CN113151534A

CN113151534A - Transgenic maize event LP007-5 and methods of detecting same

Info

Publication number: CN113151534A
Application number: CN202110113309.1A
Authority: CN
Inventors: 吕玉平; 刘枫; 孙宇; 费小红; 赵丽媛; 李涛; 张原�; 贺志豪; 李斌; 李琪; 卢娟; 易金麒; 韩雨颖
Original assignee: Longping Biotechnology Hainan Co ltd
Current assignee: Longping Biotechnology Hainan Co ltd
Priority date: 2021-01-27
Filing date: 2021-01-27
Publication date: 2021-07-23
Anticipated expiration: 2041-01-27
Also published as: CN113151534B

Abstract

The present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NOs 1-7 and complements thereof, derived from a plant, seed or cell comprising corn event LP007-5, a representative sample of seed comprising said event having been deposited under deposit number CCTCC NO: P202018. Transgenic corn event LP007-5 of the present invention is resistant to feeding damage by lepidopteran pests and is resistant to the phytotoxic effects of glyphosate-containing agricultural herbicides. The maize plant with dual characters has the following advantages: avoiding economic losses due to lepidopteran pests; the glyphosate-containing agricultural herbicide may be applied to a corn crop; the corn yield is not reduced; enhance breeding efficiency and can use molecular markers to track the transgene insert in breeding populations and progeny thereof. Meanwhile, the detection method provided by the invention can quickly, accurately and stably identify the existence of the plant material derived from the transgenic corn event LP 007-5.

Description

Transgenic maize event LP007-5 and methods of detecting same

Technical Field

The invention belongs to the technical field of molecular biology, and relates to a transgenic plant and a detection method of a product thereof, in particular to a transgenic corn event LP007-5 which is resistant to insects and tolerant to application of glyphosate herbicide, a nucleic acid sequence and a method for detecting the transgenic corn LP 007-5.

Background

Corn (Zea mays L.) is a major food crop in many parts of the world. Biotechnology has been applied to corn to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in corn production, particularly resistance to lepidopteran insects (e.g., corn borer, cotton bollworm, spodoptera frugiperda, armyworm, and the like). The lepidopteran resistance of corn can be obtained by expressing a lepidopteran resistance gene in a corn plant by a transgenic method. Another agronomic trait of interest is herbicide tolerance, particularly tolerance to glyphosate herbicide. Tolerance to glyphosate herbicide in corn can be achieved by transgenic methods that express a glyphosate herbicide tolerant gene (e.g., epsps) in the corn plant.

It is known that expression of foreign genes in plants is influenced by their chromosomal location, possibly due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site. For this reason, it is often necessary to screen a large number of events in order to be able to identify a commercializable event (i.e., an event in which the introduced gene of interest is optimally expressed). For example, it has been observed in plants and other organisms that the amount of expression of an introduced gene may vary greatly between events; differences in the spatial or temporal pattern of expression may also exist, such as differences in the relative expression of the transgene between different plant tissues, in that the actual expression pattern may not be consistent with the expected expression pattern of the transcriptional regulatory elements in the introduced gene construct. Thus, it is often necessary to generate hundreds to thousands of different events and to screen those events for a single event with the amount and pattern of transgene expression expected for commercial purposes. Such transformation events have excellent lepidopteran pest (e.g., asian corn borer, spodoptera frugiperda, oriental armyworm, spodoptera frugiperda, cotton bollworm, black cutworm, dichocrocis punctiferalis, etc.) and glyphosate herbicide resistance without affecting corn yield, and can be used to backcross transgenes into other genetic backgrounds by hybridization using conventional breeding methods. The progeny produced by this crossing retain the transgenic expression characteristics and trait performance of the original transformants. The strategy mode can ensure reliable gene expression in a plurality of varieties, has stable lepidoptera pest resistance (such as Asian corn borer, Spodoptera frugiperda, oriental armyworm, Spodoptera frugiperda, cotton bollworm, black cutworm, dichocrocis punctiferalis and the like) and glyphosate herbicide resistance, prevents the varieties from being harmed by main lepidoptera pests, has broad-spectrum weed control capability, and can well adapt to local growth conditions.

It would be beneficial to be able to detect the presence of particular events to determine whether progeny of a sexual cross contain a gene of interest. In addition, methods for detecting specific events will also help to comply with relevant regulations, such as the need for food derived from recombinant crops to be officially approved and labeled prior to introduction to the market. It is possible to detect the presence of a transgene by any well-known polynucleotide detection method, such as Polymerase Chain Reaction (PCR) or DNA hybridization using a polynucleotide probe. These detection methods usually focus on commonly used genetic elements such as promoters, terminators, marker genes, and the like. Thus, unless the sequence of chromosomal DNA adjacent to the inserted transgenic DNA ("flanking DNA") is known, this method described above cannot be used to distinguish between different events, particularly those produced with the same DNA construct. Therefore, it is now common to identify specific events of a transgene by PCR using a pair of primers spanning the junction of the inserted transgene and flanking DNA, specifically a first primer comprising the flanking sequence and a second primer comprising the inserted sequence.

Disclosure of Invention

The invention aims to provide a transgenic corn event LP007-5, a nucleic acid sequence for detecting a corn plant LP007-5 event and a detection method thereof, which can accurately and quickly identify whether a biological sample contains a specific DNA molecule of the transgenic corn event LP 007-5.

To achieve the above object, the present invention provides a nucleic acid sequence comprising one or more selected from the sequences SEQ ID NO 1-7 (i.e., SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7) and complementary sequences thereof. In some embodiments, the nucleic acid sequence is derived from a plant, seed, or cell comprising corn event LP007-5, wherein the corn seed LP007-5 comprising the event has been deposited with accession number CCTCC NO: P202018, deposited at the China center for type culture Collection (CCTCC, address: Wuhan university Collection, Inc. of Wuhan, Wuhan city, Wuchan, Bayu 299, Wuhan university Collection, postal code 430072) on a date of 12 months and 6 days 2020. In some embodiments, the nucleic acid sequence is an amplicon diagnostic for the presence of maize event LP 007-5.

In some embodiments of the invention, the invention provides a nucleic acid sequence comprising at least 11 contiguous nucleotides of SEQ ID NO. 3 or the complement thereof, and/or at least 11 contiguous nucleotides of SEQ ID NO. 4 or the complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID No. 1 or a complement thereof, and/or SEQ ID No. 2 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID No. 3 or a complement thereof, and/or SEQ ID No. 4 or a complement thereof. In some embodiments, the nucleic acid sequence comprises SEQ ID No. 5 or a complement thereof.

The SEQ ID No. 1 or its complement is a 22 nucleotide long sequence located near the insertion junction at the 5 'end of the insertion sequence in transgenic maize event LP007-5, the SEQ ID No. 1 or its complement spans the flanking genomic DNA sequences of the maize insertion site and the DNA sequence at the 5' end of the insertion sequence, and the inclusion of the SEQ ID No. 1 or its complement identifies the presence of transgenic maize event LP 007-5. The SEQ ID No. 2 or its complement is a 22 nucleotide long sequence located near the insertion junction at the 3 'end of the insertion sequence in transgenic maize event LP007-5, the DNA sequence of SEQ ID No. 2 or its complement spanning the 3' end of the insertion sequence and flanking genomic DNA sequences of the maize insertion site, the inclusion of SEQ ID No. 2 or its complement being identifiable as the presence of transgenic maize event LP 007-5.

The nucleic acid sequence provided by the present invention may be at least 11 or more contiguous polynucleotides of any portion of the transgene insert sequence in said SEQ ID NO:3 or the complement thereof (first nucleic acid sequence) or at least 11 or more contiguous polynucleotides of any portion of the 5' flanking maize genomic DNA region in said SEQ ID NO:3 or the complement thereof (second nucleic acid sequence). The nucleic acid sequence may further be homologous or complementary to a portion of said SEQ ID NO. 3 comprising the entire said SEQ ID NO. 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a pair of DNA primers in a DNA amplification method that produces an amplification product. The presence of transgenic maize event LP007-5 or progeny thereof can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO: 1. It is well known to those skilled in the art that the first and second nucleic acid sequences need not consist of only DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA or other nucleotides or analogs thereof that are not used as templates for one or more polymerases. In addition, the probe or primer of the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides in length, which may be selected from the nucleotides set forth in SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQ ID NO 5. When selected from the nucleotides set forth in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, the probes and primers may be contiguous nucleotides of at least about 17 to about 50 or more in length. The SEQ ID NO 3 or its complement is a 1454 nucleotide sequence of transgenic maize event LP007-5 located near the insertion junction at the 5 'end of the insertion, the SEQ ID NO 3 or its complement consisting of the maize flanking genomic DNA sequence of 958 nucleotides (nucleotides 1-958 of SEQ ID NO: 3), the pLP007 construct DNA sequence of 379 nucleotides (nucleotides 959-1337 of SEQ ID NO: 3) and the 3' end DNA sequence of the Nos terminator of 117 nucleotides (nucleotides 1338-1454 of SEQ ID NO: 3), inclusion of the SEQ ID NO:3 or its complement identifies the presence of transgenic maize event LP 007-5.

The nucleic acid sequence may be at least 11 or more contiguous polynucleotides of any portion of the transgene insert sequence in SEQ ID No. 4 or its complement (third nucleic acid sequence), or at least 11 or more contiguous nucleotides of any portion of the 3' flanking corn genomic DNA region in SEQ ID No. 4 or its complement (fourth nucleic acid sequence). The nucleic acid sequence may further be homologous or complementary to a portion of said SEQ ID NO. 4 comprising the entire said SEQ ID NO. 2. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences comprise a pair of DNA primers in a DNA amplification method that produces an amplification product. The presence of the transgenic maize event LP007-5 or progeny thereof can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO 2. The SEQ ID NO:4 or its complement is a 1335 nucleotide sequence of transgenic maize event LP007-5 located near the insertion junction at the 3' end of the insertion sequence, the SEQ ID NO:4 or its complement is comprised of a 53 nucleotide tNOs (nopaline synthase) transcription terminator sequence (nucleotides 1-53 of SEQ ID NO: 4), a 158 nucleotide pLP007 construct DNA sequence (nucleotides 54-211 of SEQ ID NO: 4), and a maize integration site flanking genomic DNA sequence (nucleotides 212-1335 of SEQ ID NO: 4) of nucleotides, the inclusion of the SEQ ID NO:4 or its complement identifies the presence of transgenic maize event LP 007-1124.

5 or its complement is a 18222 nucleotide long sequence characterizing transgenic maize event LP007-5, which specifically comprises the genomic and genetic elements shown in table 1. The presence of transgenic maize event LP007-5 can be identified by inclusion of the SEQ ID No. 5 or its complement.

TABLE 1 genomic and genetic elements encompassed by SEQ ID NO 5

The nucleic acid sequence or a complement thereof can be used in a DNA amplification method to produce an amplification product, the detection of which diagnoses the presence of transgenic corn event LP007-5 or progeny thereof in a biological sample; the nucleic acid sequences or complements thereof can be used in nucleotide detection assays to detect the presence of transgenic maize event LP007-5 or progeny thereof in a biological sample.

The invention provides a pair of DNA primers comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a fragment of SEQ ID No. 5 or a complement thereof and, when used in an amplification reaction with DNA comprising maize event LP007-5, produce an amplification product that detects maize event LP007-5 in a sample.

In some embodiments, the first primer is selected from SEQ ID NO. 1 or a complement thereof, SEQ ID NO. 8 or SEQ ID NO. 12; the second primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14.

In some embodiments of the invention, the amplification product comprises at least 11 contiguous nucleotides of SEQ ID NO. 3 or the complement thereof, or at least 11 contiguous nucleotides of SEQ ID NO. 4 or the complement thereof.

Further, the amplification product includes the 1 st to 11 th or 12 th to 22 nd consecutive nucleotides of SEQ ID NO. 1 or its complementary sequence, or the 1 st to 11 th or 12 th to 22 nd consecutive nucleotides of SEQ ID NO. 2 or its complementary sequence.

Still further, the amplification product comprises SEQ ID NO. 1 or a complement thereof, SEQ ID NO. 2 or a complement thereof, SEQ ID NO. 6 or a complement thereof, or SEQ ID NO. 7 or a complement thereof.

In the above technical solution, the primer comprises at least one of the nucleic acid sequences. Specifically, the primers comprise a first primer and a second primer, wherein the first primer is selected from SEQ ID NO. 1 or a complementary sequence thereof, SEQ ID NO. 8 or SEQ ID NO. 12, and the second primer is selected from SEQ ID NO. 9 or SEQ ID NO. 13; or the first primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14, and the second primer is selected from SEQ ID NO. 10 or SEQ ID NO. 15.

The invention also provides a DNA probe comprising a fragment of SEQ ID NO. 5 or a complementary sequence thereof, which hybridizes under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO. 1 to 7 or a complementary sequence thereof and does not hybridize under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from SEQ ID NO. 1 to 7 or a complementary sequence thereof.

In some embodiments, the DNA probe comprises a sequence selected from SEQ ID NO 1 or its complement, SEQ ID NO 2 or its complement, SEQ ID NO 6 or its complement, and SEQ ID NO 7 or its complement.

In some embodiments, the DNA probe is labeled with a fluorophore.

In some embodiments, the probe comprises at least 11 contiguous nucleotides of SEQ ID No. 3 or the complement thereof, or at least 11 contiguous nucleotides of SEQ ID No. 4 or the complement thereof; further, the probe includes the 1 st to 11 th or 12 th to 22 th continuous nucleotides of SEQ ID NO. 1 or its complementary sequence, or the 1 st to 11 th or 12 th to 22 th continuous nucleotides of SEQ ID NO. 2 or its complementary sequence.

The invention also provides a marker nucleic acid molecule comprising a fragment of SEQ ID NO. 5 or the complement thereof, which hybridizes under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO. 1 to 7 or the complement thereof and does not hybridize under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from SEQ ID NO. 1 to 7 or the complement thereof.

In some embodiments, the marker nucleic acid molecule comprises a sequence selected from SEQ ID NO 1 or a complement thereof, SEQ ID NO 2 or a complement thereof, SEQ ID NO 6 or a complement thereof, and SEQ ID NO 7 or a complement thereof.

In one embodiment, the marker nucleic acid molecule comprises at least 11 contiguous nucleotides of SEQ ID No. 3 or the complement thereof, or at least 11 contiguous nucleotides of SEQ ID No. 4 or the complement thereof;

in some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides 1 to 11 or 12 to 22 of SEQ ID NO. 1 or the complement thereof, or consecutive nucleotides 1 to 11 or 12 to 22 of SEQ ID NO. 2 or the complement thereof.

Further, the present invention provides a method of detecting the presence of DNA comprising transgenic maize event LP007-5 in a sample comprising:

(1) contacting a sample to be detected with the DNA primer pair in a nucleic acid amplification reaction;

(2) performing a nucleic acid amplification reaction;

(3) detecting the presence of the amplification product;

the amplification product comprises a nucleic acid sequence selected from the group consisting of sequences SEQ ID NOS: 1-7 and complements thereof, i.e., indicates the presence of DNA comprising transgenic maize event LP007-5 in a test sample.

The present invention also provides a method of detecting the presence of DNA comprising transgenic corn event LP007-5 in a sample comprising:

(1) contacting the sample to be tested with said DNA probe, and/or said marker nucleic acid molecule;

(2) hybridizing the sample to be tested with the probe and/or the marker nucleic acid molecule under stringent hybridization conditions;

(3) detecting the hybridization of the sample to be detected with the probe and/or the marker nucleic acid molecule.

The stringent conditions may be hybridization in a 6 XSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfate) solution at 65 ℃ and then washing the membrane 1 time each with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Wherein, the hybridization between the sample to be detected and the marker nucleic acid molecule is detected, and then the insect resistance and/or herbicide tolerance is determined to be genetically linked with the marker nucleic acid molecule through marker-assisted breeding analysis.

The present invention also provides a DNA detection kit comprising: a pair of DNA primers that produces an amplicon diagnostic for transgenic maize event LP007-5, a probe specific for SEQ ID NOS: 1-7 or a marker nucleic acid molecule specific for SEQ ID NOS: 1-7. Specifically, the detection kit comprises the probe, the primer pair or the marker nucleic acid molecule.

In some embodiments, the invention provides a DNA detection kit comprising at least one DNA molecule comprising at least 11 contiguous nucleotides of the homologous sequence of SEQ ID No. 3 or the complement thereof, or at least 11 contiguous nucleotides of the homologous sequence of SEQ ID No. 4 or the complement thereof, which can serve as a DNA primer or probe specific for transgenic corn event LP007-5 or progeny thereof.

Further, the DNA molecule includes the 1 st to 11 th or 12 th to 22 nd consecutive nucleotides of SEQ ID NO. 1 or its complementary sequence, or the 1 st to 11 th or 12 th to 22 nd consecutive nucleotides of SEQ ID NO. 2 or its complementary sequence.

Further, the DNA molecule comprises the homologous sequence of SEQ ID NO. 1 or a complementary sequence thereof, the homologous sequence of SEQ ID NO. 2 or a complementary sequence thereof, the homologous sequence of SEQ ID NO. 6 or a complementary sequence thereof, or the homologous sequence of SEQ ID NO. 7 or a complementary sequence thereof. To achieve the above object, the present invention also provides a plant cell comprising a nucleic acid sequence encoding insect-resistant Cry1Ab, Cry2Ab, and Vip3Aa proteins, a nucleic acid sequence encoding a glyphosate herbicide-tolerant EPSPS protein, and a nucleic acid sequence of a specific region comprising the sequence shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 6, or SEQ ID No. 7.

The sequences provided by the present invention include those listed in table 2 below:

TABLE 2 related sequences of the invention

The present invention also provides a method of protecting a corn plant from insect infestation comprising providing at least one transgenic corn plant cell comprising transgenic corn event LP007-5 in the diet of a target insect; target insects that feed on the transgenic corn plant cell are inhibited from further feeding on the corn plant.

The present invention also provides a method of protecting a corn plant from herbicide-induced damage by growing at least one transgenic corn plant comprising transgenic corn event LP 007-5. In some embodiments, the method comprises applying an effective dose of glyphosate herbicide to a field in which at least one transgenic corn plant comprising transgenic corn event LP007-5 is grown.

The present invention also provides a method of controlling weeds in a field planted with corn plants comprising applying a herbicide comprising an effective dose of glyphosate to the field planted with at least one transgenic corn plant comprising transgenic corn event LP 007-5.

