CN113151485A - Chip, primer combination, kit and identification method for identifying Jining whooping chicken - Google Patents
Chip, primer combination, kit and identification method for identifying Jining whooping chicken Download PDFInfo
- Publication number
- CN113151485A CN113151485A CN202011417224.4A CN202011417224A CN113151485A CN 113151485 A CN113151485 A CN 113151485A CN 202011417224 A CN202011417224 A CN 202011417224A CN 113151485 A CN113151485 A CN 113151485A
- Authority
- CN
- China
- Prior art keywords
- chicken
- gene
- jining
- whooping
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 288
- 238000000034 method Methods 0.000 title claims abstract description 15
- 230000002068 genetic effect Effects 0.000 claims abstract description 25
- 235000013330 chicken meat Nutrition 0.000 claims description 283
- 210000000349 chromosome Anatomy 0.000 claims description 111
- 108020004414 DNA Proteins 0.000 claims description 94
- 102000053602 DNA Human genes 0.000 claims description 50
- 108020004682 Single-Stranded DNA Proteins 0.000 claims description 50
- 239000003550 marker Substances 0.000 claims description 48
- 108090000623 proteins and genes Proteins 0.000 claims description 25
- 101100368725 Bacillus subtilis (strain 168) tagF gene Proteins 0.000 claims description 10
- 101100545272 Caenorhabditis elegans zif-1 gene Proteins 0.000 claims description 10
- 101100428022 Arabidopsis thaliana UTR3 gene Proteins 0.000 claims description 7
- 101000757620 Homo sapiens ADP-ribosylation factor-like protein 13B Proteins 0.000 claims description 7
- 101000715592 Homo sapiens Cocaine- and amphetamine-regulated transcript protein Proteins 0.000 claims description 7
- 101001053984 Homo sapiens Disks large homolog 1 Proteins 0.000 claims description 7
- 101000951365 Homo sapiens Disks large-associated protein 5 Proteins 0.000 claims description 7
- 101001011412 Homo sapiens IQ calmodulin-binding motif-containing protein 1 Proteins 0.000 claims description 7
- 101000945215 Homo sapiens Kelch-like protein 29 Proteins 0.000 claims description 7
- 101000610202 Homo sapiens Poly(A) polymerase beta Proteins 0.000 claims description 7
- 101000602149 Homo sapiens Programmed cell death protein 10 Proteins 0.000 claims description 7
- 101000928408 Homo sapiens Protein diaphanous homolog 2 Proteins 0.000 claims description 7
- 101001072243 Homo sapiens Protocadherin-19 Proteins 0.000 claims description 7
- 101000649929 Homo sapiens Serine/threonine-protein kinase VRK1 Proteins 0.000 claims description 7
- 101001026230 Homo sapiens Small conductance calcium-activated potassium channel protein 2 Proteins 0.000 claims description 7
- 101000633700 Homo sapiens Src kinase-associated phosphoprotein 1 Proteins 0.000 claims description 7
- 101000805518 Homo sapiens Transcription cofactor vestigial-like protein 4 Proteins 0.000 claims description 7
- 101000637950 Homo sapiens Transmembrane protein 127 Proteins 0.000 claims description 7
- 101000889747 Homo sapiens Tudor domain-containing protein 15 Proteins 0.000 claims description 7
- 101000818832 Homo sapiens Zinc finger protein 608 Proteins 0.000 claims description 7
- 101710148333 Regulator of G-protein signaling 13 Proteins 0.000 claims description 7
- 101100453133 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) ISY1 gene Proteins 0.000 claims description 7
- 238000003780 insertion Methods 0.000 claims description 7
- 230000037431 insertion Effects 0.000 claims description 7
- 239000003153 chemical reaction reagent Substances 0.000 claims description 4
- 238000000605 extraction Methods 0.000 claims description 4
- 102000039446 nucleic acids Human genes 0.000 claims description 4
- 108020004707 nucleic acids Proteins 0.000 claims description 4
- 150000007523 nucleic acids Chemical class 0.000 claims description 4
- 239000011535 reaction buffer Substances 0.000 claims description 4
- 230000004544 DNA amplification Effects 0.000 claims description 2
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 2
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 2
- 210000001519 tissue Anatomy 0.000 claims description 2
- 241000167854 Bourreria succulenta Species 0.000 abstract description 10
- 235000007763 Castanea pumila Nutrition 0.000 abstract description 2
- 241000408782 Lepomis microlophus Species 0.000 abstract description 2
- 235000013305 food Nutrition 0.000 abstract description 2
- 238000012214 genetic breeding Methods 0.000 abstract description 2
- 238000001514 detection method Methods 0.000 description 7
- 239000008280 blood Substances 0.000 description 5
- 210000004369 blood Anatomy 0.000 description 5
- 239000000243 solution Substances 0.000 description 5
- 238000000137 annealing Methods 0.000 description 3
- 235000013601 eggs Nutrition 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 2
- 108010006785 Taq Polymerase Proteins 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 238000003776 cleavage reaction Methods 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 230000007017 scission Effects 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- 108700028369 Alleles Proteins 0.000 description 1
- 101150089281 CINP gene Proteins 0.000 description 1
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 208000035240 Disease Resistance Diseases 0.000 description 1
- 241000287826 Gallus Species 0.000 description 1
- 101001032427 Homo sapiens General transcription factor II-I Proteins 0.000 description 1
- 101000801640 Homo sapiens Phospholipid-transporting ATPase ABCA3 Proteins 0.000 description 1
- 101000706152 Homo sapiens Syntaxin-12 Proteins 0.000 description 1
- 201000005702 Pertussis Diseases 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 101150070069 TNNI3K gene Proteins 0.000 description 1
- 230000010100 anticoagulation Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000005251 capillar electrophoresis Methods 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000002431 foraging effect Effects 0.000 description 1
- 238000012268 genome sequencing Methods 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 235000013594 poultry meat Nutrition 0.000 description 1
- 238000012797 qualification Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 108091008146 restriction endonucleases Proteins 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the fields of biotechnology and genetic breeding, in particular to a primer combination, a kit and a method for identifying Jining chinks. The invention provides specific genetic loci of the Jining whooping chicken for the first time, wherein the specific genetic loci comprise SNP loci and INDEL loci. The genetic locus provided by the invention has high specificity, and the identification rate of each locus Jining whooping chicken is more than 83.33%, so that the identification of Jining whooping chicken by using the specific genetic locus combination provided by the invention has higher accuracy. The method provides support for resource protection and identification of Jining chinquapin breeds and food traceability in the future.
