marijuana varieties as templates, and then carrying out fluorescence scanning to obtain scanning data;

inputting the scanning data into an SNPWAY platform for genotyping to obtain an SNP genotyping result;

comparing the SNP genotyping result with the actual hemp gender, and evaluating the accuracy of the SNP molecular marker;

the SNP primers are three, namely F1, F2 and R, and the sequences of F1, F2 and R are shown as SEQ ID NO. 15-17.

The invention also provides an industrial hemp sex-linked SNP molecular marker which is obtained by screening by the screening method of any one of the preferred technical schemes.

The invention also provides application of the industrial hemp sex-linked SNP molecular marker in identification of male and female industrial hemp plants.

Compared with the prior art, the invention has the advantages and positive effects that:

1. according to the method for screening the industrial hemp sex-linked SNP molecular marker, on the premise that the X chromosome and the Y chromosome of hemp are different, a SNP molecular marker locus for identifying the hemp sex is finally screened out through the steps of nucleotide sequence comparison, specific primer design, multiple rounds of PCR amplification reactions and the like, so that the sex identification of industrial hemp is realized;

2. in the screening method of the industrial hemp sex-linked SNP molecular marker provided by the invention, the SNP molecular marker locus obtained by screening by the method can realize the rapid and efficient identification of hemp sex, and can completely replace the traditional method of observing and judging by phenotype;

3. the method for screening the industrial hemp sex-linked SNP molecular marker has the characteristics of high discrimination, good stability, high accuracy and the like.

Drawings

FIG. 1 is a schematic diagram showing the alignment of the fragment MADC6 with the cannabis genome database;

FIG. 2 is a schematic diagram of the design of primers for chromosome walking of MADC6 fragment according to the embodiment of the present invention;

FIG. 3 shows the electrophoresis results of the PCR products of the second PCR amplification reaction and the third PCR amplification reaction provided in the embodiment of the present invention;

FIG. 4 shows SNP molecular marker sites provided in embodiments of the invention;

FIG. 5 shows the result of SNP molecular marker typing of HYJL-18 and HYR-3 varieties according to the embodiment of the present invention;

FIG. 6 shows the results of the marker detection of HYJL-18 and HYR-3 varieties MADC6 according to the present invention;

FIG. 7 shows the molecular marker typing results of HYW-23, HYT-14G, HYLS-19 and HYM-5 varieties SNP provided by the embodiment of the invention;

FIG. 8 shows the results of the marker detection of HYW-23, HYT-14G, HYLS-19 and HYM-5 varieties MADC6 according to the embodiment of the present invention;

FIG. 9 shows the SNP molecular markers of HYM-1, HYR-H2, HYRH-17, and HYGM-20 varieties according to the embodiment of the present invention;

FIG. 10 shows the results of the marker detection of HYM-1, HYR-H2, HYRH-17, HYGM-20 varieties MADC6 provided by the embodiments of the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The embodiment of the invention provides a method for screening industrial hemp sex-linked SNP molecular markers, which comprises the following steps:

(1) comparing the male specificity sequence fragment (namely the MADC6 fragment) with sequences in a hemp genome database to obtain the comparison difference of X chromosome and Y chromosome fragments of industrial hemp;

in step (1) above, the male-specific sequence fragments were aligned with the sequences in the cannabis genome database because: the hemp genome database is used for sequencing female strains (only X has no Y in sex chromosome sequencing), male specific sequence fragments are compared with sequences in the hemp genome database to ensure that designed primers are only combined with Y chromosome and do not combine with X chromosome (the similarity between X chromosome and Y chromosome is high), so that the comparison result is the difference of the comparison of Y chromosome fragments and X chromosome fragments, and primers are designed according to the difference (namely, the specific primers are only combined with Y chromosome).

(2) According to the difference of the industrial hemp X-chromosome and Y-chromosome fragment comparison, a plurality of pairs of specific primers and a plurality of pairs of random degenerate primers are designed by taking the male specific sequence fragment (namely the MADC6 fragment) as a template, and are taken as primers to carry out a plurality of rounds of PCR amplification reactions;

(3) sequencing and analyzing PCR products obtained by the multiple rounds of PCR amplification reaction, and screening out a flanking sequence of the male specific sequence fragment, namely WBSDMY 604;

(4) and (3) comparing the flanking sequence WBSDMY604 with sequences in a hemp genome database, and determining SNP molecular marker loci according to the comparison result.