The present invention also provides a method of growing an insect resistant corn plant comprising: planting at least one corn seed comprising transgenic corn event LP 007-5;

growing the corn seed into a corn plant;

attacking said corn plant with a target insect, and/or spraying said corn plant with an effective dose of glyphosate herbicide, results in a plant having reduced plant damage compared to other plants not comprising said transgenic corn event LP 007-5.

In some embodiments, the present invention provides a method of growing a corn plant that is resistant to insects and tolerant to glyphosate herbicide, comprising:

planting at least one corn seed comprising transgenic corn event LP 007-5;

growing the corn seed into a corn plant;

spraying the corn plants with an effective dose of glyphosate herbicide, harvesting plants having reduced plant damage that are also resistant to feeding damage by the insect as compared to other plants not having the transgenic corn event LP 007-5.

In some embodiments, the invention also provides a method of producing a maize plant that is resistant to insects, comprising introducing transgenic maize event LP007-5 into the genome of said maize plant, selecting a maize plant that has reduced plant damage to insect feeding. In some embodiments, the method comprises: sexually crossing a first parent corn plant of transgenic corn event LP007-5 that is resistant to insects with a second parent corn plant that lacks insect resistance, thereby producing a plurality of progeny plants; (ii) infesting the progeny plant with a target insect; selecting the progeny plant having reduced plant damage compared to other plants not having transgenic maize event LP 007-5.

In some embodiments, the present invention also provides a method of producing a corn plant that is tolerant to glyphosate herbicide comprising introducing transgenic corn event LP007-5 into the genome of said corn plant, selecting a corn plant that is tolerant to glyphosate. In some embodiments, the method comprises: sexually crossing a first parental maize plant of transgenic maize event LP007-5 that is tolerant to glyphosate herbicide with a second parental maize plant lacking glyphosate tolerance, thereby producing a plurality of progeny plants; treating said progeny plants with glyphosate herbicide; selecting said progeny plants that are tolerant to glyphosate.

In some embodiments, the present invention also provides a method of producing a corn plant that is resistant to insects and tolerant to application of glyphosate herbicide, comprising: transgenic maize event LP007-5 was introduced into the genome of the maize plants and maize plants that were tolerant to glyphosate and insect resistant were selected. In some embodiments, the method comprises sexually crossing a first parent corn plant of the glyphosate tolerant and insect resistant transgenic corn event LP007-5 with a second parent corn plant lacking glyphosate tolerance and/or insect resistance, thereby producing a plurality of progeny plants; treating said progeny plants with glyphosate; selecting said progeny plants that are tolerant to glyphosate, said progeny plants that are tolerant to glyphosate also being resistant to feeding damage by insects.

The present invention also provides a composition for producing autogenic corn event LP007-5, said composition being corn flour, corn oil, corn cobs, or corn starch. In some embodiments, the composition may be an agricultural or commercial product such as corn flour, corn oil, corn starch, corn gluten, corn tortilla, cosmetics, or bulking agents. If sufficient expression is detected in the composition, the composition is expected to contain a nucleic acid sequence capable of diagnosing the presence of the transgenic maize event LP007-5 material in the composition. In particular, the compositions include, but are not limited to, corn oil, corn meal, corn flour, corn gluten, corn tortillas, corn starch, and any other food product to be consumed by an animal as a food source, or otherwise used for cosmetic purposes as a bulking agent or ingredient in a cosmetic composition, and the like.

The probe or primer pair based detection methods and/or kits of the invention can be employed to detect a transgenic corn event LP007-5 nucleic acid sequence, such as shown in SEQ ID NO 1 or SEQ ID NO 2, in a biological sample, wherein the probe sequence or primer sequence is selected from the group consisting of the sequences shown in SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, and SEQ ID NO 5, to diagnose the presence of a transgenic corn event LP 007-5.

In conclusion, the transgenic corn event LP007-5 has dual traits of insect resistance and herbicide resistance, and has the following advantages: 1) the corn borer is free from economic loss caused by lepidoptera pests (such as Asian corn borers, Spodoptera frugiperda, Oriental armyworms, Spodoptera frugiperda, bollworms, agrotis cutanea, dichocrocis punctifera and the like), and the Asian corn borers, the Spodoptera frugiperda, the Oriental armyworms, the Spodoptera frugiperda, the cotton bollworms, the agrotis parvus and the dichocrocis punctiferalis and the like are main pests in a corn planting area; 2) the ability to apply glyphosate-containing agricultural herbicides to corn crops for broad-spectrum weed control; 3) the corn yield was not reduced. Specifically, the event LP007-5 of the invention achieves a high level of resistance to insects, can enable the death rate of pests to reach 100%, and protects plants to enable the damage rate to be as low as 0%; the glyphosate herbicide tolerance is high, and the plant can be protected to reduce the damage rate to 0%; and the agronomic characters of the plants containing the event are excellent, and the yield percentage can reach 100 percent. Furthermore, the genes encoding the insect resistance and glyphosate tolerance traits are linked on the same DNA segment and are present at a single locus in the genome of transgenic maize event LP007-5, which provides enhanced breeding efficiency and enables the use of molecular markers to track the transgene insert in breeding populations and progeny thereof. Meanwhile, the primer or probe sequence provided by the detection method can generate an amplification product for diagnosing the transgenic corn event LP007-5 or the progeny thereof, and can quickly, accurately and stably identify the existence of the plant material derived from the transgenic corn event LP 007-5.

Term(s) for

The following definitions and methods may better define the invention and guide those of ordinary skill in the art in the practice of the invention, unless otherwise indicated, the terms are understood according to their conventional usage by those of ordinary skill in the art.

The "corn" refers to maize (Zea mays) and includes all plant species that can be mated with corn, including wild corn species.

The term "comprising" means "including but not limited to". The term "processed product" refers to a product obtained by processing a raw material such as a plant or a seed, for example, a composition.

The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps (plant cylinders), and plant cells that are intact in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stalks, roots, root tips, anthers, and the like. It is to be understood that parts of transgenic plants within the scope of the present invention, which are derived from transgenic plants or progeny thereof which have been previously transformed with a DNA molecule of the invention and thus consist at least in part of transgenic cells, include, but are not limited to, plant cells, protoplasts, tissue, callus, embryos, and flowers, stems, fruits, leaves, and roots.

The term "gene" refers to a nucleic acid fragment that expresses a particular protein, including regulatory sequences preceding the coding sequence (5 'non-coding sequences) and regulatory sequences following the coding sequence (3' non-coding sequences). "native gene" refers to a gene that is naturally found to have its own regulatory sequences. "chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences not found in nature. "endogenous gene" refers to a native gene that is located in its natural location in the genome of an organism. A "foreign gene" is a foreign gene that is present in the genome of an organism and that is not originally present, and also refers to a gene that has been introduced into a recipient cell by a transgenic procedure. The foreign gene may comprise a native gene or a chimeric gene inserted into a non-native organism. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The site in the plant genome at which the recombinant DNA has been inserted may be referred to as an "insertion site" or "target site".

"flanking DNA" may comprise the genome as it occurs naturally in an organism such as a plant or foreign (heterologous) DNA introduced by the transformation process, such as a fragment associated with the transformation event. Thus, flanking DNA may include a combination of native and foreign DNA. In the present invention, a "flanking region" or "flanking sequence" or "genomic boundary region" or "genomic boundary sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or more in length, which is located directly upstream or downstream of and adjacent to the originally exogenously inserted DNA molecule. When the flanking region is located downstream, it may also be referred to as "left border flanking" or "3 'genomic border region" or "genomic 3' border sequence" or the like. When the flanking region is located upstream, it may also be referred to as "right border flanking" or "5 'genomic border region" or "genomic 5' border sequence" or the like.

Transformation procedures that result in random integration of the exogenous DNA will result in transformants that contain different flanking regions that are specifically contained by each transformant. When the recombinant DNA is introduced into a plant by conventional crossing, its flanking regions are not usually altered. Transformants will also contain unique junctions between the heterologous insert DNA and segments of genomic DNA or between two segments of heterologous DNA. "junction" is the point at which two specific DNA fragments are joined. For example, the junction is present where the insert DNA joins the flanking DNA. A junction point is also present in a transformed organism where two DNA fragments are joined together in a manner that is modified in the way found in the native organism. "junction DNA" refers to DNA comprising a junction site.

The present invention provides a transgenic corn event designated LP007-5, and its progeny, said transgenic corn event LP007-5 being a corn plant LP007-5 comprising plants and seeds of transgenic corn event LP007-5 and plant cells or regenerable parts thereof, said plant parts of transgenic corn event LP007-5 including, but not limited to, cells, pollen, ovules, flowers, buds, roots, stems, silks, inflorescences, ears, leaves, and products from corn plant LP007-5, such as corn flour, corn oil, corn steep liquor, corn cobs, corn starch, and biomass left in the field of corn crops.

Transgenic corn event LP007-5 of the present invention comprises a DNA construct which when expressed in a plant cell, the transgenic corn event LP007-5 acquires resistance to insects and tolerance to glyphosate herbicide.

In some embodiments of the invention, the DNA construct comprises four expression cassettes in tandem, the first expression cassette comprising a suitable promoter for expression in a plant operably linked to a nucleic acid sequence operably linked to an insect-resistant Cry2Ab protein (ccy 2Ab) from bacillus thuringiensis, said Cry2Ab protein being lepidopteran insect-resistant; the second expression cassette consists of a nucleic acid sequence comprising a suitable promoter for expression in plants operably linked to an insect resistant Vip3Aa protein of Bacillus thuringiensis (cVip3Aa), said Vip3Aa being lepidopteran insect resistant; the third expression cassette comprises a suitable promoter for expression in plants operably linked to a nucleic acid sequence of a Cry1Ab protein, the nucleic acid sequence of the Cry1Ab protein being primarily resistant to lepidopteran insects, and a suitable polyadenylation signal sequence. The fourth expression cassette comprises a suitable promoter for expression in a plant operably linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) and a suitable polyadenylation signal sequence, the nucleic acid sequence of the EPSPS protein being tolerant to glyphosate herbicide. Further, the promoter may be a suitable promoter isolated from a plant, including constitutive, inducible and/or tissue specific promoters, suitable promoters include, but are not limited to, the cauliflower mosaic virus (CaMV)35S promoter, the Figwort Mosaic Virus (FMV)35S promoter, the Ubiquitin protein (Ubiquitin) promoter, the Actin (Actin) promoter, the Agrobacterium tumefaciens (Agrobacterium tumefaciens) nopaline synthase (NOS) promoter, the octopine synthase (OCS) promoter, the nocturnal (Cestrum) yellow leaf curly virus promoter, the potato tuber storage protein (Patatin) promoter, the ribulose-1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) promoter, the glutathione thiotransferase (GST) promoter, the E9 promoter, the GOS promoter, the alcA/alcR promoter, the Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promoter, and the Arabidopsis thaliana (Arabidopsis thaliana) Suc2 promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, cauliflower mosaic virus (CaMV)35S terminator, polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, and polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

In addition, the expression cassette may also include other genetic elements including, but not limited to, enhancers and signal peptide/transit peptide nucleic acid coding sequences. The enhancer may enhance the expression level of a gene, including, but not limited to, Tobacco Etch Virus (TEV) translational activator, CaMV35S enhancer, and FMV35S enhancer. The signal peptide/transit peptide may direct the transport of the Cry1Ab protein and/or EPSPS protein to a particular organelle or compartment outside or within the cell, e.g., targeting the chloroplast using a sequence encoding a chloroplast transit peptide, or targeting the endoplasmic reticulum using a 'KDEL' retention sequence.

The Cry1Ab, Cry2Ab and Vip3Aa genes can be obtained by separating from Bacillus thuringiensis (Bt for short), and the nucleic acid sequences of Cry1Ab, Cry2Ab and Vip3Aa genes can be changed by optimizing codons or in other ways, so that the purpose of increasing the stability and the availability of transcripts in transformed cells is achieved.

In some embodiments of the invention, a maize cell, seed or plant comprising transgenic maize event LP007-5 comprises in its genome the nucleic acid sequence of SEQ ID NO 1, SEQ ID NO 5 position 1530-17132 and SEQ ID NO 2, in that order, or comprises SEQ ID NO 5.

The Lepidoptera, the academic name Lepidoptera, comprises two kinds of insects, namely moths and butterflies, and is the most one of the insects in agriculture and forestry, such as corn borers, cotton bollworms, oriental armyworms, Spodoptera frugiperda, Athetis lepigone, dichocrocis punctifera and the like.

The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene may be isolated from Agrobacterium tumefaciens (Agrobacterium tumefaciens sp.) CP4 strain, and the polynucleotide encoding the EPSPS gene may be altered by codon optimization or in other ways to increase the stability and availability of the transcript in the transformed cell. The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selectable marker gene.

By "glyphosate" is meant N-phosphonomethylglycine and its salts and by "treatment with glyphosate herbicide" is meant treatment with any herbicide formulation containing glyphosate. The rate of use of a particular glyphosate formulation to achieve an effective biological dose is not chosen beyond the skill of the ordinary agronomic artisan. Treatment of a field containing plant material derived from transgenic corn event LP007-5 with any one of the glyphosate containing herbicide formulations will control weed growth in the field and not affect the growth or yield of plant material derived from transgenic corn event LP 007-5.

The DNA construct is introduced into a plant using transformation methods including, but not limited to, Agrobacterium-mediated transformation, biolistic transformation, and pollen tube channel transformation.

The Agrobacterium-mediated transformation method is a commonly used method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border consensus sequences of the vector, i.e.the T-DNA region. The vector is transformed into an agrobacterium cell, which is then used to infect plant tissue, and the T-DNA region of the vector comprising the foreign DNA is inserted into the plant genome.

The particle gun transformation method is to bombard plant cells with vectors containing exogenous DNA (particle-mediated biolistic transformation).

The pollen tube channel transformation method is characterized in that a natural pollen tube channel (also called a pollen tube guide tissue) formed after plant pollination is utilized, and exogenous DNA is carried into an embryo sac through a nucellar channel.

After transformation, transgenic plants must be regenerated from the transformed plant tissue and progeny with foreign DNA selected using appropriate markers.

A DNA construct is a combination of DNA molecules linked together to provide one or more expression cassettes. The DNA construct is in particular a plasmid which is capable of autonomous replication in bacterial cells and which contains various restriction sites for the introduction of DNA molecules providing functional genetic elements, i.e.promoters, introns, leaders, coding sequences, 3' terminator regions and other sequences. The expression cassette contained in the DNA construct, which includes the genetic elements necessary to provide for transcription of messenger RNA, can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of the invention are designed to be most specifically expressed in plant cells.

A transgenic "event" is obtained by transforming a plant cell with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, inserting into the plant genome by transgenic means to produce a plant population, regenerating said plant population, and selecting a specific plant characterized by the insertion of a specific genomic locus. The term "event" refers to both the original transformant comprising the heterologous DNA and progeny of the transformant. The term "event" also refers to progeny resulting from sexual crosses between a transformant and individuals of other varieties containing heterologous DNA, even after repeated backcrossing with the backcross parent, where the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the progeny of the cross. The term "event" also refers to a DNA sequence from an original transformant that comprises the inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which DNA sequence is expected to be transferred to progeny that result from sexual crossing of a parent line containing the inserted DNA (e.g., the original transformant and progeny resulting from selfing thereof) with a parent line that does not contain the inserted DNA, and which progeny has received the inserted DNA comprising the gene of interest.

"recombinant" in the context of the present invention refers to a form of DNA and/or protein and/or organism that is not normally found in nature and is therefore produced by human intervention. Such manual intervention may result in recombinant DNA molecules and/or recombinant plants. Such "recombinant DNA molecules" are obtained by artificially combining two otherwise isolated sequence segments, e.g., by chemical synthesis or by manipulating isolated nucleic acid segments by genetic engineering techniques. Techniques for performing nucleic acid manipulations are well known.

The term "transgene" includes any cell, cell line, callus, tissue, plant part or plant, the genotype of which is altered by the presence of heterologous nucleic acid, including the transgene originally so altered and progeny individuals generated from the original transgene by sexual crossing or asexual reproduction. In the present invention, the term "transgene" does not include changes (chromosomal or extra-chromosomal) in the genome by conventional plant breeding methods or naturally occurring events such as random allofertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

By "heterologous" in the context of the present invention is meant that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule may be derived from a first species and inserted into the genome of a second species. Such molecules are therefore heterologous to the host and are artificially introduced into the genome of the host cell.

Culturing transgenic corn event LP007-5 that is resistant to lepidopteran insects and tolerant to glyphosate herbicide can be accomplished by the steps of: first sexually crossing a first parent corn plant consisting of a corn plant grown from transgenic corn event LP007-5 and its progeny, said transgenic corn event LP007-5 and its progeny resulting from transformation with the lepidopteran insect-resistant glyphosate herbicide-tolerant expression cassette of the present invention, with a second parent corn plant lacking lepidopteran insect resistance and/or glyphosate herbicide tolerance, to produce a plurality of first generation progeny plants; progeny plants that are resistant to lepidopteran insect infestation and/or tolerant to glyphosate herbicide are then selected, and corn plants that are resistant to lepidopteran insects and tolerant to glyphosate herbicide can be grown. These steps can further include backcrossing the lepidopteran insect-resistant and/or glyphosate-tolerant progeny plants with the second or third parent corn plant, and then selecting the progeny by infestation with the lepidopteran insect, application of a glyphosate herbicide, or by identification of a trait-related molecular marker (e.g., a DNA molecule comprising a junction site identified by the 5 'end and the 3' end of the insertion sequence in transgenic corn event LP 007-5) to produce a corn plant that is resistant to lepidopteran insects and tolerant to the glyphosate herbicide.

It is also understood that two different transgenic plants may also be crossed to produce progeny containing two separate, separately added exogenous genes. Selfing of appropriate progeny can yield progeny plants that are homozygous for both added exogenous genes. Backcrossing of parental plants and outcrossing with non-transgenic plants as described above is also contemplated, as is asexual propagation.

The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent or enzyme, has been attached. Such a probe is complementary to one strand of the target nucleic acid, and in the present invention, the probe is complementary to one strand of DNA from the genome of transgenic corn event LP007-5, whether the genomic DNA is from transgenic corn event LP007-5 or a seed or plant or seed or extract derived from transgenic corn event LP 007-5. Probes of the invention include not only deoxyribonucleic or ribonucleic acids, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

The term "primer" is an isolated nucleic acid molecule that binds to a complementary target DNA strand by nucleic acid hybridization, annealing, forming a hybrid between the primer and the target DNA strand, and then extending along the target DNA strand under the action of a polymerase (e.g., a DNA polymerase). The primer pairs of the present invention are directed to their use in amplification of a target nucleic acid sequence, for example, by Polymerase Chain Reaction (PCR) or other conventional nucleic acid amplification methods.