Description
Technical Field
The invention relates to the fields of biotechnology and genetic breeding, in particular to a chip, a primer combination, a kit and a method for identifying Jining whooping chicken.
Background
The Jinniu chicken has a central production area located in the suburb of Jining, Shandong province, and about one-hundred-year-old individual of the Jinniu chicken lays eggs, so that the Jinniu chicken is named as the Jinniu chicken. The Jining chinquan chicken is a famous local egg chicken variety in China, has the characteristics of coarseness resistance, disease resistance, strong foraging capacity and precocity, and is an excellent material for cultivating high-yield, precocity and egg chicken species. In recent years, with the impact of high-yield commercial varieties and the lack of consciousness of local chicken variety resource protection, the Jining whooping chicken is endangered. In order to better understand and protect the valuable variety resource, it is necessary to provide a product and a method which can effectively and accurately identify the variety of the Jining chinks.
Disclosure of Invention
The invention mainly aims to provide a chip, a primer combination, a kit and a method for identifying Jining whooping chicken, and provides technical support for identifying Jining whooping chicken varieties.
In order to achieve the purpose, the invention adopts the following technical scheme:
one of the purposes of the invention is to provide a group of specific genetic loci of the Jining whooping chicken, wherein the specific genetic loci of the Jining whooping chicken comprise:
JB _ tag1 is located at chromosome 91173104 of chicken No. 1, gene ARL13B at 11 th intron, and Jining whooping chicken genotype is TT;
JB _ tag2 is located at chromosome 102765389 of chicken No. 3, between gene TDRD15 and gene KLHL29, and the genotype of Jining whooping chicken is TT;
JB _ tag3 is located at chicken No. 4 chromosome 5445667, between gene PCDH19 and gene DIAPH2, and the genotype of Jining chicken is CC;
JB _ tag4 is located at chromosome 46716676 of chicken No. 5, between gene PAPOLB and gene VRK1, and the genotype of Jining whooping chicken is GG;
JB _ tag5 is located at chromosome 12646942 of chicken 9, gene DLG1 intron 2, and Jining whooping chicken genotype is GG;
JB _ tag6 is located at chromosome 4966471 of chicken No. 12, gene VGLL4 intron 2, and the genotype of Jining whooping chicken is TT;
JB _ tag7 is located at chromosome 3243101 of chicken 18, gene TBCD 7 intron, and Jining whooping chicken genotype is TT;
JB _ tag8 is located at chromosome 3670686 of chicken 22, UTR3 region of gene TMEM127, and genotype of Jining whooping chicken is CC;
JB _ tag9 is located at chromosome 6389262 of chicken 27, gene SKAP1 intron 4, and the genotype of Jining whooping chicken is CC;
JB _ tag10 is located at chicken Z chromosome 73463410, between gene CARTPT and gene KCNN2, and the genotype of Jining whooping chicken is GG;
JB _ tag11 is located at chromosome 26300021 of chicken 7, and is located in the downstream region of gene IQCB1, and the genotype of Jining whooping chicken is GG;
JB _ tag12 is located at chromosome 3987620 of chicken 8, gene RGS13 intron 1, and Jining whooping chicken genotype is GG;
JB _ tag13 is located at chromosome 20816210 of chicken 9, between gene PDCD10 and gene ZBX, and the genotype of Jining whooping chicken is AA;
JB _ tag14 is located at chromosome 2100351 of chicken 16, gene MICA intron 1, and Jining whooping chicken genotype- - (- -mutation genotype is insertion T);
JB _ tag15 is located on chicken Z chromosome 81084550, between gene ZNF608 and gene LOC112530693, and the genotype of Jining whooping chicken is AA.
The second purpose of the invention is to provide the application of the specific genetic locus in identifying the variety of the Jining chinks.
The invention also provides a method for identifying the Jining whooping chicken, which comprises the following steps:
extracting a tissue sample of the chicken to be detected, and detecting whether the chicken to be detected has one or more of the following genotypes by gene amplification:
JB _ tag1 is located at chromosome 91173104 of chicken No. 1, gene ARL13B at 11 th intron, and Jining whooping chicken genotype is TT;
JB _ tag2 is located at chromosome 102765389 of chicken No. 3, between gene TDRD15 and gene KLHL29, and the genotype of Jining whooping chicken is TT;
JB _ tag3 is located at chicken No. 4 chromosome 5445667, between gene PCDH19 and gene DIAPH2, and the genotype of Jining chicken is CC;
JB _ tag4 is located at chromosome 46716676 of chicken No. 5, between gene PAPOLB and gene VRK1, and the genotype of Jining whooping chicken is GG;
JB _ tag5 is located at chromosome 12646942 of chicken 9, gene DLG1 intron 2, and Jining whooping chicken genotype is GG;
JB _ tag6 is located at chromosome 4966471 of chicken No. 12, gene VGLL4 intron 2, and the genotype of Jining whooping chicken is TT;
JB _ tag7 is located at chromosome 3243101 of chicken 18, gene TBCD 7 intron, and Jining whooping chicken genotype is TT;
JB _ tag8 is located at chromosome 3670686 of chicken 22, UTR3 region of gene TMEM127, and genotype of Jining whooping chicken is CC;
JB _ tag9 is located at chromosome 6389262 of chicken 27, gene SKAP1 intron 4, and the genotype of Jining whooping chicken is CC;
JB _ tag10 is located at chicken Z chromosome 73463410, between gene CARTPT and gene KCNN2, and the genotype of Jining whooping chicken is GG;
JB _ tag11 is located at chromosome 26300021 of chicken 7, and is located in the downstream region of gene IQCB1, and the genotype of Jining whooping chicken is GG;
JB _ tag12 is located at chromosome 3987620 of chicken 8, gene RGS13 intron 1, and Jining whooping chicken genotype is GG;
JB _ tag13 is located at chromosome 20816210 of chicken 9, between gene PDCD10 and gene ZBX, and the genotype of Jining whooping chicken is AA;
JB _ tag14 is located at chromosome 2100351 of chicken 16, gene MICA intron 1, and Jining whooping chicken genotype- - (- -mutation genotype is insertion T);
JB _ tag15 is located on chicken Z chromosome 81084550, between gene ZNF608 and gene LOC112530693, and the genotype of Jining whooping chicken is AA.