In the technical scheme, the embodiment of the invention provides a method for screening industrial hemp sex-linked SNP molecular markers, which is characterized in that on the premise that the X chromosome and the Y chromosome of hemp are different, a SNP molecular marker locus for identifying the hemp sex is finally screened out through the steps of nucleotide sequence comparison, specific primer design, multiple rounds of PCR amplification reactions and the like, and the hemp sex identification is realized.

In a preferred embodiment, the male-specific sequence fragment is a fragment of MADC6, the sequence of which is shown in SEQ ID No.1, and the flanking sequence is WBSDMY604, the sequence of which is shown in SEQ ID No. 2.

In the preferred embodiment described above, the reason why the MADC6 fragment is selected as the male-specific sequence fragment is that: the MADC6 fragment is used as a male specificity sequence fragment, the mark has higher conservative property in a plurality of hemp varieties, the mark has high accuracy (close to 100 percent) and stability when the multiple varieties are compared with the PCR identification result, the MADC6 mark is obtained by utilizing the fragment, a flanking sequence WBSDMY604 is obtained, and the female plant detection rate is high and stable after the screened SNP molecular mark is verified in the multiple varieties.

In a preferred embodiment, the plurality of pairs of specific primers are six forward and reverse specific primers, SP1F and SPF1, SP2F and SPF2, and SP3F and SPF3, respectively, the sequences of SP1F and SPF1, SP2F and SPF2, and SP3F and SPF3 are shown in SEQ ID nos. 3-8, the plurality of pairs of random degenerate primers are six forward and reverse degenerate primers, AD1 and AD2, AD3 and AD4, and AD5 and AD6, respectively, and the sequences of AD1 and AD2, AD3 and AD4, and AD5 and AD6 are shown in SEQ ID nos. 9-14.

In the above preferred embodiment, in order to obtain an unknown sequence near the known fragment MADC6, the present invention designs 3 pairs of primers SP1F, SP2F, SP3F (forward direction) and SPF1, SPF2, and SPF3 (reverse direction) in sequence from two directions of MADC6, and designs random Degenerate primers AD1, AD2, AD3, AD4, AD5, and AD6 (combined with the unknown sequence).

In a preferred embodiment, the multiple PCR amplification reactions are three PCR amplification reactions, namely a first PCR amplification reaction, a second PCR amplification reaction, and a third PCR amplification reaction.

In the preferred embodiment, the first round of PCR amplification reaction is carried out by respectively pairing SP1F or SPF1 with AD1, AD2, AD3, AD4, AD5 and AD6, and using hemp male strain DNA as a template; performing PCR amplification on the second round of PCR amplification reaction by taking the first round of PCR products as templates and respectively pairing SP2F or SPF2 with AD1, AD2, AD3, AD4, AD5 and AD 6; and performing PCR amplification on the third round of PCR amplification reaction by using the second round of PCR product as a template and respectively using SP3F or SPF3 and AD1, AD2, AD3, AD4, AD5 and AD6 groups, and performing recovery sequencing comparison on the obtained strip to obtain an unknown fragment sequence (similar to nested PCR), wherein the AD primer design principle (15-16nt, the annealing temperature is about 45 ℃).

In a preferred embodiment, the reaction system of the first round of PCR amplification reaction is: taq Mix 10. mu.l, SP1F and SPF 11. mu.l, random degenerate primer 4. mu.l, hemp genomic DNA 1. mu.l and ddH₂O4 μ l, 20 μ l in total; the reaction system of the second round of PCR amplification reaction is as follows: taq Mix 10. mu.l, SP2F and SPF 21. mu.l, random degenerate primer 4. mu.l, first round PCR amplification reaction product dilution 1. mu.l and ddH₂O4. mu.l, 20. mu.l in total; the reaction system of the third round of PCR amplification reaction is as follows: taq Mix 10. mu.l, SP3F and SPF 31. mu.l, random degenerate primer 4. mu.l, second round PCR amplification reaction productDiluent 1. mu.l and ddH₂O4. mu.l, 20. mu.l in total.

In the above preferred embodiment, the first round of PCR amplification reaction, the second round of PCR amplification reaction, and the third round of PCR amplification reaction are nested PCR reactions, i.e. the DNA template of the second round of PCR amplification reaction is the product of the first round of PCR amplification reaction, and the DNA template of the third round of PCR amplification reaction is the product of the second round of PCR amplification reaction.