Methods of designing and using primers and probes are well known in the art. DNA molecules comprising full length or fragments of SEQ ID NOS: 1-7 are useful as primers and probes for detecting maize event LP007-5 and can be readily designed by one skilled in the art using the sequences provided herein.

The length of the probes and primers is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers specifically hybridize to the target sequence under highly stringent hybridization conditions. Although probes that are different from and maintain the ability to hybridize to the target DNA sequence can be designed by conventional methods, it is preferred that the probes and primers of the present invention have complete DNA sequence identity to the contiguous nucleic acid of the target sequence.

Primers and probes based on the flanking genomic DNA and insertion sequences of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from transgenic maize event LP007-5 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises a transgene insert and a maize genomic flanking region, and fragments of the DNA molecule can be used as primers or probes.

The nucleic acid probes and primers of the invention hybridize to a target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic maize event LP007-5 in a sample. Nucleic acid molecules or fragments thereof are in certain cases capable of specific hybridization with other nucleic acid molecules. As used herein, two nucleic acid molecules can be said to be capable of specifically hybridizing to each other if they are capable of forming an antiparallel, double-stranded nucleic acid structure. Two nucleic acid molecules are said to be "complements" of one another if they exhibit complete complementarity. As used herein, a nucleic acid molecule is said to exhibit "perfect complementarity" when each nucleotide of the nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under conventional "highly stringent" conditions. Deviations from perfect complementarity may be tolerated as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. In order to allow a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in the sequence to allow the formation of a stable double-stranded structure in the particular solvent and salt concentrations employed.

As used herein, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes under highly stringent conditions to the complementary strand of a matched nucleic acid molecule. Suitable stringency conditions for promoting DNA hybridization include, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45 ℃ followed by a wash with 2.0 XSSC at 50 ℃, as is well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from the group consisting of about 2.0 XSSC for low stringency conditions, 50 ℃ to about 0.2 XSSC for high stringency conditions, 50 ℃. In addition, the temperature conditions in the washing step can be raised from about 22 ℃ at room temperature for low stringency conditions to about 65 ℃ for high stringency conditions. Both the temperature conditions and the salt concentration may be varied, or one may be held constant while the other is varied. In particular, a nucleic acid molecule of the invention can specifically hybridize to one or more of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6 and SEQ ID NO 7, or complements thereof, or any fragment thereof, under moderately stringent conditions, such as at about 2.0 XSSC and about 65 ℃. More specifically, a nucleic acid molecule of the invention specifically hybridizes under highly stringent conditions to one or more of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6 and SEQ ID NO 7, or a complement thereof, or any fragment thereof. In the context of the present invention, preferred marker nucleic acid molecules have SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 6 or SEQ ID NO 7 or the complement thereof or any fragment of the aforementioned sequences. Another preferred marker nucleic acid molecule of the invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 6 or SEQ ID NO 7 or the complement thereof or any fragment thereof. SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 6 and SEQ ID NO 7 can be used as markers in plant breeding methods to identify progeny of a genetic cross. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including, but not limited to, fluorescent, radioactive, antibody-based, and chemiluminescent labels.

With respect to amplification of a target nucleic acid sequence using a particular amplification primer (e.g., by PCR), "stringent conditions" refer to conditions that allow only hybridization of the primer to the target nucleic acid sequence in a DNA thermal amplification reaction, with a primer having a wild-type sequence (or its complement) corresponding to the target nucleic acid sequence that is capable of binding to the target nucleic acid sequence and preferably producing a unique amplification product, i.e., an amplicon.

The term "specifically binds (target sequence)" means that the probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample containing the target sequence.

As used herein, "amplified DNA," "amplification product," or "amplicon" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a corn plant was produced by sexual hybridization comprising the transgenic corn event LP007-5 of the present invention, or whether a corn sample collected from a field comprised the transgenic corn event LP007-5, or whether a corn extract, such as meal, flour, or oil, comprised the transgenic corn event LP007-5, DNA extracted from a corn plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon diagnostic for the presence of DNA of the transgenic corn event LP 007-5. The primer pair includes a first primer derived from a flanking sequence adjacent to the insertion site of the inserted foreign DNA in the plant genome, and a second primer derived from the inserted foreign DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic maize event LP 007-5. The amplicon may range in length from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred fifty nucleotide base pairs, and most preferably plus about four hundred fifty nucleotide base pairs or more.

Alternatively, primer pairs may be derived from flanking genomic sequences flanking the inserted DNA to produce amplicons that include the entire inserted nucleic acid sequence. One of the primer pairs derived from a plant genomic sequence may be located at a distance from the inserted DNA sequence that may range from one nucleotide base pair to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in the DNA thermal amplification reaction.

The nucleic acid amplification reaction may be carried out by any of the nucleic acid amplification reaction methods known in the art, including the Polymerase Chain Reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. The PCR amplification method has been developed to amplify 22kb of genomic DNA and 42kb of phage DNA. These methods, as well as other DNA amplification methods known in the art, can be used in the present invention. The inserted exogenous DNA sequence and flanking DNA sequences from transgenic corn event LP007-5 can be amplified by using the provided primer sequences to the genome of transgenic corn event LP007-5, followed by standard DNA sequencing of the PCR amplicons or cloned DNA.

DNA detection kits based on DNA amplification methods may contain DNA primer molecules that specifically hybridize to the target DNA and amplify the diagnostic amplicon under appropriate reaction conditions. The kit may provide an agarose gel based detection method or a number of methods known in the art for detecting diagnostic amplicons. Kits containing DNA primers homologous or complementary to any portion of the maize genomic region of SEQ ID NO 3 or SEQ ID NO 4, and to any portion of the transgene insert region of SEQ ID NO 5 are provided by the present invention. In particular, the primer pairs identified as useful in the DNA amplification method are SEQ ID NO 8 and SEQ ID NO 9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene/genomic region of transgenic maize event LP007-5, wherein the amplicon comprises SEQ ID NO 1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO 5.

Amplicons produced by these methods can be detected by a variety of techniques. One such method is Genetic Bit Analysis, which designs a DNA oligonucleotide strand spanning an intervening DNA sequence and adjacent flanking genomic DNA sequences. The oligonucleotide strand is immobilized within a microwell of a microwell plate, and after PCR amplification of the target region (using one primer in each of the intervening sequence and adjacent flanking genomic sequence), the single-stranded PCR product can hybridize to the immobilized oligonucleotide strand and serve as a template for a single-base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next desired base. The results can be obtained by fluorescence or ELISA-like methods. The signal represents the presence of the inserted/flanking sequence, indicating that the amplification, hybridization and single base extension reactions were successful.

Another method is Pyrosequencing (Pyrosequencing) technology. The method designs an oligonucleotide strand that spans the junction of the inserted DNA sequence and the adjacent genomic DNA. The oligonucleotide strand is hybridized to the single-stranded PCR product of the target region (using one primer in each of the intervening and adjacent flanking genomic sequences) and then incubated with DNA polymerase, ATP, sulfuryl enzyme, luciferase, apyrase, adenosine-5' -phosphate sulfate, and luciferin. dNTPs were added separately and the resulting optical signals were measured. The light signal represents the presence of the inserted/flanking sequence, indicating that the amplification, hybridization, and single or multiple base extension reactions were successful.

The fluorescence polarization phenomenon described by Chen et al (Genome Res.)9:492-498, 1999) is also one method that can be used to detect the amplicons of the present invention. Using this method requires the design of an oligonucleotide strand that spans the intervening DNA sequence and adjacent genomic DNA binding sites. The oligonucleotide strand is hybridized to the single stranded PCR product of the target region (using one primer each in the intervening sequence and in the adjacent flanking genomic sequence) and then incubated with DNA polymerase and a fluorescently labeled ddNTPs. Single base extension will result in insertion of ddNTPs. This insertion can be measured for changes in its polarization using a fluorometer. The change in polarization represents the presence of the inserted/flanking sequence, indicating that the amplification, hybridization and single base extension reactions were successful.

Taqman is described as a method for detecting and quantifying the presence of DNA sequences, which is described in detail in the instructions provided by the manufacturer. Briefly, as illustrated below, a FRET oligonucleotide probe is designed to span the inserted DNA sequence and adjacent genomic flanking binding sites. The FRET probe and PCR primers (one primer for each of the insert and adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage of the fluorescent and quenching moieties on the FRET probe and release of the fluorescent moiety. The generation of a fluorescent signal represents the presence of the inserted/flanking sequence, indicating that amplification and hybridization were successful.

Suitable techniques for detecting plant material derived from transgenic maize event LP007-5 based on hybridization principles can also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. In particular, the suitable technique involves incubating the probe and sample, washing to remove unbound probe and detecting whether the probe has hybridised. The detection method depends on the type of label attached to the probe, for example, a radiolabeled probe can be detected by X-ray film exposure and development, or an enzymatically labeled probe can be detected by a color change achieved by substrate conversion.

Tyangi et al (Nat. Biotech.)14:303-308, 1996) describe the use of molecular markers for sequence detection. Briefly, a FRET oligonucleotide probe is designed to span the inserted DNA sequence and adjacent genomic flanking binding sites. The unique structure of the FRET probe results in it containing a secondary structure that is capable of retaining both a fluorescent moiety and a quenching moiety in close proximity. The FRET probe and PCR primers (one primer for each of the flanking genomic sequences within the insert and adjacent) are cycled in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe to the target sequence results in loss of the secondary structure of the probe, thereby spatially separating the fluorescent moiety from the quencher moiety to produce a fluorescent signal. The generation of a fluorescent signal is representative of the presence of the inserted/flanking sequence, indicating that amplification and hybridization were successful.

Other described methods, such as microfluidics (microfluidics), provide methods and apparatus for isolating and amplifying DNA samples. The fluorochromes are used to detect and measure specific DNA molecules. A nano-tube (nanotube) device comprising an electronic sensor for detecting DNA molecules or nano-beads that bind to specific DNA molecules and can thus be detected is useful for detecting the DNA molecules of the present invention.

The DNA detection kit can be developed using the compositions described herein and methods described or known in the DNA detection art. The kit facilitates the identification of the presence of DNA of transgenic maize event LP007-5 in a sample and can also be used to cultivate maize plants containing DNA of transgenic maize event LP 007-5. The kit may contain DNA primers or probes homologous or complementary to at least a portion of

SEQ ID NO

1, 2, 3, 4 or 5, or other DNA primers or probes homologous or complementary to DNA contained in the transgenic genetic element of DNA, which DNA sequences may be used in DNA amplification reactions or as probes in DNA hybridization methods.

The DNA structure of the site of the maize genome containing the transgene insert and illustrated in figure 1 and table 1 comprises: a maize LP007-5 flanking genomic region located 5' to the transgenic insert, a portion of the insert from the right border Region (RB) of agrobacterium, a first expression cassette consisting of the figwort mosaic virus 35s promoter (prFMV), operably linked to the maize heat shock protein gene HSP70 protein intron (izmwsp 70), operably linked to the maize chloroplast transit peptide 2(spZmCTP2), operably linked to the insect resistant Cry2Ab protein (ccy 2Ab) of bacillus thuringiensis, operably linked to the nopaline synthase transcription terminator (tNos); the second expression cassette consists of tandem repeat maize ubiquitin gene promoter ubi (przmubi) containing enhancer region operably linked to insect resistance gene Vip3Aa (cVip3Aa) of bacillus thuringiensis operably linked to the 9 th intron of maize phosphoenolpyruvate carboxykinase gene operably linked to the 35s RNA sequence of cauliflower mosaic virus genome; the third expression cassette consists of cauliflower mosaic virus 35S promoter (pr35S), operably linked to the 5' untranslated leader sequence (lWtCab) of the wheat chloroplast a/b binding protein, operably linked to the rice actin gene 1 intron (iOsAct1), operably linked to the insect resistant Cry1Ab protein (ccy 1Ab) of bacillus thuringiensis, and operably linked to the terminator (tin2) of benzenesulfonamide inducible gene 2; the fourth expression cassette consists of the rice actin 1 promoter (prOsAct1), operably linked to the arabidopsis thaliana EPSPS chloroplast transit peptide (spAtCTP2), operably linked to the glyphosate tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (cEPSPS) of the agrobacterium CP4 strain, and operably linked to the nopaline synthase transcription terminator (tNos). A portion of the insert from the left border region (LB) of Agrobacterium, and the genomic region flanking the maize plant LP007-5 located at the 3' end of the transgenic insert (SEQ ID NO: 5). In the DNA amplification method, the DNA molecule used as a primer can be any portion derived from the transgene insert in transgenic maize event LP007-5, or any portion of the DNA region flanking the maize genome in transgenic maize event LP 007-5.

Transgenic corn event LP007-5 can be combined with other transgenic corn varieties, such as herbicide-tolerant corn (e.g., glufosinate, dicamba, etc.), or transgenic corn varieties carrying other insect-resistant genes (e.g., scarab, grub, diabrotica, etc.). Various combinations of all of these different transgenic events, when bred with transgenic corn event LP007-5 of the present invention, can provide improved hybrid transgenic corn varieties that are resistant to a variety of insect pests and to a variety of herbicides. These varieties can exhibit more excellent characteristics such as an increase in yield as compared with non-transgenic varieties and single-trait transgenic varieties.

The present invention provides transgenic corn event LP007-5, nucleic acid sequences useful for detecting corn plants comprising the event and methods for detecting the same, transgenic corn event LP007-5 is resistant to feeding damage by lepidopteran pests and is resistant to the phytotoxic effects of glyphosate-containing agricultural herbicides. The corn plants with the dual traits express Cry1Ab, Cry2Ab and Vip3Aa proteins of Bacillus thuringiensis, which provide resistance to feeding damage by lepidopteran pests (such as Asian corn borer, Spodoptera frugiperda); and which expresses a glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of agrobacterium strain CP4 which confers glyphosate tolerance to plants. The dual-character corn has the following advantages: 1) the corn borer is free from economic loss caused by lepidoptera pests (such as Asian corn borers, Spodoptera frugiperda, Oriental armyworms, Spodoptera frugiperda, cotton bollworms, cutworms, dichocrocis punctiferalis and the like), and the Asian corn borers, the Spodoptera frugiperda, the Oriental armyworms, the Spodoptera frugiperda, the cotton bollworms, the black cutworms, the dichocrocis punctiferalis and the like are main pests in a corn planting area; 2) the ability to apply glyphosate-containing agricultural herbicides to corn crops for broad-spectrum weed control; 3) the corn yield was not reduced. Specifically, the event LP007-5 of the invention achieves a high level of resistance to insects, can enable the mortality rate of pests to reach 100%, and protects plants to enable the pest rate to be as low as 0%; the glyphosate herbicide tolerance is high, and the plant can be protected to reduce the damage rate to 0%; and the agronomic characters of the plants containing the event are excellent, and the yield percentage can reach 100 percent. Furthermore, the genes encoding the insect resistance and glyphosate tolerance traits are linked on the same DNA segment and are present at a single locus in the genome of transgenic maize event LP007-5, which provides enhanced breeding efficiency and enables the use of molecular markers to track the transgene insert in breeding populations and progeny thereof. Meanwhile, the primer or probe sequence provided by the detection method can generate an amplification product for diagnosing the transgenic corn event LP007-5 or the progeny thereof, and can quickly, accurately and stably identify the existence of the plant material derived from the transgenic corn event LP 007-5.

Drawings

FIG. 1 is a schematic diagram showing the structure of the binding site of the transgene insert sequence and the maize genome for detecting the nucleic acid sequence LP007-5 of the maize plant and the detection method thereof according to the present invention;

FIG. 2 is a schematic structural diagram of a recombinant expression vector pLP007 for use in the detection of the nucleic acid sequence of the maize plant LP007-5 and the detection method thereof according to the present invention;

FIG. 3 is an ex vivo resistance effect on lepidopteran pests in transgenic maize of the present invention comprising transgenic maize event LP 007-5;

FIG. 4 is a graph of the effect of artificial inoculation of transgenic maize comprising transgenic maize event LP007-5 in the field of Zea mays borer according to the present invention;

FIG. 5 is a graph of the effect of artificial inoculation of transgenic maize of the invention comprising transgenic maize event LP007-5 in a Helicoverpa armigera field;

FIG. 6 is a plot of the field effect of transgenic corn of the invention comprising transgenic corn event LP007-5 under naturally occurring conditions of dichocrocis punctiferalis;

FIG. 7 is a plot of the field effect of transgenic maize of the invention comprising transgenic maize event LP007-5 under conditions naturally occurring with Spodoptera exigua;

FIG. 8 is a graph of the field effect of transgenic maize of the invention comprising transgenic maize event LP007-5 under conditions in which spodoptera frugiperda naturally occurs.

Fig. 9 is a field effect plot of the recommended spray concentration in a field sprayed with 4-fold doses of glyphosate herbicide for transgenic corn of the invention comprising transgenic corn event LP 007-5.

Detailed Description

The present invention will be described in further detail below with reference to examples. The features and advantages of the present invention will become more apparent from the exemplary descriptions.

The word "exemplary" is used exclusively herein to mean "serving as an example, embodiment, or illustration. Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.

In addition, the technical features involved in the different embodiments of the present invention described below may be combined with each other as long as no collision is formed therebetween.

The following embodiments further illustrate the technical scheme of the nucleic acid sequence for detecting the maize plant LP007-5 and the detection method thereof.