The fourth purpose of the invention is to provide a chip for identifying the variety of the Jining whooping chicken, which detects one or more specific genetic loci as follows:
JB _ tag1 is located at chromosome 91173104 of chicken No. 1, gene ARL13B at 11 th intron, and Jining whooping chicken genotype is TT;
JB _ tag2 is located at chromosome 102765389 of chicken No. 3, between gene TDRD15 and gene KLHL29, and the genotype of Jining whooping chicken is TT;
JB _ tag3 is located at chicken No. 4 chromosome 5445667, between gene PCDH19 and gene DIAPH2, and the genotype of Jining chicken is CC;
JB _ tag4 is located at chromosome 46716676 of chicken No. 5, between gene PAPOLB and gene VRK1, and the genotype of Jining whooping chicken is GG;
JB _ tag5 is located at chromosome 12646942 of chicken 9, gene DLG1 intron 2, and Jining whooping chicken genotype is GG;
JB _ tag6 is located at chromosome 4966471 of chicken No. 12, gene VGLL4 intron 2, and the genotype of Jining whooping chicken is TT;
JB _ tag7 is located at chromosome 3243101 of chicken 18, gene TBCD 7 intron, and Jining whooping chicken genotype is TT;
JB _ tag8 is located at chromosome 3670686 of chicken 22, UTR3 region of gene TMEM127, and genotype of Jining whooping chicken is CC;
JB _ tag9 is located at chromosome 6389262 of chicken 27, gene SKAP1 intron 4, and the genotype of Jining whooping chicken is CC;
JB _ tag10 is located at chicken Z chromosome 73463410, between gene CARTPT and gene KCNN2, and the genotype of Jining whooping chicken is GG;
JB _ tag11 is located at chromosome 26300021 of chicken 7, and is located in the downstream region of gene IQCB1, and the genotype of Jining whooping chicken is GG;
JB _ tag12 is located at chromosome 3987620 of chicken 8, gene RGS13 intron 1, and Jining whooping chicken genotype is GG;
JB _ tag13 is located at chromosome 20816210 of chicken 9, between gene PDCD10 and gene ZBX, and the genotype of Jining whooping chicken is AA;
JB _ tag14 is located at chromosome 2100351 of chicken 16, gene MICA intron 1, and Jining whooping chicken genotype- - (- -mutation genotype is insertion T);
JB _ tag15 is located on chicken Z chromosome 81084550, between gene ZNF608 and gene LOC112530693, and the genotype of Jining whooping chicken is AA.
The fifth purpose of the invention is to provide the application of the chip in identification of the variety of the Jining chinks.
The sixth object of the present invention is to provide a primer combination for detecting the specific genetic locus of the chicken with chinks, wherein the primer combination comprises:
the primers used for detecting the marker JB _ tag1 are two single-stranded DNAs represented by JB _ P1f and JB _ P1 r:
JB_P1f：GCATTCTCCATTGTTCATTC；
JB_P1r：AGTCTGCTTATCTTCCTCTC；
the primers used for detecting the marker JB _ tag2 are two single-stranded DNAs represented by JB _ P2f and JB _ P2 r:
JB_P2f：CCATCATCCTCGCTACATT；
JB_P2r：CAAGTGCTACTGCCTCTC；
the primers used for detecting the marker JB _ tag3 are two single-stranded DNAs represented by JB _ P3f and JB _ P3 r:
JB_P3f：ACTACACAGATTACACAGAGG；
JB_P3r：AGAGAACGGTCACAATGC；
the primers used for detecting the marker JB _ tag4 are two single-stranded DNAs represented by JB _ P4f and JB _ P4 r:
JB_P4f：GGAAGCATTCATTGTCTCAG；
JB_P4r：AACTTGTGGATTCATTGGTG；
the primers used for detecting the marker JB _ tag5 are two single-stranded DNAs represented by JB _ P5f and JB _ P5 r:
JB_P5f：CCTCATCCTCCACCAGTA；
JB_P5r：GCAACTTCCATACGCATT；
the primers used for detecting the marker JB _ tag6 are two single-stranded DNAs represented by JB _ P6f and JB _ P6 r:
JB_P6f：AGGAGGAGAAGTATGGAAGT；
JB_P6r：CTGAGTATGCTAATGGTGTTC；
the primers used for detecting the marker JB _ tag7 are two single-stranded DNAs represented by JB _ P7f and JB _ P7 r:
JB_P7f：TATGCTGATGCTGCTGAG；
JB_P7r：CAGATGTGCCAAGATGCT；
the primers used for detecting the marker JB _ tag8 are two single-stranded DNAs represented by JB _ P8f and JB _ P8 r:
JB_P8f：CCTCGTGGCTCTCCTTAT；
JB_P8r：GTCTCCATTCATCTCGGTTA；
the primers used for detecting the marker JB _ tag9 are two single-stranded DNAs represented by JB _ P9f and JB _ P9 r:
JB_P9f：GGATTGAAGTGGTTGAGTTG；
JB_P9r：CGGAGTGTAGATATAGAAGGTA；
the primers used for detecting the marker JB _ tag10 are two single-stranded DNAs represented by JB _ P10f and JB _ P10 r:
JB_P10f：TGCTGATTGTCCTGAAGTC；
JB_P10r：CCTGCTGTATCCTGAAGTG；
the primers used for detecting the marker JB _ tag11 are two single-stranded DNAs represented by JB _ P11f and JB _ P11 r:
JB_P11f：TTGAGGTGAAGGTGGATTC；
JB_P11r：TGGTTGAAGAAGATGAAGGT；
the primers used for detecting the marker JB _ tag12 are two single-stranded DNAs represented by JB _ P12f and JB _ P12 r:
JB_P12f：ATTCTGGCTTGCTTGTGA；
JB_P12r：TGGTGCTGTAAGTGATTAAC；
the primers used for detecting the marker JB _ tag13 are two single-stranded DNAs represented by JB _ P13f and JB _ P13 r:
JB_P13f：CCTGAGAATGAGAACTGCTA；
JB_P13r：CCTATTACCATCCTTCCTACAT；
the primers used for detecting the marker JB _ tag14 are two single-stranded DNAs represented by JB _ P14f and JB _ P14 r:
JB_P14f：GAGATGTGTCCAGCCTTC；
JB_P14r：CCATTCATTGCTCACCTTC；
the primers used for detecting the marker JB _ tag15 are two single-stranded DNAs represented by JB _ P15f and JB _ P15 r:
JB_P15f：TGTGTTGAGTGTGATAGCA；
JB_P15r：GGCAAGTTAGTGTGAATGTT。
the seventh purpose of the invention is to provide the application of the primer combination in identifying the variety of the Jining chinks.