In a preferred embodiment, the reaction conditions of the first round of PCR amplification reaction are:

s6, extension at 72 ℃ for 2min, wherein steps S4 and S5 total 15 cycles;

In the above preferred embodiment, the reason why the present embodiment employs three rounds of PCR amplification reactions is that: random primer AD can be randomly combined with unknown sequences, a first round of PCR amplification reaction is to combine SP1F or SPF1 with AD, the obtained amplification product contains fragment enrichment of specific binding and non-specific binding, a second round of PCR amplification reaction is to combine SP2F or SPF2 with AD, the range of the amplification product can be further reduced, and a specific band containing known fragments and unknown fragments can be amplified through a third round of PCR amplification reaction.

In a preferred embodiment, the method further comprises the step of verifying the accuracy of the SNP molecular marker, which specifically comprises the following steps:

In the above preferred embodiment, the present invention further provides a method for verifying the accuracy of the SNP molecular marker, which can be used to evaluate the accuracy of the SNP molecular marker in marijuana sex determination.

The invention also provides an industrial hemp sex-linked SNP molecular marker which is obtained by screening by the screening method of any one of the preferred embodiments.

In order to more clearly and specifically describe the industrial hemp sex-linked SNP molecular markers, the screening method and the application thereof provided by the embodiments of the present invention, the following description will be given with reference to specific embodiments.

Example 1

The embodiment provides a screening method of industrial hemp sex-linked SNP molecular markers, which is carried out by taking a MADC6 fragment as a male specific sequence fragment and specifically comprises the following steps:

(1) the MADC6 fragment is used as a male specificity sequence fragment, the nucleotide sequence of the MADC6 fragment is shown as SEQ ID NO.1, the MADC6 fragment is compared with sequences in a hemp genome database (http:// genome. ccbr. utoronto. ca /), the comparison result of the MADC6 fragment and the sequences is shown as figure 1, and the sequence with the highest similarity with the MADC6 fragment is obtained and is marked as a sequence A;

(2) six specific primers and six random degenerate primers are designed by taking a MADC6 fragment as a template, and the chromosome walking primer design of the MADC6 fragment is shown in figure 2, wherein the six specific primers are six forward and reverse specific primers, namely SP1F, SPF1, SP2F, SPF2, SP3F and SPF3, the nucleotide sequences of the primers are shown in table 1, the six random degenerate primers are six forward and reverse degenerate primers, namely AD1-AD6, and the sequences of the primers are shown in table 2;

TABLE 1 six specific primer sequences

Primer name	Primer sequence (5 '-3')
		SP1F	CTAGAGGCCGATAATTGACTGGAACCT
SPF1	CAAACAACAACAAACCGATATGTCAG
		SP2F	AGATGTCAAACTGGTGGTAACATTTT
SPF2	AAAATGTTACCACCAGTTTGACATCT
		SP3F	CTGACATATCGGTTTGTTGTTGTTTG
SPF3	AGGTTCCAGTCAATTATCGGCCTCTAG

TABLE 2 six randomly degenerate primer sequences

Primer name	Primer sequence (5 '-3')
		AD1	NGTCGASWGANAWGAA
AD2	WGTGNAGWANCANAGA
		AD3	AGWGNAGWANCAWAGG
AD4	GTNCGASWCANAWGTT
		AD5	TCSTNCGNACNTWGGA
AD6	CAWCGNCNGANASGAA

(3) The primers are used as primers to carry out three rounds of PCR amplification reactions, namely a first round of PCR amplification reaction, a second round of PCR amplification reaction and a third round of PCR amplification reaction, wherein the reaction system and the reaction conditions of each round of PCR amplification reaction are as follows:

TABLE 3 three rounds of PCR amplification reaction System

The reaction conditions of the first round of PCR amplification reaction are as follows:

s6, extension at 72 ℃ for 2min, wherein steps S4 and S5 total 15 cycles;

s3, extension at 72 ℃ for 2min, wherein steps S1 and S2 total 15 cycles;

(4) carrying out agarose gel electrophoresis on PCR products of the second round of PCR amplification reaction and the third round of PCR amplification reaction, wherein the electrophoresis result is shown in figure 3, the two rounds of SPF2 amplified fragments are analyzed by gel recovery sequencing to be 604bp, the sequence of the two rounds of SPF2 amplified fragments is shown in SEQ ID NO.2, the sequence fragments are flanking sequences of MADC6 fragments, and the sequence fragments are named as WBSDMY 604;

(5) the flanking sequences WBSDMY604 were aligned with the sequences in the Cannabis sativa genome database, and SNP molecular marker sites were found according to the alignment (as shown in the box in FIG. 4).