EXAMPLE 1 cloning and transformation

1.1 cloning of vectors

Recombinant expression vector pLP007 (shown in FIG. 2) was constructed using standard gene cloning techniques. The vector pLP007 comprises 4 transgenic expression cassettes in tandem, the first expression cassette consisting of the figwort mosaic virus 35s promoter (prFMV), operably linked to the intron of the heat shock protein gene HSP70 protein of maize (iZmHSP70), operably linked to the maize chloroplast transit peptide 2(spZmCTP2), operably linked to the insect resistant Cry2Ab protein of bacillus thuringiensis (ccy 2Ab), operably linked to the transcriptional terminator of nopaline synthase (tNos); the second expression cassette consists of tandem repeats of the maize ubiquitin gene promoter ubi (przmubi) containing an enhancer region operably linked to the insect resistance gene Vip3Aa (cVip3Aa) of bacillus thuringiensis operably linked to the 9 th intron of the maize phosphoenolpyruvate carboxykinase gene operably linked to the 35s RNA sequence of the cauliflower mosaic virus genome; the third expression cassette consists of a cauliflower mosaic virus 35S promoter (pr35S), operably linked to the 5' untranslated leader sequence (lWtCab) of the wheat chloroplast a/b binding protein, operably linked to the rice actin gene 1 intron (iOsAct1), operably linked to the insect resistant Cry1Ab protein (ccy 1Ab) of bacillus thuringiensis, and operably linked to the terminator (tin2) of benzenesulfonamide inducible gene 2; the fourth expression cassette consists of the rice actin 1 promoter (prOsAct1), operably linked to the arabidopsis thaliana EPSPS chloroplast transit peptide (spAtCTP2), operably linked to the glyphosate tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (cEPSPS) of the agrobacterium CP4 strain, and operably linked to the nopaline synthase transcription terminator (tNos). The vector pLP007 was transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA; Cat. No.: 18313-.

1.2 plant transformation

Transformation was performed by conventional Agrobacterium infection and the aseptically cultured maize embryos were co-cultured with Agrobacterium as described in example 1.1 to transfer the T-DNA of the constructed recombinant expression vector pLP007 into the maize genome to produce transgenic maize event LP 007-5.

For Agrobacterium-mediated transformation of maize, briefly, immature embryos are isolated from maize and the embryos are contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the nucleic acid sequence of the cry1Ab, cry2Ab, vip3Aa genes and the nucleic acid sequence of the epsps gene to at least one cell of one of the embryos (step 1: the infection step), in which the embryos are specifically immersed in an Agrobacterium suspension (OD660 ═ 0.4-0.6), an infection medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, Acetosyringone (AS)40mg/L, 2, 4-dichlorophenoxyacetic acid (2,4-D)1mg/L, pH5.3) to initiate inoculation, the embryos are co-cultured with Agrobacterium for a period of time (3 days) (step 2: the co-culturing step). The young embryos are cultured on a solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, Acetosyringone (AS)100mg/L, 2, 4-dichlorophenoxyacetic acid (2,4-D)1mg/L, agar 8g/L, pH5.8) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (cefamycin) is present in the recovery medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 2, 4-dichlorophenoxyacetic acid (2,4-D)1mg/L, plant gel 3g/L, pH5.8) without the addition of a selection agent for plant transformants (step 3: recovery step). In particular, young embryos are cultured on solid medium with antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selection agent (N- (phosphonomethyl) glycine) and the growing transformed calli are selected (step 4: selection step). Specifically, the immature embryos are cultured on a selective solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, N- (phosphonomethyl) glycine 0.25mol/L, 2, 4-dichlorophenoxyacetic acid (2,4-D)1mg/L, plant gel 3g/L, pH5.8) with a selective agent, resulting in selective growth of transformed cells. Then, the callus is regenerated into a plant (step 5: regeneration step), and specifically, the callus grown on the medium containing the selection agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate the plant.

The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, N- (phosphonomethyl) glycine 0.125mol/L, plant gel 3g/L, pH5.8), and cultured and differentiated at 25 ℃. The differentiated plantlets were transferred to the MS rooting medium (MS salts 2.15g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8), cultured at 25 ℃ until the height was about 10cm, and transferred to a greenhouse for fructification. In the greenhouse, the culture was carried out at 28 ℃ for 16 hours and at 20 ℃ for 8 hours each day.

1.3 identification and screening of transgenic events

A total of 1500 independent transgenic T0 individuals were generated.

Example 2 detection of transgenic maize event LP007-5 with TaqMan

Approximately 100mg of leaf discs of transgenic maize event LP007-5 were sampled, genomic DNA was extracted using the DNeasy plant Maxi Kit from Qiagen, and copy numbers of cry1Ab, cry2Ab, vip3Aa, and epsps were determined by Taqman probe fluorescent quantitative PCR. Meanwhile, wild corn plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.

The specific method comprises the following steps:

step 11, taking 100mg of leaves of transgenic corn event LP007-5, grinding the leaves into homogenate by using liquid nitrogen in a mortar, and taking 3 samples for each sample;

step 12, extracting the genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, and referring to the product specification of the specific method;

step 13, measuring the genomic DNA concentration of the sample by using NanoDrop 2000(Thermo Scientific);

step 14, adjusting the genomic DNA concentration of the sample to the same concentration value, wherein the concentration value range is 80-100 ng/mu l;

step 15, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with known copy number after identification as a standard substance, taking the sample of a wild-type corn plant as a control, repeating each sample for 3 times, and taking the average value of the samples; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:

the following primers and probes were used to detect the cry1Ab gene sequence:

primer 1: TGGGAGGACGGAATGATATTG is shown as SEQ ID NO:16 in the sequence list;

primer 2: AACTCGTCCGTGAGCATCATC is shown as SEQ ID NO:17 in the sequence list;

1, probe 1: AACTCCGCGCTGCGATGAATCC is shown as SEQ ID NO:18 in the sequence list;

the following primers and probes were used to detect the cry2Ab gene sequence:

primer 3: GGACAGAGGCACCGCATT is shown as SEQ ID NO:19 in the sequence list;

primer 4: CGGGTCTGCAAGCAAACG is shown as SEQ ID NO:20 in the sequence list;

and (3) probe 2: TCCACTTGGCGGTTGAACTCCTCC is shown as SEQ ID NO:21 in the sequence list;

the following primers and probes were used to detect the vip3Aa gene sequence:

primer 5: GGTGTCCTCGTAGTGGATGT is shown as SEQ ID NO. 22 in the sequence table;

primer 6: TGATCCAGTACACCGTGAAG is shown as SEQ ID NO. 23 in the sequence list;

and 3, probe 3: TTCAGGTGAATCGATGGC is shown as SEQ ID NO. 24 in the sequence table;

the following primers and probes were used to detect the epsps gene sequence:

primer 7: GCAAATCCTCTGGCCTTTCC is shown as SEQ ID NO. 25 in the sequence list;

primer 8: TGAAGGACCGGTGGGAGAT is shown as SEQ ID NO:26 in the sequence list;

and 4, probe 4: CGTCCGCATTCCCGGCGA is shown as SEQ ID NO:27 in the sequence list;

the PCR reaction system is

The 50 × primer/probe mixture contained 45 μ L of each primer at a concentration of 1mM, 50 μ L of probe at a concentration of 100 μ M and 860 μ L of 1 × TE buffer and was stored in amber tubes at 4 ℃.

The PCR reaction conditions are

Data were analyzed using SDS2.3 software (applied biosystems) to obtain a single copy of transgenic maize event LP 007-5.

Example 3 transgenic maize event LP007-5 detection

3.1 extraction of genomic DNA

DNA extraction was performed according to the conventionally used CTAB (cetyltrimethylammonium bromide) method: grinding 2 g of tender leaves of transgenic maize event LP007-5 into powder in liquid nitrogen, adding 0.5mL of DNA preheated at 65 ℃ to extract CTAB Buffer [20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylene diamine tetraacetic acid) ], adjusting the pH to 8.0 with NaOH, fully mixing uniformly, and extracting at 65 ℃ for 90 min; adding 0.5 times of phenol and 0.5 times of chloroform, reversing and mixing evenly; centrifuging at 12000rpm for 10 min; sucking supernatant, adding 1 volume of isopropanol, gently shaking the centrifuge tube, and standing at-20 deg.C for 30 min; centrifuging at 12000rpm for 10 min; collecting DNA to the bottom of the tube; discarding the supernatant, washing the precipitate with 0.5mL of 70% ethanol; centrifuging at 12000rpm for 5 min; vacuum pumping or drying in a super clean bench; the DNA pellet was dissolved in an appropriate amount of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and stored at-20 ℃.

3.2 analysis of flanking DNA sequences

And (3) carrying out concentration measurement on the extracted DNA sample so that the concentration of the sample to be measured is between 80 and 100 ng/. mu.L. The genomic DNA was digested with the selected restriction enzymes SpeI, PstI, BssHII (5 '-end analysis) and SacI, KpnI, XmaI, NheI (3' -end analysis), respectively. To each digestion system were added 26.5. mu.L of genomic DNA, 0.5. mu.L of the above selected restriction enzyme and 3. mu.L of digestion buffer, and the mixture was digested at an appropriate temperature for 1 hour. After the enzyme digestion is finished, 70 mu L of absolute ethyl alcohol is added into the enzyme digestion system, ice bath is carried out for 30min, and then the mixture is transferredCentrifuging at 12000rpm for 7min, discarding supernatant, blow-drying, and adding 8.5 μ L double distilled water (ddH)₂O), 1. mu.L of 10X T4 Buffer and 0.5. mu. L T4 ligase were ligated overnight at 4 ℃. PCR amplification with a series of nested primers isolates 5 'and 3' transgene/genomic DNA. Specifically, the primer combination for separating 5' transgene/genome DNA comprises SEQ ID NO 13 and SEQ ID NO 34 as first primers, SEQ ID NO 35 and SEQ ID NO 36 as second primers, and SEQ ID NO 13 as sequencing primers. The primer combination for separating the 3' transgene/genome DNA comprises SEQ ID NO 15 and SEQ ID NO 37 as first primers, SEQ ID NO 38 and SEQ ID NO 39 as second primers, SEQ ID NO 15 as a sequencing primer, and the PCR reaction conditions are shown in Table 3.

The obtained amplicons were electrophoresed on a 2.0% agarose Gel to separate the PCR reactions, followed by separation of the fragment of interest from the agarose matrix using QIAquick Gel extraction kit (catalog # 28704, Qiagen inc, Valencia, CA). The purified PCR products are then sequenced (e.g., ABI prism 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR inc., Madison, WI).

The 5 'and 3' flanking sequences and junction sequences were confirmed using standard PCR methods. The 5' flanking and junction sequences may be confirmed using SEQ ID NO 8 or 12 in combination with SEQ ID NO 9, 13 or 34. The 3' flanking and junction sequences may be confirmed using SEQ ID NO 11 or 14 in combination with SEQ ID NO 10, 15 or 37. The PCR reaction system and amplification conditions are shown in tables 2 and 3. One skilled in the art will appreciate that other primer sequences may also be used to confirm the flanking and junction sequences.

DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules that serve as primers and probes for the identification of maize plants or seeds derived from transgenic maize event LP 007-5.

It was found that the maize genomic sequence shown at nucleotides 1-1068 of SEQ ID NO:5 flanked the right boundary of the transgenic maize event LP007-5 insert (the 5 'flanking sequence), and that the maize genomic sequence shown at nucleotides 17184-18257 of SEQ ID NO:5 flanked the left boundary of the transgenic maize event LP007-5 insert (the 3' flanking sequence). The 5 'junction sequence is set forth in SEQ ID NO 1 and the 3' junction sequence is set forth in SEQ ID NO 2.

3.3 PCR conjugation assay

The adaptor sequence is a relatively short polynucleotide molecule that is a novel DNA sequence that is diagnostic for the DNA of transgenic maize event LP007-5 when detected in a polynucleic acid detection assay. The binding sequence of SEQ ID NO. 1 consists of 11bp each on one side of the T-DNARB region insertion site of transgenic maize event LP007-5 and the maize genomic DNA insertion site, and the binding sequence of SEQ ID NO. 2 consists of 11bp each on the other side of the T-DNARB region insertion site of transgenic maize event LP007-5 and the maize genomic DNA insertion site. Longer or shorter polynucleotide joining sequences may be selected from SEQ ID NO. 3 or SEQ ID NO. 4. The junction sequences (5 'junction region SEQ ID NO:1, and 3' junction region SEQ ID NO:2) are useful in DNA detection methods as DNA probes or as DNA primer molecules. The junction sequences SEQ ID NO 6 and SEQ ID NO 7 are also novel DNA sequences in transgenic maize event LP007-5 that can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic maize event LP007-5 DNA. The SEQ ID NO. 6 (nucleotides 959-1454 of SEQ ID NO. 3) spanned the LP007 construct DNA sequence and the tNOs transcription termination sequence, and the SEQ ID NO. 7 (nucleotides 1-211 of SEQ ID NO. 4) spanned the tNOs transcription termination sequence and the LP007 construct DNA sequence.

In addition, an amplicon is generated by using primers from at least one of SEQ ID NO 3 or SEQ ID NO 4 that when used in a PCR method produce a diagnostic amplicon of transgenic maize event LP 007-5.

Specifically, a PCR product is generated from the 5 'end of the transgene insert, which PCR product is a portion of genomic DNA comprising the 5' end of the T-DNA insert flanking the genome of plant material derived from transgenic maize event LP 007-5. This PCR product contained SEQ ID NO 3. For PCR amplification, primer 5(SEQ ID NO:8) hybridizing to the genomic DNA sequence flanking the 5' end of the transgene insert sequence, and primer 6(SEQ ID NO:9) at the transgene tNOs transcription termination sequence, are designed to pair with it.

A PCR product comprising a portion of genomic DNA flanking the 3 'end of the T-DNA insert in the genome of plant material derived from the transgenic maize event LP007-5 was generated from the 3' end of the transgenic insert. This PCR product contained SEQ ID NO 4. For PCR amplification, primer 8(SEQ ID NO:11) hybridizing to the genomic DNA sequence flanking the 3 'end of the transgene insert was designed, along with primer 7(SEQ ID NO:10) pairing to the tNos transcription termination sequence located at the 3' end of the insert.

The DNA amplification conditions set forth in tables 3 and 4 can be used in the PCR zygosity assay described above to produce a diagnostic amplicon of transgenic maize event LP 007-5. Detection of amplicons can be performed by using a Stratagene Robocycle, MJ Engine, Perkin-Elmer9700, or Eppendorf MastercycleGradien thermocycler, etc., as shown in Table 3, or by methods and equipment known to those skilled in the art.

TABLE 3 PCR steps and reaction mixture conditions for 5' transgene insert/genome junction region identification for transgenic maize event LP007-5

TABLE 4 Perkin-Elmer9700 thermal cycler conditions

Mix gently, and if there is no incubation cap on the thermocycler, 1-2 drops of mineral oil can be added above each reaction. PCR was performed on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer9700 (Perkin Elmer, Boston, MA) or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermocycler using the following cycling parameters (Table 3). The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a computational mode. The Perkin-Elmer9700 thermal cycler was operated with a ramp speed set to a maximum value.

The experimental results show that: primers 11 and 12(SEQ ID NOS: 8 and 9) which, when used in a PCR reaction of transgenic maize event LP007-5 genomic DNA, produced an amplification product of a 1646bp fragment, with NO fragment being amplified when used in a PCR reaction of untransformed maize genomic DNA and non-LP 007-5 maize genomic DNA; primers 13 and 14(SEQ ID NOS: 10 and 11) produced an amplification product of a 1333bp fragment when used in a PCR reaction of transgenic maize event LP007-5 genomic DNA, and NO fragment was amplified when used in a PCR reaction of untransformed maize genomic DNA and non-LP 007-5 maize genomic DNA.

PCR zygosity assays can also be used to identify whether the material derived from transgenic maize event LP007-5 is homozygous or heterozygous. Primer 15(SEQ ID NO:12), primer 16(SEQ ID NO:13) and primer 17(SEQ ID NO:14), or primer 16(SEQ ID NO:13), primer 17(SEQ ID NO:14) and primer 18(SEQ ID NO:15) were used in an amplification reaction to generate a diagnostic amplicon of transgenic maize event LP 007-5. The DNA amplification conditions set forth in tables 5 and 6 can be used in the zygosity assay described above to produce a diagnostic amplicon for transgenic maize event LP 007-5.

TABLE 5 reaction solution for measuring adhesiveness

TABLE 6 determination of bondability Perkin-Elmer9700 thermal cycler conditions

PCR was performed on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer9700 (Perkin Elmer, Boston, MA) or Eppendorf MastercycleGradient (Eppendorf, Hamburg, Germany) thermocycler using the following cycling parameters (Table 5). The MJ Engine or Eppendorf Mastercycler Gradient thermocycler should operate in a computational mode. The Perkin-Elmer9700 thermal cycler was operated with a ramp speed set to a maximum value.

In the amplification reaction, the biological sample containing the template DNA contains DNA diagnostic for the presence of transgenic maize event LP007-5 in the sample. Or the reaction will produce two different DNA amplicons from a biological sample containing DNA derived from the maize genome that is heterozygous for the corresponding allele of the inserted DNA present in transgenic maize event LP 007-5. These two different amplicons will correspond to a first amplicon derived from the wild-type maize genomic locus and a second amplicon diagnostic for the presence of transgenic maize event LP007-5 DNA. Only a maize DNA sample corresponding to a single amplicon of the second amplicon described for the heterozygous genome is produced, the presence of transgenic maize event LP007-5 in the sample can be diagnostically determined, and the sample is produced from maize seeds that are homozygous for the allele corresponding to the inserted DNA present in the transgenic maize plant LP 007-5. It is noted that the primer pair for transgenic maize event LP007-5 was used to generate an amplicon diagnostic for transgenic maize event LP007-5 genomic DNA. These primer pairs include, but are not limited to, primers 11 and 12(SEQ ID NOS: 8 and 9), and primers 13 and 14(SEQ ID NOS: 10 and 11), which are used in the DNA amplification method. In addition, a control primer 9 and 10(SEQ ID NO:28 and SEQ ID NO:29) for amplification of the maize endogenous gene was included as an internal standard of reaction conditions. Analysis of a sample of a DNA extract of transgenic maize event LP007-5 should include a control of positive tissue DNA extract of transgenic maize event LP007-5, a control of negative DNA extract from non-transgenic maize event LP007-5, and a negative control that does not contain a template maize DNA extract. In addition to these primer pairs, any primer pair from SEQ ID NO 3 or SEQ ID NO 4, or the complement thereof, which when used in a DNA amplification reaction produces an amplicon comprising SEQ ID NO 1 or SEQ ID NO 2, respectively, that is diagnostic for tissue derived from transgenic event maize plant LP007-5 can be used. The DNA amplification conditions illustrated in tables 2-5 can be used to generate diagnostic amplicons of transgenic maize event LP007-5 using appropriate primer pairs. An extract putatively containing corn plant or seed DNA comprising transgenic corn event LP007-5, or a product derived from transgenic corn event LP007-5, which when tested in a DNA amplification method produces an amplicon diagnostic for transgenic corn event LP007-5, can be used as a template for amplification to determine the presence or absence of transgenic corn event LP 007-5.