The invention also provides a kit for identifying the variety of the Jining chinks, which comprises one or more pairs of the primer combinations.
Further, the kit also comprises at least one of nucleic acid extraction reagent, PCR reaction buffer solution, DNA polymerase and dNTPs.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides specific genetic loci of the Jining whooping chicken for the first time, wherein the specific genetic loci comprise SNP loci and INDEL loci; the genetic locus provided by the invention has high specificity, and the identification rate of each locus Jining whooping chicken is 83.33% or more. Therefore, the identification of the Jining chinks by the specific genetic locus combination provided by the invention has higher accuracy. The method provides support for resource protection and identification of Jining chinquapin breeds and food traceability in the future.
Detailed Description
It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of the stated features, steps, operations, and/or combinations thereof, unless the context clearly indicates otherwise.
In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.
Example 1 specific genetic loci for Jining whooping chickens
The sample comprises 20 Jining chinks (20), 20 Rugao yellow chickens (20), 20 Langya chickens (20), shou chicken (20), Wenshang Luhua chickens (20), Taihu lake chickens (20), Luyuan chickens (20), Langshan chickens (20), Li Yang chickens (20), Xuhai chickens (20), Longsheng chicken (20), Yimeng chickens (20), Minqingmaojiao chickens (20) and Huaibei Ma chickens (20), and each variety of male and female is half. Collecting blood of wing vein by 0.5-1.0ml, placing into anticoagulation tube, and storing at-70 deg.C.
The genomic DNA was extracted using a conventional blood DNA extraction kit. And carrying out enzyme digestion on the genome DNA by using restriction enzyme, adding a sequencing joint to construct a small fragment library, and carrying out GBS simplified genome sequencing.
In order to check the efficiency of the cleavage and facilitate subsequent sequence analysis, an electronic cleavage evaluation of the chromosome was performed. To ensure data quality, the original sequence is more strictly filtered: removing reads containing linker sequences; removing the read length of unknown base with the proportion more than 10%; removing low-quality read length (base occupation ratio higher than 50% with Q value lower than 10). And (3) removing the individual of the Longsheng chicken 1 from sequencing data due to unqualified quality control.
Analyzing 279 simplified local chicken genome sequences by a minimum allele frequency-linkage disequilibrium method, and screening to obtain 20 variety-specific SNPs/INDELs markers of the Jinning chinks. The physical location of the 20 SNPs/INDELs sites was determined based on alignment of a reference sequence of the whole chicken genome with the version number of the standard sequence (Gallus galllus GRCg 6). The specific SNPs/INDELs loci of the Jinning whooping chicken breed are as follows:
JB _ tag1 is located at chromosome 91173104 of chicken No. 1, gene ARL13B at 11 th intron, and Jining whooping chicken genotype is TT;
JB _ tag2 is located at chromosome 102765389 of chicken No. 3, between gene TDRD15 and gene KLHL29, and the genotype of Jining whooping chicken is TT;
JB _ tag3 is located at chicken No. 4 chromosome 5445667, between gene PCDH19 and gene DIAPH2, and the genotype of Jining chicken is CC;
JB _ tag4 is located at chromosome 46716676 of chicken No. 5, between gene PAPOLB and gene VRK1, and the genotype of Jining whooping chicken is GG;
JB _ tag5 is located at chromosome 12646942 of chicken 9, gene DLG1 intron 2, and Jining whooping chicken genotype is GG;
JB _ tag6 is located at chromosome 4966471 of chicken No. 12, gene VGLL4 intron 2, and the genotype of Jining whooping chicken is TT;
JB _ tag7 is located at chromosome 3243101 of chicken 18, gene TBCD 7 intron, and Jining whooping chicken genotype is TT;
JB _ tag8 is located at chromosome 3670686 of chicken 22, UTR3 region of gene TMEM127, and genotype of Jining whooping chicken is CC;
JB _ tag9 is located at chromosome 6389262 of chicken 27, gene SKAP1 intron 4, and the genotype of Jining whooping chicken is CC;
JB _ tag10 is located at chicken Z chromosome 73463410, between gene CARTPT and gene KCNN2, and the genotype of Jining whooping chicken is GG;
JB _ tag11 is located at chromosome 26300021 of chicken 7, and is located in the downstream region of gene IQCB1, and the genotype of Jining whooping chicken is GG;
JB _ tag12 is located at chromosome 3987620 of chicken 8, gene RGS13 intron 1, and Jining whooping chicken genotype is GG;
JB _ tag13 is located at chromosome 20816210 of chicken 9, between gene PDCD10 and gene ZBX, and the genotype of Jining whooping chicken is AA;
JB _ tag14 is located at chromosome 2100351 of chicken 16, gene MICA intron 1, and Jining whooping chicken genotype- - (- -mutation genotype is insertion T);
JB _ tag15 is located at chicken Z chromosome 81084550, between gene ZNF608 and gene LOC112530693, and the genotype of Jining whooping chicken is AA;
gene5_1 is located on chromosome 49784217 No. 5, intron 2 of CINP Gene, and genotype of Jining whooping chicken is TT;
gene8_2 is located on chromosome 29949231 No. 8, the 3 rd intron of TNNI3K Gene, and the genotype of Jining whooping chicken is CC;
gene14_2 is located on chromosome 13995320 of chicken 14, and the 14 th exon of Gene ABCA3, and the genotype of Jining whooping chicken is GG;
gene19_1 is located at chromosome 2863260 of chicken 19, and is located in the downstream region of Gene GTF2I, and the genotype of the Jining whooping chicken is CC;
gene23_1 is located on chromosome 1526334 of chicken 23, Gene STX12 intron 1, and the genotype of Jining whooping chicken is TT. Wherein JB _ tag14 is INDELs locus, and others are SNP loci. The genetic locus has strong characteristics and can be used for identifying the variety of the Jining whooping chicken.
In addition, the specific genetic locus of the Jining chinquan chicken can be used for preparing a chip for identifying Jining chinquan chicken varieties.