Example 2

The embodiment provides an accuracy verification experiment of industrial hemp gender linked SNP molecular markers, which specifically comprises the following steps:

(1) three flanking sequence primers, namely F1, F2 and R, are designed by using the flanking sequence WBSDMY604 obtained by amplification in example 1 as a template, and the primer sequences are shown in Table 4:

TABLE 4 primer sequences for the three flanking sequences

Primer name	Primer sequence (5 '-3')
		F1	GAAGGTGACCAAGTTCATGCTAGCACCTCCTCCTTCGAG
F2	GAAGGTCGGAGTCAACGGATTAGCACCTCCTCCTTCGAT
		R	GAATTTTATGCTGATTTTTGTGTTGTGAA

(2) Selecting industrial hemp varieties HYJL-18 and HYR-3 as verification samples, selecting 24 samples for each variety, extracting sample DNA according to a CTAB method to be used as a template, and taking primers F1, F2 and R as primers to carry out KASP reaction, wherein the specific reaction system and the reaction program are as follows:

TABLE 5 KASP reaction System

PCR Components	Volume (μ l)
		Matrix Mix	3
F1	0.075
		F2	0.075
R	0.2
		DNA	1.5
ddH₂O	3.15

Reaction procedure:

s1, pre-denaturation at 95 ℃ for 15 min;

s2, denaturation at 95 ℃ for 15S, annealing at 61 ℃, cooling to 55 ℃ at 0.6 ℃/S for 1min, and 1 cycle;

s3, denaturation at 95 ℃ for 15S; annealing at 55 deg.C for 1min for 15 cycles;

S4、30℃30s；

(3) performing fluorescence scanning on the KASP product (namely the KASP marker detection sample) obtained in the step (2), analyzing by an SNPWAY platform, and comparing the SNP typing result with the actual hemp gender, wherein the SNP molecular marker typing result is shown in figure 5, so as to evaluate the accuracy of the SNP molecular marker;

(4) on the basis, the embodiment also carries out MADC6 marking detection on the KASP product, the detection result is shown in figure 6, and the comparison shows that the detection rate of the KASP marked female strain is 78.2%, and the accuracy is 100%.

Example 3

(1) in the embodiment, industrial hemp varieties HYW-23, HYT-14G, HYLS-19 and HYM-5 are selected as verification samples as templates, three flanking sequence primers F1, F2 and R shown in the embodiment 2 are used as primers to carry out KASP reaction, and the specific reaction system and the reaction program are the same as those in the embodiment 2 to obtain a KASP marker detection sample;

(2) performing fluorescence scanning on the KASP marker detection sample obtained in the step (1), analyzing by an SNPWAY platform, and comparing the SNP typing result with the actual hemp gender, wherein the SNP molecular marker typing result is shown in figure 7, so as to evaluate the accuracy of the SNP molecular marker;

(3) on the basis, the embodiment also carries out MADC6 marking detection on the KASP product, the detection result is shown in figure 8, and the comparison shows that the average detection rate of the KASP marked female plants is 78%, and the accuracy rate is 100%.

Comparative example 1

The comparative example provides a method for identifying hemp male and female by using SNP conventionally, which is the only reported method for identifying hemp male and female by using SNP at present, and the primer sequence and the identification method are as follows:

(1) selecting industrial hemp varieties HYM-1, HYR-H2, HYRH-17 and HYGM-20 as verification samples, selecting 24 samples of each variety, extracting sample DNA according to a CTAB method to serve as a template, and performing KASP reaction by using primers CSP-F1, CSP-F2 and CSP-R as primers, wherein the sequences of the primers are shown in Table 6, and the specific reaction system and the reaction procedure are the same as those in example 2 to obtain a KASP marker detection sample;

table 6 reported hemp sex identification SNP primers

Primer name	Primer sequence (5 '-3')
		CSP-F1	GAAGGTGACCAAGTTCATGCTAGCTTGAAATGAGATGTCAAACC
CSP-F2	GAAGGTCGGAGTCAACGGATTGAGCTTGAAATGAGATGTCAAACT
		CSP-R	GCAGCAGACCTGGGCATATAG