Example 4 detection of transgenic maize event LP007-5 by Southern blot hybridization

4.1 DNA extraction for Southern blot hybridization

Southern blot analysis was performed using transformation events homozygous for the T4, T5 generations. Approximately 5 to 10g of plant tissue was ground in liquid nitrogen using a mortar and pestle. Plant tissues were resuspended in 12.5mL extraction buffer a (0.2MTris pH 8.0, 50mM EDTA, 0.25M NaCl, 0.1% v/v β -mercaptoethanol, 2.5% w/v polyvinyl-pyrrolidone) and centrifuged at 4000rpm for 10 minutes (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5mL extraction buffer B (0.2M Tris pH 8.0, 50mM EDTA, 0.5M NaCl, 1% v/v β -mercaptoethanol, 2.5% w/v polyvinyl-pyrrolidone, 3% sarcosyl, 20% ethanol) and incubated at 37 ℃ for 30 minutes. During the incubation period, the sample was mixed once with a sterile loop. After incubation, an equal volume of chloroform/isoamyl alcohol (24:1) was added, gently mixed by inversion, and centrifuged at 4000rpm for 20 minutes. The aqueous layer was collected and centrifuged at 4000rpm for 5 minutes after adding 0.54 volume of isopropanol to precipitate the DNA. The supernatant was discarded and the DNA pellet resuspended in 500. mu.L TE. To degrade any RNA present, DNA was incubated with 1. mu.L of 30mg/mL RNAaseA for 30 minutes at 37 ℃, centrifuged at 4000rpm for 5 minutes, and the DNA was precipitated by centrifugation at 14000rpm for 10 minutes in the presence of 0.5 volumes of 7.5M ammonium acetate and 0.54 volumes of isopropanol. After discarding the supernatant, the pellet was washed with 500. mu.L of 70% by mass ethanol, dried and resuspended in 100. mu.L of TE.

4.2 restriction enzyme digestion

The DNA concentration is quantified using a spectrophotometer or fluorometer (using 1 XTAE and GelRED dyes). Mu.g of DNA was digested in 100. mu.L reaction. The genomic DNA was digested with the restriction enzymes BamHI and HindIII, respectively, and with the partial sequences of Cry2Ab and EPSPS on the T-DNA as probes, and with the restriction enzymes EcoRV and HindIII, respectively, and with the partial sequences of Cry1Ab and Vip3Aa on the T-DNA as probes. For each enzyme, the digests were incubated overnight at the appropriate temperature. The sample was spun using a vacuum centrifugal evaporator concentrator (speed vacuum) to reduce the volume to 30 μ L.

4.3 gel electrophoresis

Bromophenol blue loading dye was added to each sample from example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide, electrophoresed in TBE electrophoresis buffer, and the gel was electrophoresed overnight at 20 volts.

The gel was washed in 0.25M HCl for 15 minutes to depurinate the DNA, then washed with water. Southern blot hybridization was set as follows: in the tray, 20 sheets of thick dry blotting paper were placed, and 4 sheets of thin dry blotting paper were placed thereon. 1 piece of thin blotting paper was pre-wetted in 0.4M NaOH and placed on the stack, followed by 1 piece of Hybond-N + transfer membrane pre-wetted in 0.4M NaOH (Amersham Pharmacia Biotech, # RPN 303B). The gel is placed on top to ensure that there are no air bubbles between the gel and the membrane. 3 additional pre-soaked blotting papers were placed on top of the gel and the buffer tray was filled with 0.4M NaOH. The gel stack and buffer tray were connected with wicks pre-soaked in 0.4M NaOH to transfer the DNA to the membrane. The DNA transfer was carried out at room temperature for about 4 hours. After transfer, the Hybond membrane was rinsed in2 XSSC for 10 seconds and the DNA was bound to the membrane by UV cross-linking.

4.4 hybridization

PCR was used to amplify appropriate DNA sequences for probe preparation. The DNA probe is SEQ ID NO 30 and SEQ IDNO 31, SEQ ID NO 32 and SEQ ID NO 33, or homologous or complementary to portions of the above sequences. 25ng of the probe DNA was boiled in 45. mu.L of TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, # RPN1633) tube. After adding 5. mu.l of 32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37 ℃ for 15 minutes. The probe was purified by microcentrifugation of a G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. Probe activity was measured using a scintillation counter. By preheathing Church prehybridization with 20mL (500mM Na) at 65 deg.C₃P0₄1mM EDTA, 7% SDS, 1% BSA) wet the Hybond membrane for 30 minutes, pre-hybridizing the Hybond membrane. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. Add appropriate amount of probe to the prehybridization buffer (1 million counts per 1mL prehybridization buffer) and perform hybridization overnight at 65 ℃. The following day, the hybridization buffer was discarded, and after rinsing with 20mL of Church rinse solution 1(40mM Na3P04, 1mM EDTA, 5% SDS, 0.5% BSA), the membrane was washed in 150mL of Church rinse solution 1 at 65 ℃ for 20 minutes. Rinse solution 2 with Church (40mM Na)₃P0₄1mM EDTA, 1% SDS) was repeated 2 times. The membrane is exposed to a phosphor screen or X-ray film to detect the location of probe binding.

Two control samples were included on each Southern: (1) DNA from a negative (untransformed) isolate, which is used to identify any endogenous maize sequence that can hybridize to the element-specific probe; (2) DNA from a positive isolate, into which HindIII digested pLP007 was introduced in an amount equivalent to one copy number based on probe length, to demonstrate the sensitivity of the experiment in detecting a single gene copy within the maize genome.

The hybridization data provide corroborative evidence supporting TaqMan^TMPCR analysis, i.e., maize plant LP007-5 contained a single copy of Cry1Ab, Cry2Ab, Vip3Aa, and the EPSPS genes. Using Cry1Ab probe, EcoRV and HindIII were digested to generate single bands of about 21.3kb and 15.9kb in size, respectively; using this Cry2Ab probe, BamHI and HindIII were digested to generate single bands of about 4.3kb and 8.3kb in size, respectively; using the Vip3Aa probe, EcoRV and HindIII gave single bands of approximately 21.3kb and 15.9kb in size, respectively; using this EPSPS probe, BamHI and HindIII were digested to generate single bands of approximately 2.8kb and 15.9kb in size, respectively. This indicates that one copy each of Cry1Ab, Cry2Ab, Vip3Aa, and EPSPS is present in maize transformation event LP 007-5.

Example 5 insect resistance assay

5.1 bioassay of maize plant LP007-5

Transgenic maize event LP007-5 and wild type maize plant (non-transgenic, transformed receptor control (CK-))2 plants were bioassayed against asian maize borer (ostrinia californicalis), Spodoptera frugiperda (Spodoptera frugiperda), pink moth (Conogethespecilia), athetia lepigone (athetislipidone), oriental armyworm (mythimnasepera), prodenia litura (Spodoptera litura), cotton bollworm (helicovparamea) and Spodoptera exigua (Spodoptera exigua), respectively, as follows:

taking fresh leaves (period V3-V4) of 2 transgenic corn event LP007-5 and wild type corn plants (non-transgenic, transformation receptor control (CK-)) respectively, washing the fresh leaves with sterile water, sucking the water on the leaves with gauze, removing leaf veins of the corn leaves, simultaneously cutting the corn leaves into long strips of about 1cm multiplied by 3cm, taking 1-3 (determining the number of the leaves according to the insect appetite) cut long strips, putting the long strips on filter paper at the bottom of a circular plastic culture dish, wetting the filter paper with distilled water, putting 10 artificially-fed first-hatched larvae in each culture dish, covering the insect test culture dish after covering, and performing a light cycle (light/dark) 16 at the temperature of 26-28 ℃, the relative humidity of 70% -80%: and 8, counting the result after the mixture is placed for 5 days. The mortality was counted and the level of resistance was identified by correcting the mortality (%) (1-survival/number of vaccinated-wild type control mortality)/(1-wild type control mortality) x 100% with the results shown in table 7 and the in vitro resistance effect shown in figure 3.

TABLE 7 insect resistance bioassay for transgenic corn event LP 007-5-mortality (%)

5.2 field Effect of transgenic maize event LP007-5

(1) Corn borer

The insect-resistant herbicide-tolerant corn LP007-5 is used for carrying out field inoculation verification on the resistance of a main target pest namely Asian corn borer. Inoculating insects at the 4-6 leaf stage and the silking stage (silking of female ear is 3-5cm), each for 2 times, 50 times each time, and the interval time of the two times is one week. After 14d of inoculation of the corn borers in the leaf stage, the feeding condition of the upper leaves of the corn plants by the Asiatic corn borers is investigated plant by plant, and the leaf feeding level of the Asiatic corn borers is recorded. After the silking period is inoculated with the insects, the damage degree of the female ears and the damage condition of plants before harvesting comprise the damage length of the female ears of the corn, the number of wormholes, the length of tunnels of the wormholes, the age of the living larvae and the number of the living larvae. Evaluation was performed using "heart-leaf-as-harmful-level grading criteria" as an index, and the results are shown in fig. 4 and table 12. The ears are dissected and investigated in the silking period, and the statistical result is shown in a table 13.

TABLE 8 grading Standard of the degree of damage of Asiatic corn borers to the corn leaves

Grade of eating leaves	Description of the symptoms
		1	The leaves are not damaged, or only the leaves are provided with needle-like (less than or equal to 1mm) insect holes
2	Only a few bug holes with the spring hole size (less than or equal to 5mm) are arranged on the individual leaves
		3	A small number of leaves have bug holes with spring hole size (less than or equal to 5mm)
4	The upper part of the individual leaf is carved (less than or equal to 10mm)
		5	A small number of blades are provided with notches (less than or equal to 10mm)
6	The partial blade is provided with a notch (less than or equal to 10mm)
		7	The part of each leaf is eaten, and a small number of leaves are provided with large scale (less than or equal to 10mm)
8	A small number of leaves are eaten, and a large number of notches (less than or equal to 10mm) are arranged on part of the leaves
		9	Most of the leaves are eaten

TABLE 9 evaluation of resistance of corn to Asiatic corn borer

Average value of leaf eating grade in heart leaf stage	Level of resistance
		1.0-2.9	High Resistance (HR)
3.1-4.9	Anti (R)
		5.0-6.9	Moderate (MR)
7.0-8.9	Feeling of
		9.0	Feeling of height

TABLE 10 grading Standard of the extent of corn ear stage injury by Asiatic corn borer

TABLE 11 evaluation criteria for resistance to Asiatic corn borer in corn ear stage

Average damage grade of female ear	Type of resistance
		1-2.0	High resistance HR
2.1-3.0	anti-R
		3.1-5.0	anti-MR
5.1-7.0	Feeling S
		≥7.1	High-sensitivity HS

TABLE 12 results of resistance of transgenic maize event LP007-5 heart leaf stage to Ostrinia furnacalis Guenee,

item/plant	LP007-5	CK-
			Average leaf eating grade	1.02	8.1
Level of resistance	Gao Kang	Feeling of height

TABLE 13 resistance results of transgenic maize event LP007-5 to Asiatic corn borer

Item/plant	LP007-5	CK-
			Percentage of damage to ear (%)	0	100
Survival number of larvae	0	15
			Tunnel length (cm)	0	2.1
Grade of damage to ears	0	6.5
			Level of resistance	Gao Kang	Feeling of

The results show that: the transgenic maize event LP007-5 has a better level of resistance to asian corn borers, both in the heart-leaf stage and in the silking stage; leaf feeding grade mean for transgenic maize event LP007-5 was significantly lower at the heart leaf stage than for the transformed receptor control. In the silking phase, the ear damage rate, larval survival number, tunnel length and ear damage level of transgenic maize event LP007-5 were significantly lower than those of the transformed receptor control.

(2) Oriental mythimna

The experimental design and method of testing is essentially consistent with the evaluation of resistance to asian corn borer as described above. Except that the artificial inoculation is carried out only in the heart-leaf stage of the corn (the corn plants develop to the 4-6 leaf stage of the development), the inoculation is carried out for 2 times, and about 20 heads of the two-year larvae are inoculated to the heart-leaf stage of each corn. And 3 days after the inoculation, carrying out second inoculation, wherein the inoculation quantity is the same as that of the first inoculation. After 14 days of inoculation, the degree of damage of corn leaves by oriental armyworm was investigated. The average value of the level of the eastern armyworms to the corn leaves (the level of eating leaves) of each cell was calculated according to the degree of the corn leaves to be damaged by the eastern armyworms, the judgment criteria thereof are shown in table 14, and then the resistance level of the corn to the eastern armyworms was judged according to the criteria of table 15. The results of resistance to oriental armyworm at the heart-leaf stage of transgenic maize event LP007-5 are shown in table 16.

TABLE 14 grading Scale of the degree of corn leaf injury by Oriental mythimna

Grade of damage to ears	Description of the symptoms
		1	The leaves are not damaged, or only the leaves are provided with needle-like (less than or equal to 1mm) insect holes
2	Only a few bug holes with the spring hole size (less than or equal to 5mm) are arranged on the individual leaves
		3	A small number of leaf blades are provided with wormholes with spring hole sizes (less than or equal to 5mm)
4	The upper part of each blade is carved (less than or equal to 10mm)
		5	A few of the leaves have nicks (less than or equal to)10mm)
6	The partial blade is provided with a notch (less than or equal to 10mm)
		7	The part of each leaf is eaten, and a small number of leaves are provided with large scale (less than or equal to 10mm)
8	A small number of leaves are eaten, and a large number of notches (less than or equal to 10m) are arranged on part of the leaves
		9	Most of the leaves are eaten

TABLE 15 evaluation criteria for resistance of corn to Oriental myxozoa

Average damage grade of female ear	Type of resistance
		1.0-2.0	High resistance HR
2.1-4.0	anti-R
		4.1-6.0	anti-MR
6.1-8.0	Feeling S
		8.1-9.0	High-sensitivity HS

TABLE 16 resistance results of transgenic maize event LP007-5 heart leaf stage to Oriental mythimna

Item/plant	LP007-5	CK-
			Average leaf eating grade	1.03	78
Level of resistance	Gao Kang	Feeling of

The results show that: the transgenic maize event LP007-5 has a better level of resistance to Oriental myxozoa, and the notch ratio and leaf feeding grade of the transgenic maize event LP007-5 are both significantly lower than the transformed receptor control (CK-).

(3) Bollworm

The experimental design and method of testing is essentially consistent with the evaluation of resistance to asian corn borer as described above. The difference is that the artificial inoculation is carried out only in the spinning stage of the corn for 2 times, about 20 newly hatched larvae which are artificially fed are inoculated into each corn filament, and after 3 days, the second inoculation is carried out, and the number of the inoculated insects is the same as that of the first inoculation. After 14-21 days of inoculation, the damage rate of the female ears, the number of surviving larvae of each female ear and the damage length of the female ears are investigated plant by plant. The investigation is started 14 days after the inoculation, if the pest level of the negative control material (CK-) reaches a feeling or a high feeling, the negative control material is considered to be effective, if the pest level does not reach a level which can be delayed properly, but the pest level does not reach the corresponding level 21 days after the inoculation, the pest is considered to be ineffective. Calculating the average damage level of the cotton bollworms in the ear stage of the corn to the female ears in each cell according to the damage rate of the female ears, the number of the surviving larvae and the damage length (cm) of the female ears, wherein the judgment standard is shown in the table 17, and then judging the resistance level of the cotton bollworms in the ear stage of the corn according to the standard in the table 18. The results of resistance to Helicoverpa armigera during transgenic maize event LP007-5 silking are shown in FIG. 5, Table 19.

TABLE 17 grading Standard of the degree of damage to ears of corn by Cotton bollworm

Grade of damage to ears	Description of the symptoms
		0	The ear of the female ear is not damaged
1	Only the filament is damaged
		2	Damage to ear tip of 1cm
3+	When the damage under the top of the spike is increased by 1cm, the corresponding damage level is increased by 1 level
		…N

TABLE 18 evaluation of resistance of corn ears to bollworms

TABLE 19 resistance results of transgenic maize event LP007-5 to Helicoverpa armigera

Item/plant	LP007-5	CK-
			Percentage of damage to ear (%)	0	100
Survival number of larvae	0	16
			Tunnel length (cm)	0	2.4
Grade of damage to ears	0	6.7
			Level of resistance	Gao Kang	Feeling of

The results show that: transgenic maize event LP007-5 has a better level of resistance to cotton bollworm, and the ear damage rate, larval survival number, ear damage length, and ear damage grade of transgenic maize event LP007-5 are significantly lower than transformation receptor control (CK-).

(4) Dichocrocis punctiferalis

The natural insects are infected in the areas where the dichocrocis punctiferalis occurs naturally. And after 14-21 days of the initial occurrence of the insect pest, and when most of the transformation receptor control (CK-) is damaged by 4-5-year old larvae, investigating the damage rate of the dichocrocis punctiferalis to the corn plants one by one. The results of resistance of transgenic maize event LP007-5 to dichocrocis punctiferalis are shown in figure 6, table 20.

TABLE 20 resistance to dichocrocis punctiferalis under the native insect-inducing conditions of transgenic maize event LP007-5

Item/plant	LP007-5	CK-
			Percentage of damage (%)	0	67

The results show that: under the condition of natural occurrence of dichocrocis punctiferalis, compared with a transformation receptor control (CK-), the damage rate of dichocrocis punctiferalis to transgenic corn event LP007-5 is remarkably reduced, so that the transgenic corn event LP007-5 has better resistance to dichocrocis punctiferalis.

(5) Beet armyworm

The natural insects are infected in the areas where the beet armyworms occur more seriously naturally. And (3) after 10-15 days of initial insect pest occurrence and when most of transformation receptor control (CK-) is damaged by 4-6-year old young larvae, investigating the damage rate of the spodoptera exigua on the corn plants one by one. The results of resistance of transgenic maize event LP007-5 to spodoptera exigua are shown in figure 7, table 21.

TABLE 21 resistance results of transgenic maize event LP007-5 to beet armyworm under naturally susceptible conditions

Item/plant	LP007-5	CK-
			Percentage of damage (%)	0	92

The results show that: under the condition that the beet armyworm naturally occurs, compared with a transformation receptor control (CK-), the damage rate of the beet armyworm to the transgenic corn event LP007-5 is obviously reduced, so that the transgenic corn event LP007-5 has better resistance to the beet armyworm.