Example 2 primer combination for detection of Jining whooping chicken
Providing a primer combination for detecting the specific genetic locus of the Jining whooping chicken in example 1:
primers for detecting the marker JB _ tag1 are two single-stranded DNAs represented by JB _ P1f and JB _ P1 r;
primers for detecting the marker JB _ tag2 are two single-stranded DNAs represented by JB _ P2f and JB _ P2 r;
primers for detecting the marker JB _ tag3 are two single-stranded DNAs represented by JB _ P3f and JB _ P3 r;
primers for detecting the marker JB _ tag4 are two single-stranded DNAs represented by JB _ P4f and JB _ P4 r;
primers for detecting the marker JB _ tag5 are two single-stranded DNAs represented by JB _ P5f and JB _ P5 r;
primers for detecting the marker JB _ tag6 are two single-stranded DNAs represented by JB _ P6f and JB _ P6 r;
primers for detecting the marker JB _ tag7 are two single-stranded DNAs represented by JB _ P7f and JB _ P7 r;
primers for detecting the marker JB _ tag8 are two single-stranded DNAs represented by JB _ P8f and JB _ P8 r;
primers for detecting the marker JB _ tag9 are two single-stranded DNAs represented by JB _ P9f and JB _ P9 r;
primers for detecting the marker JB _ tag10 are two single-stranded DNAs represented by JB _ P10f and JB _ P10 r;
primers for detecting the marker JB _ tag11 are two single-stranded DNAs represented by JB _ P11f and JB _ P11 r;
primers for detecting the marker JB _ tag12 are two single-stranded DNAs represented by JB _ P12f and JB _ P12 r;
primers for detecting the marker JB _ tag13 are two single-stranded DNAs represented by JB _ P13f and JB _ P13 r;
primers for detecting the marker JB _ tag14 are two single-stranded DNAs represented by JB _ P14f and JB _ P14 r;
primers for detecting the marker JB _ tag15 are two single-stranded DNAs represented by JB _ P15f and JB _ P15 r;
the primers used for detecting the labeled Gene5_1 were two single-stranded DNAs represented by Gene _ P5_1f and Gene _ P5_1 r;
the primers used for detecting the marker Gene8_2 were two single-stranded DNAs represented by Gene _ P8_2f and Gene _ P8_2 r;
the primers used for detecting the marker Gene14_2 were two single-stranded DNAs represented by Gene _ P14_2f and Gene _ P14_2 r;
the primers used for detecting the labeled Gene19_1 were two single-stranded DNAs represented by Gene _ P19_1f and Gene _ P19_1 r;
the primers used for detecting the labeled Gene23_1 were two single-stranded DNAs represented by Gene _ P23_1f and Gene _ P23_1 r; the primer sequences, the lengths of the amplified fragments, and the annealing temperatures are specifically shown in Table 1 below.
TABLE 1 amplification primers for detection of specific markers of Jining whooping chicken breeds
Example 3 detection kit for identifying Jining chicken
The kit comprises the following primer combinations: JB _ P1f and JB _ P1r, JB _ P2f and JB _ P2r, JB _ P3f and JB _ P3r, JB _ P4f and JB _ P4r, JB _ P5f and JB _ P5r, JB _ P6r and JB _ P6r, JB _ P7r and JB _ P7r, JB _ P8r and JB _ P8r, JB _ P9r and JB _ P9r, JB _ P10 and JB _ P10r, JB _ P11 and JB _ P11r, JB _ P12r and JB _ P12r, JB _ P13 and JB _ P13r, JB _ P14 and JB _ P14r, JB _ P15 and JB _ P15 r; also comprises PCR reaction buffer solution, TaqDNA polymerase and dNTPs, and nucleic acid extraction reagent.
Example 4 detection kit for identifying Jining chicken
The kit comprises the following primer combinations: JB _ P2f and JB _ P2r, JB _ P3f and JB _ P3r, JB _ P5f and JB _ P5r, JB _ P6f and JB _ P6r, JB _ P7f and JB _ P7r, JB _ P8f and JB _ P8r, JB _ P9f and JB _ P9r, JB _ P10f and JB _ P10r, JB _ P11f and JB _ P11r, JB _ P13f and JB _ P13r, JB _ P15f and JB _ P15 r; eleven pairs of primers in total; also comprises PCR reaction buffer solution, TaqDNA polymerase and dNTPs, and nucleic acid extraction reagent.
Examples of the experiments
The chicken to be tested is identified by identifying the specific genetic locus as described in example 1. 30 parts of a blood sample of the Jining chicken and 350 parts of a blood sample of the non-Jining chicken are taken as samples to be tested.
The specific operation steps are as follows:
380 parts of blood sample genome DNA is extracted by a CTAB method, and PCR amplification is carried out after the qualification of ultraviolet spectrophotometer detection and agarose electrophoresis detection.
And (3) PCR amplification process:
1) reaction system: the 10 mul system includes 50ng of identification material DNA template, forward and reverse primers lOng, 5 mul 2
power Taq MasterMix, and the rest volume is complemented by ultrapure water;
2) reaction procedure: firstly, denaturation at 94 ℃ for 30s, annealing at 51.0-56.1 ℃ for 30s, and extension at 72 ℃ for 30s for 5 cycles; then denaturation at 94 ℃ for 30s, annealing at 49.6-56.9 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; extending for 5min at 72 ℃, and storing at 4 ℃.
The amplified product is sent to a sequencing company for sequence polymorphism detection. For INDELs markers, capillary electrophoresis was also chosen to detect fragment amplification length as a basis for genotyping.
The identification rate of each of the above specific marker sites for Jining pertussis is shown in Table 2 below.