(2) Carrying out fluorescence scanning on the KASP marker detection sample obtained in the step (1), carrying out SNPWAY platform agarose gel electrophoresis analysis, comparing an electrophoresis SNP typing result with the actual hemp gender, and evaluating the accuracy of the SNP molecular marker, wherein the SNP molecular marker typing result is shown in figure 9;

(3) on the basis, the detection result of the MADC6 labeling detection of the KASP product is shown in FIG. 10, and the comparison shows that the average detection rate of the female KASP labeled strains is only 21.7%, and the accuracy rate is 100%.

According to the content, the SNP molecular marker obtained by screening by the method can realize the rapid and efficient identification of the hemp gender, can completely replace the traditional method for observing and judging the phenotype, and has the characteristics of high discrimination, good stability, high accuracy and the like through an accuracy verification test. Therefore, the industrial hemp gender linkage SNP molecular marker and the screening method thereof provided by the invention can solve the technical problems of low accuracy, unsatisfactory identification result and the like of the existing SNP molecular marker, and have wide application prospect in the aspect of industrial hemp gender identification.

Sequence listing

<110> Weifang Shawang biological species industry Co Ltd

<120> industrial hemp sex-linked SNP molecular marker, screening method and application thereof

<160> 17

<170> PatentIn version 3.5

<210> 1

<211> 151

<212> DNA

<213> MADC6

<400> 1

1 CTAGAGGCCG TGGACGCGGC GGAGGACGAT CAAACAACAA CAAACCGATA TGTCAGCTTT

61 GCAGCAGACC TGGGCATATA GCTTCAAAAT GTTACCACCA GTTTGACATC TCATTTCAAG

121 CTCCAGGTTC CAGTCAATTA TCGGCCTCTA G

<210> 2

<211> 593

<212> DNA

<213> WBSDMY604

<400> 2

1 TAGACTCGGC AAACAAAGAC ATACACCTAT GGGATTGACT CGATTTATCT ATTAGTTGGG

61 GAAGTTTGGC AGTATTTCTG CTCTTGGAGC AAACAGTAAA ACTCGAGCTG GTGTTGACAG

121 GAACATTTGA TGATGATGAT GCAGTGAGTT TCAATTGATA TAACCCATTG TTAAGCACTC

181 CCCGAAGCAC CTCCTCCTTC GAGATCAGAT CCTTCACAAC ACAAAAATCA GCATAAAATT

241 CCACATACAC TTTGTTATCT TTGGTTAGCT AGACAATAGA TTTTTAGAGA TTTCAGGTAC

301 ACAAAGTATA TCATTAAGCA CTAAATAGTC GGTTGAGTCA TGGATCTTAC TGAGCCAAAT

361 CTAGTTACGG CTAAGGGAAA TCCATTACCA ACAAGCAGTT GTGTAGTACC TTTCATATCA

421 GTTTTATGCT GTATGTTGGA TGGTTCAGAG GTGGTGTGAT TAGTGGCTCC ACTATCGATA

481 TACCAGAATT GCCGGCATGC TGGTGAAAAA GGCTTGTTGA TCATTGTTTG AGTGGATGTT

541 GTTGTTGTTT TGAGAGGCTC ATGGTTGACT GGAACGAGGA GCTAGAAAAT GAT

<210> 3

<211> 27

<212> DNA

<213> SP1F

<400> 3

CTAGA GGCCG ATAAT TGACT GGAAC CT

<210> 4

<211> 26

<212> DNA

<213> SPF1

<400> 4

CAAAC AACAA CAAAC CGATA TGTCA G

<210>5

<211> 26

<212> DNA

<213> SP2F

<400> 5

AGATG TCAAA CTGGT GGTAA CATTT T

<210>6

<211> 26

<212> DNA

<213> SPF2

<400> 6

AAAAT GTTAC CACCA GTTTG ACATC T

<210>7

<211> 26

<212> DNA

<213> SP3F

<400> 7

CTGAC ATATC GGTTT GTTGT TGTTT G

<210>8

<211> 27

<212> DNA

<213> SPF3

<400> 8

AGGTT CCAGT CAATT ATCGG CCTCT AG

<210>9

<211> 16

<212> protein

<213> AD1

<400> 9

NGTCG ASWGA NAWGA A

<210>10

<211> 16

<212> protein

<213> AD2

<400>10

WGTGN AGWAN CANAG A

<210>11

<211> 16

<212> protein

<213> AD3

<400> 11

AGWGN AGWAN CAWAG G

<210>12

<211> 16

<212> protein

<213> AD4

<400> 12

GTNCG ASWCA NAWGT T

<210>13

<211> 16

<212> protein

<213> AD5

<400> 13

TCSTN CGNAC NTWGG A

<210>14

<211> 16

<212> protein