(5) Spodoptera frugiperda

The natural insects are infected in the areas where the spodoptera frugiperda naturally occurs seriously. And after 10-15 days of initial insect pest occurrence and when most of transformation receptor control (CK-) is damaged by 4-6-year old larvae, investigating the damage rate of spodoptera frugiperda to the corn plants plant by plant. The results of the resistance of transgenic maize event LP007-5 to Spodoptera frugiperda are shown in Table 22, and the effects of field resistance are shown in FIG. 8.

TABLE 22 resistance results of transgenic maize event LP007-5 to Spodoptera frugiperda under naturally insect-susceptible conditions

Item/plant	LP007-5	CK-
			Percentage of damage (%)	0	100

The results show that: under the condition that spodoptera frugiperda naturally occurs, compared with a transformation receptor control (CK-), the damage rate of spodoptera frugiperda to the transgenic maize event LP007-5 is remarkably reduced, so that the transgenic maize event LP007-5 has better resistance to spodoptera frugiperda.

Example 6 herbicide tolerance testing of events

The test selects the farmyard herbicide (41% glyphosate isopropylammonium aqua) to spray. Random block design was used, 3 replicates. The area of the cell is 15m²(5m multiplied by 3m), the row spacing is 60cm, the plant spacing is 25cm, the cultivation management is carried out conventionally, and 1m wide isolation belts are arranged among cells. Transgenic maize event LP007-5 was subjected to 2 treatments, respectively: 1) spraying is not carried out; 2) the agro-herbicide was sprayed at the V3 foliar stage at a dose of 1680ga.e./ha, and then again at the same dose at the V8 stage. It is noted that glyphosate herbicides of varying content and dosage formThe conversion of the agent to the equivalent glyphosate acid form is useful in the following conclusions. Phytotoxicity symptoms were investigated 1 and 2 weeks after drug administration, respectively, and the yield of the plots was determined at the time of harvest. The grading of the symptoms of drug damage is shown in Table 23. Evaluating an index of herbicide tolerance of the transformation event using the herbicide damage rate as an evaluation index, specifically, the herbicide damage rate (%) ═ Σ (number of sibling damaged strains × number of ranks)/(number of total strains × highest rank); wherein the herbicide damage rate refers to glyphosate damage rate, and the glyphosate damage rate is determined according to phytotoxicity investigation results of 2 weeks after glyphosate treatment. The corn yield per cell was measured as the total corn grain yield (weight) in the middle 3 rows of each cell, and the yield difference between the different treatments was measured as the yield percentage (%) -spray/no-spray yield. The results for herbicide tolerance and corn yield results for transgenic corn event LP007-5 are shown in figure 9, table 24.

TABLE 23 grading Standard for the extent of phytotoxicity of Glyphosate herbicides on corn

Grade of phytotoxicity	Description of the symptoms
		Level 0	No phytotoxicity, and consistent growth with that of clear water;
level 1	Slight phytotoxicity symptom, local color change, and phytotoxicity spots accounting for less than 10% of the leaf area;
		stage 2	Slightly inhibiting growth or losing green, and the area of phytotoxicity spots is below 1/4;
grade 3	Has great influence on growth and development, leaf deformity or plant dwarfing or phytotoxicity spots occupying less than 1/2
		4 stage	The influence on growth and development is large, the leaves are seriously deformed, or the plants are obviously dwarfed or the leaf withered spots are below 3/4;
grade 5	The phytotoxicity is heavy, the dead plant or phytotoxicity spots occupy more than 3/4 of the leaf area.

TABLE 24 results for tolerance of transgenic maize event LP007-5 to glyphosate herbicide and maize yield results

The results show that, in terms of herbicide (glyphosate) damage rate: 1) transgenic corn event LP007-5 suffered a substantially 0% injury rate under glyphosate herbicide (800 ml/acre) treatment, and thus, transgenic corn event LP007-5 had good glyphosate herbicide tolerance.

In terms of yield: the yield of the transgenic corn event LP007-5 is not obviously different under the treatment of not spraying and spraying 2 glyphosate seeds with the concentration of 800 ml/mu, and the yield of the transgenic corn event LP007-5 is not reduced basically after the glyphosate herbicide is sprayed, so that the transgenic corn event LP007-5 is further proved to have good tolerance to the glyphosate herbicide.

Taken together, regenerated transgenic maize plants were tested for the presence of cry1Ab, cry2Ab, vip3Aa, and epsps genes by taqman analysis (see example 2) and characterized for copy number of insect-resistant and glyphosate herbicide-tolerant lines. Based on the copy number of the gene of interest, good insect resistance, glyphosate herbicide tolerance and agronomic performance (see examples 5 and 6), event LP007-5 was selected by screening to be superior with a single copy transgene, good insect resistance, glyphosate herbicide tolerance and agronomic performance (examples 5 and 6).

Finally, it should be noted that the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Longping Biotechnology (Hainan) Co., Ltd

<120> transgenic maize event LP007-5 and methods of detecting the same

<160> 39

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcttgtttac cacactgata gt 22

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccgtatccgc aatagttatg tc 22

<210> 3

<211> 1454

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctttgtagat cttgagaagt tatagaattt tgtagttggc aactttttca tttgaagtca 60

tcttgtcaac gaaaactacg tctaaatttt aaaaattaaa aatttgaatt ttgaaaatga 120

ttttgaaaga gaaaaccact aacatgaaag ttgtaggtat tgaagagtta tgaaactttg 180

tagttgacaa tgttttagtt tgaaatcatc ttgtcatgca aaactatgtt tgaattttaa 240

aatttgaatt tttcaaacta gctcggaaaa ccaccaaaat aaaagttgta gattttgaaa 300

tgtaataaaa ctttgtaatt gacaattttt tgatttgaaa tcatcttatc attgaaaaat 360

tcgtgtgcag ttttcaattt tgaaatccaa attttttaaa cggcctcgaa agtagaagct 420

atcaaaatag aatttgtaga tcttaaaaag ttatgcaact ttatagttcg ccatattttc 480

aaaaataata atttagtgcc ttaaataatc aaattactct cgattggtta ttgtacatga 540

ggaatgaaaa cgtaatatag atagaattga tgtagtacta tagtggtaga agagagtatg 600

cgcaagagag aggttgcgag ttcgaatctc acaccattca caaaacatgt aaatatgatt 660

caaaataata gtgaaaaatg attagagtga tgggtatggt atagagttgt tcctacaatt 720

taaaaatgtt ttgatgtttt tgggtttttt cgattcttaa ttttccgagt gcttttcgac 780

actcggcaaa gtctttgtcc gagtgtccga aaaagtactt gacaaaaaac actttgccga 840

taaaatattt accgagtatt atttgccgag tttaacgctc cataaaggct ttgcccaata 900

taaaatggca tttgccaagt cccggcaaat aacccgattc aggtagtgct tgtttaccac 960

actgatagtt taaactgaag gcgggaaacg acaatctgat caagagcgga gaattaaggg 1020

agtcacgtta tgacccccgc cgatgacgcg ggacaagccg ttttacgttt ggaactgaca 1080

gaaccgcaac gctgcaggaa ttggccgcag gtggatttgt attaaactaa tgactaatta 1140

gtggcactag cctcaccgac ttcgcagacg aggccgctaa gtcgcagcta cgctctcaac 1200

ggcactgact aggtagttta aacgtgcact taattaaggt accgggaatt taaatcccgg 1260

gaggtctcgc agacctagct agttagaatc ccgagaccta agtgactagg gtcacgtgac 1320

cctagtcact taaagctgat ctagtaacat agatgacacc gcgcgcgata atttatccta 1380

gtttgcgcgc tatattttgt tttctatcgc gtattaaatg tataattgcg ggactctaat 1440

cataaaaacc catc 1454

<210> 4

<211> 1335

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atccctgcag 60

ggaattctta attaagtgca cgcggccgcc tacttagtca agagcctcgc acgcgactgt 120

cacgcggcca ggatcgcctc gtgagcctcg caatctgtac ctagtttagc tagttaggac 180

gttaacaggg acgcgcctgg ccgtatccgc aatagttatg tccctctgtc ctataataat 240

gtagctggtt ctagatatac cataagtcaa tttttattag atttgactga acttcttcca 300

tcaacatgcc caactagtat cattaaattc accgtaaaat aaatttagta tacttctttt 360

ttggtgttgc acctgttaat tattttctat tttaatttag aactaatcca aattacagaa 420

tgatgcatgt gagatcttca taattttgtt agataactca tctattagtg tttaacctta 480

tggtatttaa ttttaggatg gtccaagatc cacggtacag taccaccatg ctagctcggg 540

cggcctacgt gtcttcatgg atccataact atgatgcatg cacacactga cacacattct 600

ggtgaccctg gacatgtaga ttgatgcgac agaactattt aaaggacact cattttcgcc 660

atggtagagg acgaggctcc ggcgccgcct cccccgtcgt gcatgcaagg cctcgtcggg 720

cccgctctcc gccgctgcct tcattctcac cgccagttct cgtgcgctca cctcgtcccg 780

ctctcgtgtc acagaagatg gtcgatccgc agctggtgca ggtgaggcgc tcggcgtccc 840

cgccggtccc cgagctgggg tcgtcgaaat cggagaaacg gcggcggcaa agccatggcg 900

gtcgaaatcc ccgagcttgg atgagttgga caggaaaaaa aatttatatg tgcatagtat 960

gttttacggg ttaatttagg ccttgttcag atatttccag ggattggaaa aattttagaa 1020

aaaaatttaa ttttcttagg atttaaatcc atcaatcaca ctcagttcac atggattgat 1080

aactatccaa acaaaccttt tggaagaatc actccgagag atattgatat gagggacgaa 1140

ttctggtgat gtgatgtgac ataaagggaa gaaattttta gaggaaacca ttgcagtcag 1200

tcttaattct acactcttcc tcacaattct gactgcatca ttacaagcgt acaccgccta 1260

gtcaccacca ttacaacacg ggtgccccca ataataacgt tgtgataatt aacgacgacg 1320

tacgattacg cgaga 1335

<210> 5

<211> 18222

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctttgtagat cttgagaagt tatagaattt tgtagttggc aactttttca tttgaagtca 60