TABLE 2 identifying rate of specific markers for Jining chicken variety
As can be seen from table 2, the identification rate of each specific genetic locus JB _ tag1-JB _ tag15 in example 1 to juing whooping chicken is 83.3% or more, so that juing whooping chicken can be identified with higher accuracy by using the specific genetic loci JB _ tag1-JB _ tag15 as an identification combination; the identification rate of the specific genetic loci described in Gene5_1, Gene8_2, Gene14_2, Gene19_1, and Gene23_1 to Jining whooping chickens was 80% or less, and thus the Gene was eliminated.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> Xueyi science and technology (Chengdu) Co Ltd of poultry scientific institute in Jiangsu province
<120> chip, primer combination, kit and identification method for identifying Jining whooping chicken
<130>
<160> 40
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
gcattctcca ttgttcattc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
agtctgctta tcttcctctc 20
<210> 3
<211> 19
<212> DNA
<213> Artificial sequence
<400> 3
ccatcatcct cgctacatt 19
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence
<400> 4
caagtgctac tgcctctc 18
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<400> 5
actacacaga ttacacagag g 21
<210> 6
<211> 18
<212> DNA
<213> Artificial sequence
<400> 6
agagaacggt cacaatgc 18
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
ggaagcattc attgtctcag 20
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<400> 8
aacttgtgga ttcattggtg 20
<210> 9
<211> 18
<212> DNA
<213> Artificial sequence
<400> 9
cctcatcctc caccagta 18
<210> 10
<211> 18
<212> DNA
<213> Artificial sequence
<400> 10
gcaacttcca tacgcatt 18
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<400> 11
aggaggagaa gtatggaagt 20
<210> 12
<211> 21
<212> DNA
<213> Artificial sequence
<400> 12
ctgagtatgc taatggtgtt c 21
<210> 13
<211> 18
<212> DNA
<213> Artificial sequence
<400> 13
tatgctgatg ctgctgag 18
<210> 14
<211> 18
<212> DNA
<213> Artificial sequence
<400> 14
cagatgtgcc aagatgct 18
<210> 15
<211> 18
<212> DNA
<213> Artificial sequence
<400> 15
cctcgtggct ctccttat 18
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence
<400> 16
gtctccattc atctcggtta 20
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence
<400> 17
ggattgaagt ggttgagttg 20
<210> 18
<211> 22
<212> DNA
<213> Artificial sequence
<400> 18
cggagtgtag atatagaagg ta 22
<210> 19
<211> 19
<212> DNA
<213> Artificial sequence
<400> 19
tgctgattgt cctgaagtc 19
<210> 20
<211> 19
<212> DNA
<213> Artificial sequence
<400> 20
cctgctgtat cctgaagtg 19
<210> 21
<211> 19
<212> DNA
<213> Artificial sequence
<400> 21
ttgaggtgaa ggtggattc 19
<210> 22
<211> 20
<212> DNA
<213> Artificial sequence
<400> 22
tggttgaaga agatgaaggt 20
<210> 23
<211> 18
<212> DNA
<213> Artificial sequence
<400> 23
attctggctt gcttgtga 18
<210> 24
<211> 20
<212> DNA
<213> Artificial sequence
<400> 24
tggtgctgta agtgattaac 20
<210> 25
<211> 20
<212> DNA
<213> Artificial sequence
<400> 25
cctgagaatg agaactgcta 20
<210> 26
<211> 22
<212> DNA
<213> Artificial sequence
<400> 26
cctattacca tccttcctac at 22
<210> 27
<211> 18
<212> DNA
<213> Artificial sequence
<400> 27
gagatgtgtc cagccttc 18
<210> 28
<211> 19
<212> DNA
<213> Artificial sequence
<400> 28
ccattcattg ctcaccttc 19
<210> 29
<211> 19
<212> DNA
<213> Artificial sequence
<400> 29
tgtgttgagt gtgatagca 19
<210> 30
<211> 20
<212> DNA
<213> Artificial sequence
<400> 30
ggcaagttag tgtgaatgtt 20
<210> 31
<211> 19
<212> DNA
<213> Artificial sequence
<400> 31
tggcacaact tgatgatga 19
<210> 32
<211> 22
<212> DNA
<213> Artificial sequence
<400> 32
cactgttata ccttcttctg tc 22
<210> 33
<211> 18
<212> DNA
<213> Artificial sequence
<400> 33
gatcagttgg ctgttcac 18
<210> 34
<211> 20
<212> DNA
<213> Artificial sequence
<400> 34
cattaccgtg cttgacttat 20
<210> 35
<211> 19
<212> DNA
<213> Artificial sequence
<400> 35
gtgtgcctgt atcctgaat 19
<210> 36
<211> 19
<212> DNA
<213> Artificial sequence
<400> 36
gtatcaccac tcacctctg 19
<210> 37
<211> 19
<212> DNA
<213> Artificial sequence
<400> 37
gactgacact gacactgag 19
<210> 38
<211> 19
<212> DNA
<213> Artificial sequence
<400> 38
ttccaccttg agcacatag 19
<210> 39
<211> 19
<212> DNA
<213> Artificial sequence
<400> 39
ttgcctcgtt actgattga 19
<210> 40
<211> 19
<212> DNA
<213> Artificial sequence
<400> 40
gctgacttgc tgtattctg 19
Claims (9)
1. The specific genetic locus of the Jining whooping chicken is characterized by comprising the following components:
JB _ tag1 is located at chromosome 91173104 of chicken No. 1, gene ARL13B at 11 th intron, and Jining whooping chicken genotype is TT;
JB _ tag2 is located at chromosome 102765389 of chicken No. 3, between gene TDRD15 and gene KLHL29, and the genotype of Jining whooping chicken is TT;
JB _ tag3 is located at chicken No. 4 chromosome 5445667, between gene PCDH19 and gene DIAPH2, and the genotype of Jining chicken is CC;
JB _ tag4 is located at chromosome 46716676 of chicken No. 5, between gene PAPOLB and gene VRK1, and the genotype of Jining whooping chicken is GG;
JB _ tag5 is located at chromosome 12646942 of chicken 9, gene DLG1 intron 2, and Jining whooping chicken genotype is GG;
JB _ tag6 is located at chromosome 4966471 of chicken No. 12, gene VGLL4 intron 2, and the genotype of Jining whooping chicken is TT;
JB _ tag7 is located at chromosome 3243101 of chicken 18, gene TBCD 7 intron, and Jining whooping chicken genotype is TT;
JB _ tag8 is located at chromosome 3670686 of chicken 22, UTR3 region of gene TMEM127, and genotype of Jining whooping chicken is CC;
JB _ tag9 is located at chromosome 6389262 of chicken 27, gene SKAP1 intron 4, and the genotype of Jining whooping chicken is CC;
JB _ tag10 is located at chicken Z chromosome 73463410, between gene CARTPT and gene KCNN2, and the genotype of Jining whooping chicken is GG;
JB _ tag11 is located at chromosome 26300021 of chicken 7, and is located in the downstream region of gene IQCB1, and the genotype of Jining whooping chicken is GG;
JB _ tag12 is located at chromosome 3987620 of chicken 8, gene RGS13 intron 1, and Jining whooping chicken genotype is GG;
JB _ tag13 is located at chromosome 20816210 of chicken 9, between gene PDCD10 and gene ZBX, and the genotype of Jining whooping chicken is AA;
JB _ tag14 is located at chromosome 2100351 of chicken 16, gene MICA intron 1, and Jining whooping chicken genotype- - (- -mutation genotype is insertion T);
JB _ tag15 is located on chicken Z chromosome 81084550, between gene ZNF608 and gene LOC112530693, and the genotype of Jining whooping chicken is AA.