<213> AD6

<400> 14

CAWCG NCNGA NASGA A

<210>15

<211> 39

<212> DNA

<213> F1

<400> 15

GAAGG TGACC AAGTT CATGC TAGCA CCTCC TCCTT CGAG

<210>16

<211> 39

<212> DNA

<213> F2

<400>16

GAAGG TCGGA GTCAA CGGAT TAGCA CCTCC TCCTT CGAT

<210>17

<211> 29

<212> DNA

<213> R

<400> 17

GAATT TTATG CTGAT TTTTG TGTTG TGAA

Claims

1. The method for screening the industrial hemp sex-linked SNP molecular marker is characterized by comprising the following steps:

2. The method for screening industrial cannabis sativa sex-linked SNP molecular markers according to claim 1, wherein the male specific sequence fragment is a MADC6 fragment, the sequence of which is shown in SEQ ID No.1, and the flanking sequence is WBSDMY604, the sequence of which is shown in SEQ ID No. 2.

3. The method for screening industrial hemp sex-linked SNP molecular markers according to claim 1, wherein the plurality of pairs of specific primers are six forward and reverse specific primers, SP1F and SPF1, SP2F and SPF2, and SP3F and SPF3, and the sequences of the SP1F and SPF1, the SP2F and SPF2, and the SP3F and SPF3 are shown as SEQ ID No. 3-8.

4. The method for screening industrial cannabis sativa sex-linked SNP molecular markers according to claim 1, wherein the plurality of pairs of random degenerate primers are six forward and reverse degenerate primers, including AD1 and AD2, AD3 and AD4, and AD5 and AD6, and the sequences of AD1 and AD2, AD3 and AD4, and AD5 and AD6 are shown as SEQ ID No. 9-14.

5. The method for screening industrial cannabis sativa sex-linked SNP molecular markers according to claim 1, wherein the multiple PCR amplification reactions are three PCR amplification reactions including a first PCR amplification reaction, a second PCR amplification reaction and a third PCR amplification reaction.

6. The method for screening industrial cannabis sativa sex-linked SNP molecular markers according to claim 5, wherein the reaction system of the first round of PCR amplification reaction is as follows: taq Mix 10. mu.l, SP1F and SPF 11. mu.l, random degenerate primer 4. mu.l, hemp genomic DNA 1. mu.l and ddH₂O4. mu.l, 20. mu.l in total; the reaction system of the second round of PCR amplification reaction is as follows: taq Mix 10. mu.l, SP2F and SPF 21. mu.l, random degenerate primer 4. mu.l, first round PCR amplification reaction product dilution 1. mu.l and ddH₂O4. mu.l, 20. mu.l in total; the reaction system of the third round of PCR amplification reaction is as follows: taq Mix 10. mu.l, SP3F and SPF 31. mu.l, random degenerate primer 4. mu.l, second round PCR amplification reaction product dilution 1. mu.l and ddH₂O4. mu.l, 20. mu.l in total.

7. The method for screening industrial cannabis sativa sex-linked SNP molecular markers according to claim 5, wherein the reaction conditions of the first round of PCR amplification reaction are as follows:

s6, extension at 72 ℃ for 2min, wherein steps S4 and S5 total 15 cycles;

8. The method for screening industrial cannabis sativa sex-linked SNP molecular markers according to claim 1, further comprising a step of verifying the accuracy of the SNP molecular markers, specifically:

9. An industrial hemp sex-linked SNP molecular marker, which is obtained by screening by the screening method according to any one of claims 1 to 8.

10. The use of industrial hemp gender-linked SNP molecular markers according to claim 9 for the identification of industrial hemp male and female strains.