tcttgtcaac gaaaactacg tctaaatttt aaaaattaaa aatttgaatt ttgaaaatga 120

ttttgaaaga gaaaaccact aacatgaaag ttgtaggtat tgaagagtta tgaaactttg 180

tagttgacaa tgttttagtt tgaaatcatc ttgtcatgca aaactatgtt tgaattttaa 240

aatttgaatt tttcaaacta gctcggaaaa ccaccaaaat aaaagttgta gattttgaaa 300

tgtaataaaa ctttgtaatt gacaattttt tgatttgaaa tcatcttatc attgaaaaat 360

tcgtgtgcag ttttcaattt tgaaatccaa attttttaaa cggcctcgaa agtagaagct 420

atcaaaatag aatttgtaga tcttaaaaag ttatgcaact ttatagttcg ccatattttc 480

aaaaataata atttagtgcc ttaaataatc aaattactct cgattggtta ttgtacatga 540

ggaatgaaaa cgtaatatag atagaattga tgtagtacta tagtggtaga agagagtatg 600

cgcaagagag aggttgcgag ttcgaatctc acaccattca caaaacatgt aaatatgatt 660

caaaataata gtgaaaaatg attagagtga tgggtatggt atagagttgt tcctacaatt 720

taaaaatgtt ttgatgtttt tgggtttttt cgattcttaa ttttccgagt gcttttcgac 780

actcggcaaa gtctttgtcc gagtgtccga aaaagtactt gacaaaaaac actttgccga 840

taaaatattt accgagtatt atttgccgag tttaacgctc cataaaggct ttgcccaata 900

taaaatggca tttgccaagt cccggcaaat aacccgattc aggtagtgct tgtttaccac 960

actgatagtt taaactgaag gcgggaaacg acaatctgat caagagcgga gaattaaggg 1020

agtcacgtta tgacccccgc cgatgacgcg ggacaagccg ttttacgttt ggaactgaca 1080

gaaccgcaac gctgcaggaa ttggccgcag gtggatttgt attaaactaa tgactaatta 1140

gtggcactag cctcaccgac ttcgcagacg aggccgctaa gtcgcagcta cgctctcaac 1200

ggcactgact aggtagttta aacgtgcact taattaaggt accgggaatt taaatcccgg 1260

gaggtctcgc agacctagct agttagaatc ccgagaccta agtgactagg gtcacgtgac 1320

cctagtcact taaagctgat ctagtaacat agatgacacc gcgcgcgata atttatccta 1380

gtttgcgcgc tatattttgt tttctatcgc gtattaaatg tataattgcg ggactctaat 1440

cataaaaacc catctcataa ataacgtcat gcattacatg ttaattatta catgcttaac 1500

gtaattcaac agaaattata tgataatcat cgcaagaccg gcaacaggat tcaatcttaa 1560

gaaactttat tgccaaatgt ttgaacgatc gggaattccc atggggatca gagctcctat 1620

cagtacagcg gcgagatgtt agttggcacc agcatgatgt tcatgaggtc gaactgggtg 1680

ccagagttca gggtcacgtt gatgtccagc gggacgtcgg agttgctgct ggccaccacg 1740

ttgccaatgt tgatgtcgct gaagcgggcg ccgttgtcgt tgacgccatc attgttggtc 1800

gtcgtgttca cattggtggc tgtgtacacc ctcccgttga tggtgaccct gatggtggag 1860

ttgccaatgg agctgacgcg caggtacagg ttgtagctgt tgccgttgcc gcgcagggtg 1920

tacctggcgg tggtgttgtt ctgctcgaac ctcagggagt cgccctggtt gccgaacttc 1980

tcggagatga aggtgcgtgt ctggttgttc acttgggtgg cgtggattgg agagatggtg 2040

aagccggtgt aatcattggg cgccaggtgg atcatggagc cgttctcatg cacagcgtgg 2100

atgttgttct tcctgttatg gacgctcacc atgtacgccc ttgcacctcc gggcgtcccg 2160

gacggagagg cgatgttcct gatctcgttg tagtgcagtg gacggcggag gtcctcgttg 2220

cggacgacga gaggaacacc agagatgttc ctgatgaagt agtcggggaa gtagttagaa 2280

tttccacgcg ccgtgaaggc gccgctccgg aggccaaggg tggtctcgaa ggactcggtt 2340

tgccagttgg tgacggtggc cacgccctcg cggtcggagc cgctgtcgag ccaggacctc 2400

acgaacgggg tgagcagcgg cggcaggaag gtggagcagt tgaagttctg gttgaacggc 2460

gatgcaccaa tgtcgccgct cgagatgccg ccggagtagt tcactctggc agcaagcaga 2520

gcatgagttg tggtggagcc ggggaggcca acaatgttgg ggaaggtgtt ggagaggcga 2580

gcaccagaga agccgttgag gacgtagttg gagttgactt ggaacaacga atacaggaat 2640

ggccagtcct ggctggtgaa gctctgagtt tgttggggac cagagccgct ggcgtagagg 2700

ttggcgccgc tggacaccag caggctctgg tacttgaaga gcgaccagat gctgacgtac 2760

tcgaacacgt tcaggaacat gtaggtcctg aactccagca tgtcgtgaag cctcgtattg 2820

aggcccttga aggccgactg gtaggtgttg atgcaatagt tggagtagtc cctggtgtag 2880

ttcttcaggt agtcgcggta ggtcctcagc gtggctgcag agatgcccca ctcgtcagcg 2940

ttgaggatca cgtcacgaat gaaggagagg tgcaggttgg cagcctgagc aaagagtggc 3000

agcaggagca gctggtagcc ttgcatctgg aactgaggca agcggttgag gaacagttgt 3060

tgcatggtgt tcacggaaga agtgatggac agaggcaccg cattgcggtt ggggttgagg 3120

aagttgtcca cttggcggtt gaactcctcc acgtttgctt gcagacccgt cagctcagcg 3180

ttgacgcgag caagggtatc agtgttgagg cgctggttga gaaacttctc ggtctccctg 3240

aggatgtctt gcatgaggtt ggtggagcca gatggaaaga tcaggttgcg gagttccgag 3300

aggatgcgct tcccgacgag agagccgacc ttcttgagaa ggaagctggc caccgtgccg 3360

acgacggggt ccacgtacag gctgtggttg ttcttcttcc actccgtcca ctccttctga 3420

acagtgtcga ggctcttgtg ctggaagctg aatggatcat gcgccgcgac gttgtaggcg 3480

tcgcagatgg tggtgcgacc agagttcagg acggagttgt ccatggcctg catgcagcgg 3540

atgcgcccgc cggtcgacag cggcggcagg tacgacagcg tctcgaactt cttgttgccg 3600

taggccggcc acacctgcac gtagtacgtg tgttttggtt cgtttggggt tgggaattgg 3660

gatgggatgg gcaacacaca tcagtccatg catggatcat cagttccctt cctattacta 3720

actcgctagc tgcagctgct gcaatgcaaa gaactactag ctaggatgca tttgttacct 3780

gcatgcaccg gatccttccg ccgttgctga cgttgccgag gcttctggag gagcggcggg 3840

cgacggggag gctggcggtg gacttgagcc cctggaacgg agcgacggcg gtggccgacg 3900

aggccatcat cacggtgggc gccatgctga tcctctagag gccgcttggt atctgcatta 3960

caatgaaatg agcaaagact atgtgagtaa cactggtcaa cactagggag aaggcatcga 4020

gcaagatacg tatgtaaaga gaagcaatat agtgtcagtt ggtagatact agataccatc 4080

aggaggtaag gagagcaaca aaaaggaaac tctttatttt taaattttgt tacaacaaac 4140

aagcagatca atgcatcaaa atactgtcag tacttatttc ttcagacaac aatatttaaa 4200

acaagtgcat ctgatcttga cttatggtca caataaagga gcagagataa acatcaaaat 4260

ttcgtcattt atatttattc cttcaggcgt taacaattta acagcacaca aacaaaaaca 4320

gaataggaat atctaatttt ggcaaataat aagctctgca gacgaacaaa ttattatagt 4380

atcgcctata atatgaatcc ctatactatt gacccatgta gtatgaagcc tgtgcctaaa 4440

ttaacagcaa acttctgaat ccaagtgccc tataacacca acatgtgctt aaataaatac 4500

cgctaagcac caaattacac atttctcgta ttgctgtgta ggttctatct tcgtttcgta 4560

ctaccatgtc cctatatttt gctgctacaa aggacggcaa gtaatcagca caggcagaac 4620

acgatttcag agtgtaattc tagatccagc taaaccactc tcagcaatca ccacacaaga 4680

gagcattcag agaaacgtgg cagtaacaaa ggcagagggc ggagtgagcg cgtaccgaag 4740

acggtagatc ctagaaggat tggttgagta tctgatgatc cttcaaatgg gaatgaatgc 4800

cttcttatat agagggaatt cttttgtggt cgtcactgcg ttcgtcatac gcattagtga 4860

gtgggctgtc aggacagctc ttttccacgt tattttgttc cccacttgta ctagaggaat 4920

ctgctttatc tttgcaataa aggcaaagat gcttttggta ggtgcgccta acaattctgc 4980

accattcctt ttttgtctgg tccccacaag ccagctgctc gatgttgaca agattacttt 5040

caaagatgcc cactaacttt aagtcttcgg tggatgtctt tttctgaaac ttactgacca 5100

tgatgcatgt gctggaacag tagtttactt tgattgaaga ttcttcattg atctcctgta 5160

gcttttggct aatggtttgg agactctgta ccctgacctt gttgaggctt tggactgaga 5220

attcttcctt acaaaccttt gaggatggga gttccttctt ggttttggcg ataccaattt 5280

gaataaagtg atatggctcg taccttgttg attgaaccca atctggaatg ctgctaaatc 5340

ctgagaagct tctggatttt ggttttagga attagaaatt ttattgatag aagtatttta 5400

caaatacaaa tacatactaa gttgtacaaa aaccagcaac tcactgcact gcacttcact 5460

tcacttcact gtatgaataa aagtctggtg tctggttcct gatcgatgac tgactactcc 5520

actttgtgca gaacagatct aggcgcgccc tacttgatgc tcacgtcgta gaagtgcacg 5580

atcgggccgc cgtacaggtt gttgccctgg ctcagctcga tgtagaagtt gtccttctcg 5640

aacttggtgg tgaacatctc gctcacgtcc ttggcgccgc tcatgtacct cttctcgaac 5700

agcacctcgc gggagttgcg gatgcgcacg ttggcgtcgc cgctcacgct gaagtacacg 5760

cggtaggtgc tgaagctgtc cagctgcagg ttctgcttca ggatgccgcg gccgccctgg 5820

tacagggtca gggtgttgcc gctgatgttg gtgctgccgg tgctggtcca gttgttggtg 5880

ttgatcagct ccgggctcag cagcttctcg ctcgggctga tctccaggat gatgaagttg 5940

tcgccccagg cctcgtcgcc gttctggctc ttcaggatca ggtacacgcc cttcaggtcg 6000

gtgccggtgg tgaagcgctt gttgatggtc tggtagtcct ccaggttgtt gttggtgtcc 6060

tcgtagtgga tgtagccggt gttctcgtcc ttcaggtgaa tcgatggctt gcccttcacg 6120

gtgtactgga tcacgtactc ggtcttcggc ttcagcttgt cgccgatgaa ctggctgatg 6180

ccgccgtcct tgtgcacgta cagggccttg gtgccgttca cgccgccggt gtggtcgacg 6240

taggcgttct tgttgttggc cttccacggc tccaggttgt cctcctcgat gctgccgttc 6300

tccacgatgt tgctgatgaa gccgctcggt ggcacgatca gcttggtctc cttgttgctc 6360

aggtcggtgg ctagcagcag ctcgcgcagg tagctcttac aggtcagggt gatcaggcgg 6420

ctgttctcgt cggcctgcag gccaaagccg ttgatcgggg tcaggaaggt ctcgctgatc 6480

acgcccagtg gcatgtagac gccgtcgtcg ttcgcgctca gggtgcggta ctcggcctcg 6540

ctgctctcca ccttcttctt gttcaggtcg atctcgccgg tgctgctgtc gtagaagttg 6600

gcggtcacct cgtagcgcag ggtcttcatc ttcttggtga agtcgatctt ggtgatcacg 6660

tactcgttcg ggaacacgat gttgttggtg tagtagattt gctcgctctg gtccggacac 6720

agcagcttgt ccatgtcgcc gtagatcacc tcgctcaagc tgtccttgtc cacctggtag 6780

ttctgcttca gcttggcctc gtacaccttc agcacggtga tgctgtcgtt gctgatctcg 6840

aagccgatca acgcgtggcc cggcttagcc tccacgatca tcttggcgtc ctcgtcgctg 6900

cccttcacct tggcgtagtt cgggttgctg aaggtgttgc tcagggtcgg caggatgttc 6960

acgcggaact cctccttctc cttgttcaag tgctcgttca tgatgctggt gtagtcgatg 7020

tcggccaggc ccagcagctt gcgacaggtg gtcagggtca ggaaggcctt ggcctgcagg 7080

gcggtcagca cgatcaggaa gttgtacacg ttgcccacct cgctgccgct ggtcttcacg 7140

ttctccttgg tgatcagctc gctggcggtc ttcagggcgc tgcggccgaa caggttgttg 7200

cccaccatca cgtcgtggaa ggtgttcagg tagaactcga agccgtccac gtcgttcttg 7260

gtcacgctct tcgccagctc ggtcagctcg gtcagctcgt ccaggatgtc ggccgggctg 7320

ccgtccttct tcaccttgct gctggtctcg gtggcgaagg tcagctcttc gaacttctcg 7380

ttcacgtact tgatgcgctg gtaggccggg gtgatctcgg tcagggtgct gttgatcagg 7440

acgttcacgt tgatgatgtc cagcttgtcg ctgatctcct gcagctgctt gctcaggtac 7500

tcgatctgca ggctcagggc gtagttctgc ttgagcacgt cgctcagcat gctggtgatc 7560

ttcggcaggt acacgcgcag catggtgttg atggcgtcca gcttgttgtt cacgtcgttc 7620

agcacctggt tctgctcgtt ggcgatctta aggatctcct tgctcagctc ggtgttcagg 7680

ttgccctggg cgatcaggtc gttcaggctg ccgttcacgc cgtccagctt gccgctgatg 7740

tcgttcagca gctgctggtt cttcaggatc tcgtccaggg tcaggtcgcc gccggtgtcg 7800

gtcttgaaga tcatgttcat gatgtccttg atgccggtgg cgaagccgta gatgccgttg 7860

aagtagtcga tgaagctcgg cagggcgcgg gcgttcagct tggtgttgtt catgttcata 7920

ctagtctgca gaagtaacac caaacaacag ggtgagcatc gacaaaagaa acagtaccaa 7980

gcaaataaat agcgtatgaa ggcagggcta aaaaaatcca catatagctg ctgcatatgc 8040

catcatccaa gtatatcaag atcaaaataa ttataaaaca tacttgttta ttataataga 8100

taggtactca aggttagagc atatgaatag atgctgcata tgccatcatg tatatgcatc 8160

agtaaaaccc acatcaacat gtatacctat cctagatcga tatttccatc catcttaaac 8220

tcgtaactat gaagatgtat gacacacaca tacagttcca aaattaataa atacaccagg 8280

tagtttgaaa cagtattcta ctccgatcta gaacgaatga acgaccgccc aaccacacca 8340

catcatcaca accaagcgaa caaaaagcat ctctgtatat gcatcagtaa aacccgcatc 8400

aacatgtata cctatcctag atcgatattt ccatccatca tcttcaattc gtaactatga 8460

atatgtatgg cacacacata cagatccaaa attaataaat ccaccaggta gtttgaaaca 8520

gaattctact ccgatctaga acgaccgccc aaccagacca catcatcaca accaagacaa 8580

aaaaaagcat gaaaagatga cccgacaaac aagtgcacgg catatattga aataaaggaa 8640

aagggcaaac caaaccctat gcaacgaaac aaaaaaaatc atgaaatcga tcccgtctgc 8700

ggaacggcta gagccatccc aggattcccc aaagagaaac actggcaagt tagcaatcag 8760

aacgtgtctg acgtacaggt cgcatccgtg tacgaacgct agcagcacgg atctaacaca 8820

aacacggatc taacacaaac atgaacagaa gtagaactac cgggccctaa ccatggaccg 8880

gaacgccgat ctagagaagg tagagagggg ggggggggga ggacgagcgg cgtaccttga 8940

agcggaggtg ccgacgggtg gatttggggg agatctggtt gtgtgtgtgt gcgctccgaa 9000

caacacgagg ttggggaaag agggtgtgga gggggtgtct atttattacg gcgggcgagg 9060

aagggaaagc gaaggagcgg tgggaaagga atcccccgta gctgccggtg ccgtgagagg 9120

aggaggaggc cgcctgccgt gccggctcac gtctgccgct ccgccacgca atttctggat 9180

gccgacagcg gagcaagtcc aacggtggag cggaactctc gagaggggtc cagaggcagc 9240

gacagagatg ccgtgccgtc tgcttcgctt ggcccgacgc gacgctgctg gttcgctggt 9300

tggtgtccgt tagactcgtc gacggcgttt aacaggctgg cattatctac tcgaaacaag 9360

aaaaatgttt ccttagtttt tttaatttct taaagggtat ttgtttaatt tttagtcact 9420

ttattttatt ctattttata tctaaattat taaataaaaa aactaaaata gagttttagt 9480

tttcttaatt tagaggctaa aatagaataa aatagatgta ctaaaaaaat tagtctataa 9540

aaaccattaa ccctaaaccc taaatggatg tactaataaa atggatgaag tattatatag 9600

gtgaagctat ttgcaaaaaa aaaggagaac acatgcacac taaaaagata aaactgtaga 9660

gtcctgttgt caaaatactc aattgtcctt tagaccatgt ctaactgttc atttatatga 9720

ttctctaaaa cactgatatt attgtagtac tatagattat attattcgta gagtaaagtt 9780

taaatatatg tataaagata gataaactgc acttcaaaca agtgtgacaa aaaaaatatg 9840

tggtaatttt ttataactta gacatgcaat gctcattatc tctagagagg ggcacgaccg 9900

ggtcacgctg cactgcagcc taggttaagt gactagggtc acgtgactct agtcacttac 9960

ttcgtggaga tataggggaa agagaacgct gatgtgacaa gtgagtgaga tataggggga 10020

gaaatttagg gggaacgccg aacacagtct aaagtagctt gggacccaaa gcactctgtt 10080

cgggggtttt tttttttgtc tttcaacttt ttgctgtaat gttattcaaa ataagaaaag 10140

cacttggcat ggctaagaaa tagagttcaa caactgaaca gtacagtgta ttatcaatgg 10200

cataaaaaac aacccttaca gcattgccgt attttattga tcaaacattc aactcaacac 10260

tgacgagtgg tcttccaccg atcaacggac taatgctgct ttgtcaggcg cgcctagccc 10320

aggtcctcgt tcaggtcggt gcagcccaca tcgatgtcca aggagaagtg gtggctgtgg 10380

tgggcacact tgccgatcgg gctgggggcg ctcagcggcc agagggaacc agtaccgggc 10440

acgttgacgg tctcgtgctt ggcgttgtag cggatcaggt aaatctcgag gtcttggctg 10500

tcttcgatgt agccgcggag ctggtagcga gtgtaagcct tgagcttgga ctcatcgatc 10560

ttctggtaca agtaggtagg gtagcactcg tcgaaagtgc ccaggagagt cacgtagttc 10620

tccttgaaca catcgtcgcc gccctggatc gtgatgtcgg tgctgccgcg ccagccgcgg 10680

tcgagctgcc tgttgatgcc gcggaaattg gggtcctgga ggagattcct ctcgtcgctg 10740

agacgcttgg catgcttcac cttctcggac agctccttct tctcgtcgag gcagaactca 10800

tcggagaggc actccacgag gttggagact tggtcgatgt ggtagtcagt gacgtcggtc 10860

ttcaggccga tctgattgct ggacgtgaag agctcattga cagccttctg ggctctctcc 10920

aggtcgtact cggcttcgaa ggtgacctcg gctggcacga actcaatgcg gtcaatgtac 10980

acctcattgc cggaattgaa cacgtgggcg ctcagggtga aaacgctgga gccgttggag 11040

aagttgaagg gggtggtgaa acccacggtg cggaagctgc cggattggag gttgctgccg 11100

ctggacatgg tggcggagaa gttaccctga ttgatcggcc tgccgtcgat ggaggtgtgg 11160

aattgcaggt tggtggtgct agcgtagcga atcctgacgc ggtacctctg ggacagggga 11220

gcggtgatgt tgacgcggag ggtgctgatc tggcccgggg aggtcctgcg caggatgtcg 11280

ccgcccgtga agcctgggcc cttcaccacg gaggtgccgc tgcccaggtt ggtggacttg 11340

gtgaggggga tttgggtgat ttgggaggac ggaatgatat tgttgaactc cgcgctgcga 11400

tgaatccagg agaacatagg agctctgatg atgctcacgg acgagttgct gaagccggag 11460

cggaacatgg acacgtggct gagcctgtgg gaaaaaccct gcctgggggg cacattgttg 11520

ttctgtggtg ggatctcgtc cagggaatcc accgtgccgc tcttgcggta gacagcggag 11580

ggcaggttgg aggaggtgcc gtaggcgaac tcagtgccat ccaggacgga cagctgctgg 11640

ttgttgatac cgatgttgaa gggcctgcgg tacagggtgg agctcagggt gcggtagacg 11700

ccctggccca gctgagcgac gatgcgttgt tgtggagcgg cgttgcccat cgtgccgtag 11760

agaggaaagg taaactcggg gccgctgaag ccgaccgggg aggccatgat ctggtggccg 11820

gaccagtagt actcgccgcg gtgggcatcg gtgtagatag tgatgctgtt gaggatgtcc 11880

atcaggtgtg ggctcctgat ggagccctcg atgccctggg cgctgcccct gaagctaccg 11940

tcgaagttct ccaggacggg gttggtgtag atttcgcggg tcagttggga cacggtgcgg 12000

atcgggtagg tgcgggagtc gtagttcggg aagagggaca caatgtccag gacggtgagg 12060

gtcagctcgc gcctgaactg gttgtagcga atccagtctc tagaatcagg gccccagacg 12120

cgctccaggc cagtgttgta ccagcggaca gcgtggtcgg tgtagttgcc gatcagcctg 12180

gtgaggtcgt tgtagcggct gttgatggtg gcggcgtcga agccccacct ctggccaaac 12240

acgctgacgt ccctcagcac gctgaggtgc aggttggcgg cctggacgta cacggacagg 12300

agcgggactt ggtagttctg gacggcgaag agtgggatgg cggtggtcag ggcgctgttc 12360

atgtcgttga actggatgcg catctcctcg cggagagctg ggttagtggg gtcggcctcc 12420

cactcgcgga agctctcagc gtagatttgg tagaggttgc tgaggccctc caggcggctg 12480

atggcctggt tcctggcgaa ctcctcgatc ctctggttga tgagctgctc gatttgcacc 12540

aggaaggcgt cccactggga ggggccaaag atgccccaga tgatgtccac gaggcccagg 12600

acgaagccag cgcctggcac gaactcgctg agcaggaact gcgtgaggga gagggagatg 12660

tcgatggggg tgtaaccggt ctcgatgcgc tcaccgccga gcacctcgac ctcagggttg 12720

ctgaggcagt tgtacgggat gcactcgttg atgtttgggt tgttgtccat ggctagcttc 12780

tacctacaaa aaagctccgc acgaggctgc atttgtcaca aatcatgaaa agaaaaacta 12840

ccgatgaaca atgctgaggg attcaaattc tacccacaaa aagaagaaag aaagatctag 12900

cacatctaag cctgacgaag cagcagaaat atataaaaat ataaaccata gtgccctttt 12960

cccctcttcc tgatcttgtt tagcacggcg gaaattttaa accccccatc atctccccca 13020

acaacggcgg atcgcagatc tacatccgag agccccattc cccgcgagat ccgggccgga 13080

tccacgccgg cgagagcccc agccgcgaga tcccgcccct cccgcgcacc gatctgggcg 13140

cgcacgaagc cgcctctcgc ccacccaaac taccaaggcc aaagatcgag accgagacgg 13200

aaaaaaaaac ggagaaagaa agaggagagg ggcggggtgg ttaccggcgg cggcggaggc 13260

ctcccttgga tcttatggtg tgttgtccct gtgtgttctc caatagtgtg gcttgagtgt 13320

gtggaagatg gttctagagg atctgctaga gtcagcttgt cagcgtgtcc tctccaaatg 13380

aaatgaactt ccttatatag aggaagggtc ttgcgaagga tagtgggatt gtgcgtcatc 13440

ccttacgtca gtggagatat cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc 13500

ttctttttcc acgatgctcc tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga 13560