2. Use of the specific genetic locus as defined in claim 1 for identifying a variety of bening whooping chickens.
3. The identification method of the Jining whooping chicken is characterized by comprising the following steps of:
extracting a tissue sample of the chicken to be detected, and detecting whether the chicken to be detected has one or more of the following genotypes by gene amplification:
JB _ tag1 is located at chromosome 91173104 of chicken No. 1, gene ARL13B at 11 th intron, and Jining whooping chicken genotype is TT;
JB _ tag2 is located at chromosome 102765389 of chicken No. 3, between gene TDRD15 and gene KLHL29, and the genotype of Jining whooping chicken is TT;
JB _ tag3 is located at chicken No. 4 chromosome 5445667, between gene PCDH19 and gene DIAPH2, and the genotype of Jining chicken is CC;
JB _ tag4 is located at chromosome 46716676 of chicken No. 5, between gene PAPOLB and gene VRK1, and the genotype of Jining whooping chicken is GG;
JB _ tag5 is located at chromosome 12646942 of chicken 9, gene DLG1 intron 2, and Jining whooping chicken genotype is GG;
JB _ tag6 is located at chromosome 4966471 of chicken No. 12, gene VGLL4 intron 2, and the genotype of Jining whooping chicken is TT;
JB _ tag7 is located at chromosome 3243101 of chicken 18, gene TBCD 7 intron, and Jining whooping chicken genotype is TT;
JB _ tag8 is located at chromosome 3670686 of chicken 22, UTR3 region of gene TMEM127, and genotype of Jining whooping chicken is CC;
JB _ tag9 is located at chromosome 6389262 of chicken 27, gene SKAP1 intron 4, and the genotype of Jining whooping chicken is CC;
JB _ tag10 is located at chicken Z chromosome 73463410, between gene CARTPT and gene KCNN2, and the genotype of Jining whooping chicken is GG;
JB _ tag11 is located at chromosome 26300021 of chicken 7, and is located in the downstream region of gene IQCB1, and the genotype of Jining whooping chicken is GG;
JB _ tag12 is located at chromosome 3987620 of chicken 8, gene RGS13 intron 1, and Jining whooping chicken genotype is GG;
JB _ tag13 is located at chromosome 20816210 of chicken 9, between gene PDCD10 and gene ZBX, and the genotype of Jining whooping chicken is AA;
JB _ tag14 is located at chromosome 2100351 of chicken 16, gene MICA intron 1, and Jining whooping chicken genotype- - (- -mutation genotype is insertion T);
JB _ tag15 is located on chicken Z chromosome 81084550, between gene ZNF608 and gene LOC112530693, and the genotype of Jining whooping chicken is AA.
4. A chip for identifying a variety of Jining whooping chicken, which is characterized by detecting one or more specific genetic loci of:
JB _ tag1 is located at chromosome 91173104 of chicken No. 1, gene ARL13B at 11 th intron, and Jining whooping chicken genotype is TT;
JB _ tag2 is located at chromosome 102765389 of chicken No. 3, between gene TDRD15 and gene KLHL29, and the genotype of Jining whooping chicken is TT;
JB _ tag3 is located at chicken No. 4 chromosome 5445667, between gene PCDH19 and gene DIAPH2, and the genotype of Jining chicken is CC;
JB _ tag4 is located at chromosome 46716676 of chicken No. 5, between gene PAPOLB and gene VRK1, and the genotype of Jining whooping chicken is GG;
JB _ tag5 is located at chromosome 12646942 of chicken 9, gene DLG1 intron 2, and Jining whooping chicken genotype is GG;
JB _ tag6 is located at chromosome 4966471 of chicken No. 12, gene VGLL4 intron 2, and the genotype of Jining whooping chicken is TT;
JB _ tag7 is located at chromosome 3243101 of chicken 18, gene TBCD 7 intron, and Jining whooping chicken genotype is TT;
JB _ tag8 is located at chromosome 3670686 of chicken 22, UTR3 region of gene TMEM127, and genotype of Jining whooping chicken is CC;
JB _ tag9 is located at chromosome 6389262 of chicken 27, gene SKAP1 intron 4, and the genotype of Jining whooping chicken is CC;
JB _ tag10 is located at chicken Z chromosome 73463410, between gene CARTPT and gene KCNN2, and the genotype of Jining whooping chicken is GG;
JB _ tag11 is located at chromosome 26300021 of chicken 7, and is located in the downstream region of gene IQCB1, and the genotype of Jining whooping chicken is GG;
JB _ tag12 is located at chromosome 3987620 of chicken 8, gene RGS13 intron 1, and Jining whooping chicken genotype is GG;
JB _ tag13 is located at chromosome 20816210 of chicken 9, between gene PDCD10 and gene ZBX, and the genotype of Jining whooping chicken is AA;
JB _ tag14 is located at chromosome 2100351 of chicken 16, gene MICA intron 1, and Jining whooping chicken genotype- - (- -mutation genotype is insertion T);
JB _ tag15 is located on chicken Z chromosome 81084550, between gene ZNF608 and gene LOC112530693, and the genotype of Jining whooping chicken is AA.