ggcatcttca acgatggcct ttcctttatc gcaatgatgg catttgtagg agccaccttc 13620

cttttccact atcttcacaa taaagtgaca gatagctggg caatggggcg cgcctactcg 13680

aggtcattca tatgcttgag aagagagtcg ggatagtcca aaataaaaca aaggtaagat 13740

tacctggtca aaagtgaaaa catcagttaa aaggtggtat aaagtaaaat atcggtaata 13800

aaaggtggcc caaagtgaaa tttactcttt tctactatta taaaaattga ggatgttttt 13860

gtcggtactt tgatacgtca tttttgtatg aattggtttt taagtttatt cgcttttgga 13920

aatgcatatc tgtatttgag tcgggtttta agttcgtttg cttttgtaaa tacagaggga 13980

tttgtataag aaatatcttt agaaaaaccc atatgctaat ttgacataat ttttgagaaa 14040

aatatatatt caggcgaatt ctcacaatga acaataataa gattaaaata gctttccccc 14100

gttgcagcgc atgggtattt tttctagtaa aaataaaaga taaacttaga ctcaaaacat 14160

ttacaaaaac aacccctaaa gttcctaaag cccaaagtgc tatccacgat ccatagcaag 14220

cccagcccaa cccaacccaa cccaacccac cccagtccag ccaactggac aatagtctcc 14280

acaccccccc actatcaccg tgagttgtcc gcacgcaccg cacgtctcgc agccaaaaaa 14340

aaaaagaaag aaaaaaaaga aaaagaaaaa acagcaggtg ggtccgggtc gtgggggccg 14400

gaaacgcgag gaggatcgcg agccagcgac gaggccggcc ctccctccgc ttccaaagaa 14460

acgcccccca tcgccactat atacataccc ccccctctcc tcccatcccc ccaaccctac 14520

caccaccacc accaccacct ccacctcctc ccccctcgct gccggacgac gagctcctcc 14580

cccctccccc tccgccgccg ccgcgccggt aaccaccccg cccctctcct ctttctttct 14640

ccgttttttt ttccgtctcg gtctcgatct ttggccttgg tagtttgggt gggcgagagg 14700

cggcttcgtg cgcgcccaga tcggtgcgcg ggaggggcgg gatctcgcgg ctggggctct 14760

cgccggcgtg gatccggccc ggatctcgcg gggaatgggg ctctcggatg tagatctgcg 14820

atccgccgtt gttgggggag atgatggggg gtttaaaatt tccgccgtgc taaacaagat 14880

caggaagagg ggaaaagggc actatggttt atatttttat atatttctgc tgcttcgtca 14940

ggcttagatg tgctagatct ttctttcttc tttttgtggg tagaatttga atccctcagc 15000

attgttcatc ggtagttttt cttttcatga tttgtgacaa atgcagcctc gtgcggagct 15060

tttttgtagg tagaagtgat caaccatggc gcaagttagc agaatctgca atggtgtgca 15120

gaacccatct cttatctcca atctctcgaa atccagtcaa cgcaaatctc ccttatcggt 15180

ttctctgaag acgcagcagc atccacgagc ttatccgatt tcgtcgtcgt ggggattgaa 15240

gaagagtggg atgacgttaa ttggctctga gcttcgtcct cttaaggtca tgtcttctgt 15300

ttccacggcg tgcatgcttc acggtgcaag cagccggccc gcaaccgccc gcaaatcctc 15360

tggcctttcc ggaaccgtcc gcattcccgg cgacaagtcg atctcccacc ggtccttcat 15420

gttcggcggt ctcgcgagcg gtgaaacgcg catcaccggc cttctggaag gcgaggacgt 15480

catcaatacg ggcaaggcca tgcaggcgat gggcgcccgc atccgtaagg aaggcgacac 15540

ctggatcatc gatggcgtcg gcaatggcgg cctcctggcg cctgaggcgc cgctcgattt 15600

cggcaatgcc gccacgggct gccgcctgac gatgggcctc gtcggggtct acgatttcga 15660

cagcaccttc atcggcgacg cctcgctcac aaagcgcccg atgggccgcg tgttgaaccc 15720

gctgcgcgaa atgggcgtgc aggtgaaatc ggaagacggt gaccgtcttc ccgttacctt 15780

gcgcgggccg aagacgccga cgccgatcac ctaccgcgtg ccgatggcct ccgcacaggt 15840

gaagtccgcc gtgctgctcg ccggcctcaa cacgcccggc atcacgacgg tcatcgagcc 15900

gatcatgacg cgcgatcata cggaaaagat gctgcagggc tttggcgcca accttaccgt 15960

cgagacggat gcggacggcg tgcgcaccat ccgcctggaa ggccgcggca agctcaccgg 16020

ccaagtcatc gacgtgccgg gcgacccgtc ctcgacggcc ttcccgctgg ttgcggccct 16080

gcttgttccg ggctccgacg tcaccatcct caacgtgctg atgaacccca cccgcaccgg 16140

cctcatcctg acgctgcagg aaatgggcgc cgacatcgaa gtcatcaacc cgcgccttgc 16200

cggcggcgaa gacgtggcgg acctgcgcgt tcgctcctcc acgctgaagg gcgtcacggt 16260

gccggaagac cgcgcgcctt cgatgatcga cgaatatccg attctcgctg tcgccgccgc 16320

cttcgcggaa ggggcgaccg tgatgaacgg tctggaagaa ctccgcgtca aggaaagcga 16380

ccgcctctcg gccgtcgcca atggcctcaa gctcaatggc gtggattgcg atgagggcga 16440

gacgtcgctc gtcgtgcgtg gccgccctga cggcaagggg ctcggcaacg cctcgggcgc 16500

cgccgtcgcc acccatctcg atcaccgcat cgccatgagc ttcctcgtca tgggcctcgt 16560

gtcggaaaac cctgtcacgg tggacgatgc cacgatgatc gccacgagct tcccggagtt 16620

catggacctg atggccgggc tgggcgcgaa gatcgaactc tccgatacga aggctgcctg 16680

aactagtgat cgttcaaaca tttggcaata aagtttctta agattgaatc ctgttgccgg 16740

tcttgcgatg attatcatat aatttctgtt gaattacgtt aagcatgtaa taattaacat 16800

gtaatgcatg acgttattta tgagatgggt ttttatgatt agagtcccgc aattatacat 16860

ttaatacgcg atagaaaaca aaatatagcg cgcaaactag gataaattat cgcgcgcggt 16920

gtcatctatg ttactagatc cctgcaggga attcttaatt aagtgcacgc ggccgcctac 16980

ttagtcaaga gcctcgcacg cgactgtcac gcggccagga tcgcctcgtg agcctcgcaa 17040

tctgtaccta gtttagctag ttaggacgtt aacagggacg cgcctggccg tatccgcaat 17100

agttatgtcc ctctgtccta taataatgta gctggttcta gatataccat aagtcaattt 17160

ttattagatt tgactgaact tcttccatca acatgcccaa ctagtatcat taaattcacc 17220

gtaaaataaa tttagtatac ttcttttttg gtgttgcacc tgttaattat tttctatttt 17280

aatttagaac taatccaaat tacagaatga tgcatgtgag atcttcataa ttttgttaga 17340

taactcatct attagtgttt aaccttatgg tatttaattt taggatggtc caagatccac 17400

ggtacagtac caccatgcta gctcgggcgg cctacgtgtc ttcatggatc cataactatg 17460

atgcatgcac acactgacac acattctggt gaccctggac atgtagattg atgcgacaga 17520

actatttaaa ggacactcat tttcgccatg gtagaggacg aggctccggc gccgcctccc 17580

ccgtcgtgca tgcaaggcct cgtcgggccc gctctccgcc gctgccttca ttctcaccgc 17640

cagttctcgt gcgctcacct cgtcccgctc tcgtgtcaca gaagatggtc gatccgcagc 17700

tggtgcaggt gaggcgctcg gcgtccccgc cggtccccga gctggggtcg tcgaaatcgg 17760

agaaacggcg gcggcaaagc catggcggtc gaaatccccg agcttggatg agttggacag 17820

gaaaaaaaat ttatatgtgc atagtatgtt ttacgggtta atttaggcct tgttcagata 17880

tttccaggga ttggaaaaat tttagaaaaa aatttaattt tcttaggatt taaatccatc 17940

aatcacactc agttcacatg gattgataac tatccaaaca aaccttttgg aagaatcact 18000

ccgagagata ttgatatgag ggacgaattc tggtgatgtg atgtgacata aagggaagaa 18060

atttttagag gaaaccattg cagtcagtct taattctaca ctcttcctca caattctgac 18120

tgcatcatta caagcgtaca ccgcctagtc accaccatta caacacgggt gcccccaata 18180

ataacgttgt gataattaac gacgacgtac gattacgcga ga 18222

<210> 6

<211> 496

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acactgatag tttaaactga aggcgggaaa cgacaatctg atcaagagcg gagaattaag 60

ggagtcacgt tatgaccccc gccgatgacg cgggacaagc cgttttacgt ttggaactga 120

cagaaccgca acgctgcagg aattggccgc aggtggattt gtattaaact aatgactaat 180

tagtggcact agcctcaccg acttcgcaga cgaggccgct aagtcgcagc tacgctctca 240

acggcactga ctaggtagtt taaacgtgca cttaattaag gtaccgggaa tttaaatccc 300

gggaggtctc gcagacctag ctagttagaa tcccgagacc taagtgacta gggtcacgtg 360

accctagtca cttaaagctg atctagtaac atagatgaca ccgcgcgcga taatttatcc 420

tagtttgcgc gctatatttt gttttctatc gcgtattaaa tgtataattg cgggactcta 480

atcataaaaa cccatc 496

<210> 7

<211> 210

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atccctgcag 60

ggaattctta attaagtgca cgcggccgcc tacttagtca agagcctcgc acgcgactgt 120

cacgcggcca ggatcgcctc gtgagcctcg caatctgtac ctagtttagc tagttaggac 180

gttaacaggg acgcgcctgg ccgtatccgc 210

<210> 8

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctttgtagat cttgagaagt tatagaa 27

<210> 9

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gatgggtttt tatgattaga gtcccgca 28

<210> 10

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcgcgcaaac taggataaat tatcgcgcg 29

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tctcgcgtaa tcgtacgtcg tcgtt 25

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aacggcctcg aaagtagaag ctatc 25

<210> 13

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atcagcttta agtgactagg gtcacgt 27

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggatcgacca tcttctgtga cacga 25

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ccgcctactt agtcaagagc ctcg 24

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tgggaggacg gaatgatatt g 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aactcgtccg tgagcatcat c 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aactcgtccg tgagcatcat c 21

<210> 19

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ggacagaggc accgcatt 18

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

cgggtctgca agcaaacg 18

<210> 21

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tccacttggc ggttgaactc ctcc 24

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ggtgtcctcg tagtggatgt 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tgatccagta caccgtgaag 20

<210> 24

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ttcaggtgaa tcgatggc 18

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gcaaatcctc tggcctttcc 20

<210> 26

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tgaaggaccg gtgggagat 19

<210> 27

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

cgtccgcatt cccggcga 18

<210> 28

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

agcagacggc acggcatctc tgt 23

<210> 29

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

cagaagtaga actaccgggc cct 23

<210> 30

<211> 538

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

catccagttc aacgacatga acagcgccct gaccaccgcc atcccactct tcgccgtcca 60

gaactaccaa gtcccgctcc tgtccgtgta cgtccaggcc gccaacctgc acctcagcgt 120

gctgagggac gtcagcgtgt ttggccagag gtggggcttc gacgccgcca ccatcaacag 180

ccgctacaac gacctcacca ggctgatcgg caactacacc gaccacgctg tccgctggta 240

caacactggc ctggagcgcg tctggggccc tgattctaga gactggattc gctacaacca 300

gttcaggcgc gagctgaccc tcaccgtcct ggacattgtg tccctcttcc cgaactacga 360

ctcccgcacc tacccgatcc gcaccgtgtc ccaactgacc cgcgaaatct acaccaaccc 420

cgtcctggag aacttcgacg gtagcttcag gggcagcgcc cagggcatcg agggctccat 480

caggagccca cacctgatgg acatcctcaa cagcatcact atctacaccg atgcccac 538

<210> 31

<211> 597

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

agaagaacaa ccacagcctg tacgtggacc ccgtcgtcgg cacggtggcc agcttccttc 60

tcaagaaggt cggctctctc gtcgggaagc gcatcctctc ggaactccgc aacctgatct 120

ttccatctgg ctccaccaac ctcatgcaag acatcctcag ggagaccgag aagtttctca 180

accagcgcct caacactgat acccttgctc gcgtcaacgc tgagctgacg ggtctgcaag 240

caaacgtgga ggagttcaac cgccaagtgg acaacttcct caaccccaac cgcaatgcgg 300

tgcctctgtc catcacttct tccgtgaaca ccatgcaaca actgttcctc aaccgcttgc 360

ctcagttcca gatgcaaggc taccagctgc tcctgctgcc actctttgct caggctgcca 420

acctgcacct ctccttcatt cgtgacgtga tcctcaacgc tgacgagtgg ggcatctctg 480

cagccacgct gaggacctac cgcgactacc tgaagaacta caccagggac tactccaact 540

attgcatcaa cacctaccag tcggccttca agggcctcaa tacgaggctt cacgaca 597

<210> 32

<211> 530

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

gatccagtac accgtgaagg gcaagccatc gattcacctg aaggacgaga acaccggcta 60

catccactac gaggacacca acaacaacct ggaggactac cagaccatca acaagcgctt 120

caccaccggc accgacctga agggcgtgta cctgatcctg aagagccaga acggcgacga 180

ggcctggggc gacaacttca tcatcctgga gatcagcccg agcgagaagc tgctgagccc 240

ggagctgatc aacaccaaca actggaccag caccggcagc accaacatca gcggcaacac 300

cctgaccctg taccagggcg gccgcggcat cctgaagcag aacctgcagc tggacagctt 360

cagcacctac cgcgtgtact tcagcgtgag cggcgacgcc aacgtgcgca tccgcaactc 420

ccgcgaggtg ctgttcgaga agaggtacat gagcggcgcc aaggacgtga gcgagatgtt 480

caccaccaag ttcgagaagg acaacttcta catcgagctg agccagggca 530

<210> 33

<211> 655

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ctacgatttc gacagcacct tcatcggcga cgcctcgctc acaaagcgcc cgatgggccg 60

cgtgttgaac ccgctgcgcg aaatgggcgt gcaggtgaaa tcggaagacg gtgaccgtct 120

tcccgttacc ttgcgcgggc cgaagacgcc gacgccgatc acctaccgcg tgccgatggc 180

ctccgcacag gtgaagtccg ccgtgctgct cgccggcctc aacacgcccg gcatcacgac 240

ggtcatcgag ccgatcatga cgcgcgatca tacggaaaag atgctgcagg gctttggcgc 300

caaccttacc gtcgagacgg atgcggacgg cgtgcgcacc atccgcctgg aaggccgcgg 360

caagctcacc ggccaagtca tcgacgtgcc gggcgacccg tcctcgacgg ccttcccgct 420

ggttgcggcc ctgcttgttc cgggctccga cgtcaccatc ctcaacgtgc tgatgaaccc 480

cacccgcacc ggcctcatcc tgacgctgca ggaaatgggc gccgacatcg aagtcatcaa 540

cccgcgcctt gccggcggcg aagacgtggc ggacctgcgc gttcgctcct ccacgctgaa 600

gggcgtcacg gtgccggaag accgcgcgcc ttcgatgatc gacgaatatc cgatt 655

<210> 34

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

ctaacatctc gccgctgtac tga 23

<210> 35

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

cagagttcag ggtcacgttg 20

<210> 36

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

gccaatgttg atgtcgctga 20

<210> 37

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

cgatacgaag gctgcctgaa 20

<210> 38

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

ccatcaggtc catgaactcc 20

<210> 39

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

gtgacagggt tttccgacac 20

Claims

1. A nucleic acid sequence comprising one or more selected from the sequences SEQ ID NOs 1 to 7 and complements thereof.

2. The nucleic acid sequence of claim 1, wherein the nucleic acid sequence is derived from a plant, seed, or cell comprising maize event LP007-5, a representative sample of seed comprising said event having been deposited under deposit number CCTCC No. P202018.

3. The nucleic acid sequence of claim 1, wherein the nucleic acid sequence is an amplicon diagnostic for the presence of maize event LP 007-5.

4. A DNA primer pair comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a partial sequence of SEQ ID NO 5 or a complement thereof and when used in an amplification reaction with DNA comprising maize event LP007-5 produce an amplicon that detects maize event LP007-5 in a sample,

specifically, the first primer is selected from SEQ ID NO. 1 or a complementary sequence thereof, SEQ ID NO. 8 or SEQ ID NO. 12; the second primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14.

More specifically, the first primer is selected from SEQ ID NO. 1 or a complementary sequence thereof, SEQ ID NO. 8 or SEQ ID NO. 12, and the second primer is selected from SEQ ID NO. 9 or SEQ ID NO. 13; or the first primer is selected from SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 11 or SEQ ID NO. 14, and the second primer is selected from SEQ ID NO. 10 or SEQ ID NO. 15.

5. A DNA probe comprising a partial sequence of SEQ ID NO. 5 or a complementary sequence thereof, which hybridizes under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1 to 7 or a complementary sequence thereof and does not hybridize under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1 to 7 or a complementary sequence thereof,

specifically, the DNA probe comprises a sequence selected from SEQ ID NO. 3 or a complementary sequence thereof, SEQ ID NO. 4 or a complementary sequence thereof,

more specifically, the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO. 1 or a complementary sequence thereof, SEQ ID NO. 2 or a complementary sequence thereof, SEQ ID NO. 6 or a complementary sequence thereof, and SEQ ID NO. 7 or a complementary sequence thereof.

6. A marker nucleic acid molecule comprising a partial sequence of SEQ ID NO. 5 or a complementary sequence thereof, which hybridizes under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1 to 7 or a complementary sequence thereof and does not hybridize under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO. 1 to 7 or a complementary sequence thereof,

in particular, the marker nucleic acid molecule comprises a sequence selected from SEQ ID NO 3 or the complement thereof, SEQ ID NO 4 or the complement thereof,

more specifically, the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO 1 or its complement, SEQ ID NO 2 or its complement, SEQ ID NO 6 or its complement and SEQ ID NO 7 or its complement.

7. A method for detecting the presence of DNA comprising transgenic corn event LP007-5 in a sample comprising:

(1) contacting a sample to be tested with the DNA primer pair of claim 4 in a nucleic acid amplification reaction;

(2) performing a nucleic acid amplification reaction;

(3) detecting the presence of the amplification product;

the amplification product comprises a nucleic acid sequence selected from the group consisting of sequences SEQ ID NOS: 1-7 and complements thereof, i.e., indicates the presence of DNA comprising transgenic maize event LP007-5 in the test sample.

8. A method for detecting the presence of DNA comprising transgenic corn event LP007-5 in a sample comprising:

(1) contacting a sample to be tested with the DNA probe of claim 5, and/or the marker nucleic acid molecule of claim 6;

(2) hybridizing the sample to be tested to the probe and/or the marker nucleic acid molecule under stringent hybridization conditions;

9. A DNA detection kit, comprising: the pair of DNA primers of claim 4, the DNA probe of claim 5, and/or the marker nucleic acid molecule of claim 6.

10. A method of protecting a corn plant from insect infestation comprising providing at least one transgenic corn plant cell comprising transgenic corn event LP007-5 in the diet of a target insect; target insects that feed on the transgenic corn plant cell are inhibited from further feeding on the corn plant.

11. A method of protecting a corn plant from herbicide induced damage comprising growing at least one transgenic corn plant comprising transgenic corn event LP 007-5.

12. A method of controlling weeds in a field planted with corn plants, comprising applying an effective dose of glyphosate herbicide to a field planted with at least one transgenic corn plant comprising transgenic corn event LP 007-5.

13. A method of growing a corn plant resistant to insects and/or tolerant to glyphosate herbicide comprising: planting at least one corn seed comprising transgenic corn event LP 007-5;

growing the corn seed into a corn plant;

attacking said maize plant with a target insect, and/or spraying said maize plant with an effective dose of glyphosate herbicide, harvesting a plant having reduced plant damage compared to other plants not having said transgenic maize event LP 007-5.

14. A processed product that produces autogenic corn event LP007-5, wherein said processed product is corn flour, corn oil, corn silk, or corn starch.