5. Use of the chip of claim 4 in identification of varieties of bening whooping chickens.
6. The primer combination for detecting the genetic locus specific for the Jining whooping chicken of claim 1, wherein the primer combination comprises: the primers used for detecting the marker JB _ tag1 are two single-stranded DNAs represented by JB _ P1f and JB _ P1 r:
JB_P1f：GCATTCTCCATTGTTCATTC；
JB_P1r：AGTCTGCTTATCTTCCTCTC；
the primers used for detecting the marker JB _ tag2 are two single-stranded DNAs represented by JB _ P2f and JB _ P2 r:
JB_P2f：CCATCATCCTCGCTACATT；
JB_P2r：CAAGTGCTACTGCCTCTC；
the primers used for detecting the marker JB _ tag3 are two single-stranded DNAs represented by JB _ P3f and JB _ P3 r:
JB_P3f：ACTACACAGATTACACAGAGG；
JB_P3r：AGAGAACGGTCACAATGC；
the primers used for detecting the marker JB _ tag4 are two single-stranded DNAs represented by JB _ P4f and JB _ P4 r:
JB_P4f：GGAAGCATTCATTGTCTCAG；
JB_P4r：AACTTGTGGATTCATTGGTG；
the primers used for detecting the marker JB _ tag5 are two single-stranded DNAs represented by JB _ P5f and JB _ P5 r:
JB_P5f：CCTCATCCTCCACCAGTA；
JB_P5r：GCAACTTCCATACGCATT；
the primers used for detecting the marker JB _ tag6 are two single-stranded DNAs represented by JB _ P6f and JB _ P6 r:
JB_P6f：AGGAGGAGAAGTATGGAAGT；
JB_P6r：CTGAGTATGCTAATGGTGTTC；
the primers used for detecting the marker JB _ tag7 are two single-stranded DNAs represented by JB _ P7f and JB _ P7 r:
JB_P7f：TATGCTGATGCTGCTGAG；
JB_P7r：CAGATGTGCCAAGATGCT；
the primers used for detecting the marker JB _ tag8 are two single-stranded DNAs represented by JB _ P8f and JB _ P8 r:
JB_P8f：CCTCGTGGCTCTCCTTAT；
JB_P8r：GTCTCCATTCATCTCGGTTA；
the primers used for detecting the marker JB _ tag9 are two single-stranded DNAs represented by JB _ P9f and JB _ P9 r:
JB_P9f：GGATTGAAGTGGTTGAGTTG；
JB_P9r：CGGAGTGTAGATATAGAAGGTA；
the primers used for detecting the marker JB _ tag10 are two single-stranded DNAs represented by JB _ P10f and JB _ P10 r:
JB_P10f：TGCTGATTGTCCTGAAGTC；
JB_P10r：CCTGCTGTATCCTGAAGTG；
the primers used for detecting the marker JB _ tag11 are two single-stranded DNAs represented by JB _ P11f and JB _ P11 r:
JB_P11f：TTGAGGTGAAGGTGGATTC；
JB_P11r：TGGTTGAAGAAGATGAAGGT；
the primers used for detecting the marker JB _ tag12 are two single-stranded DNAs represented by JB _ P12f and JB _ P12 r:
JB_P12f：ATTCTGGCTTGCTTGTGA；
JB_P12r：TGGTGCTGTAAGTGATTAAC；
the primers used for detecting the marker JB _ tag13 are two single-stranded DNAs represented by JB _ P13f and JB _ P13 r:
JB_P13f：CCTGAGAATGAGAACTGCTA；
JB_P13r：CCTATTACCATCCTTCCTACAT；
the primers used for detecting the marker JB _ tag14 are two single-stranded DNAs represented by JB _ P14f and JB _ P14 r:
JB_P14f：GAGATGTGTCCAGCCTTC；
JB_P14r：CCATTCATTGCTCACCTTC；
the primers used for detecting the marker JB _ tag15 are two single-stranded DNAs represented by JB _ P15f and JB _ P15 r:
JB_P15f：TGTGTTGAGTGTGATAGCA；
JB_P15r：GGCAAGTTAGTGTGAATGTT。
7. use of the primer combination of claim 6 for identifying a variety of bening whooping chickens.
8. A kit for identifying a variety of chinning whooping chickens, comprising one or more of the primer combinations of claim 5.
9. The kit of claim 8, wherein the kit further comprises at least one of nucleic acid extraction reagents, PCR reaction buffers, DNA polymerases, and dNTPs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011417224.4A CN113151485A (en) | 2020-12-04 | 2020-12-04 | Chip, primer combination, kit and identification method for identifying Jining whooping chicken |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011417224.4A CN113151485A (en) | 2020-12-04 | 2020-12-04 | Chip, primer combination, kit and identification method for identifying Jining whooping chicken |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113151485A true CN113151485A (en) | 2021-07-23 |
Family
ID=76882482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011417224.4A Pending CN113151485A (en) | 2020-12-04 | 2020-12-04 | Chip, primer combination, kit and identification method for identifying Jining whooping chicken |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113151485A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103627791A (en) * | 2013-09-12 | 2014-03-12 | 山东农业大学 | Molecular marking method of two mutation sites in chicken CCT6A gene 5' control region and application thereof in chicken breeding |
| CN111225986A (en) * | 2017-10-10 | 2020-06-02 | 中国农业科学院北京畜牧兽医研究所 | Chicken whole genome SNP chip and application thereof |
| WO2020122507A1 (en) * | 2018-12-12 | 2020-06-18 | 충남대학교산학협력단 | Snp marker set for determining genetic background or variety of native chickens and use thereof |
-
2020
- 2020-12-04 CN CN202011417224.4A patent/CN113151485A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103627791A (en) * | 2013-09-12 | 2014-03-12 | 山东农业大学 | Molecular marking method of two mutation sites in chicken CCT6A gene 5' control region and application thereof in chicken breeding |
| CN111225986A (en) * | 2017-10-10 | 2020-06-02 | 中国农业科学院北京畜牧兽医研究所 | Chicken whole genome SNP chip and application thereof |
| WO2020122507A1 (en) * | 2018-12-12 | 2020-06-18 | 충남대학교산학협력단 | Snp marker set for determining genetic background or variety of native chickens and use thereof |
Non-Patent Citations (2)
| Title |
|---|
| ZHENGXIAO ZHAI等: "SNP discovery and genotyping using restriction-site-associated DNA sequencing in chickens", ANIM. GENET., vol. 46, no. 2, pages 216 - 219 * |
| 田艳苓等: "济宁百日鸡群体遗传多样性的微卫星标记分析", 经济动物学报, vol. 14, no. 1, pages 41 - 45 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107619870B (en) | Molecular marker capable of indicating and identifying length of sheep wool and specific primer pair and application thereof | |
| CN108424958A (en) | A kind of relevant SNP marker of Larimichthys crocea genetic sex and its primer and application | |
| CN106906303A (en) | One SNP marker for influenceing quality character of pork and its application | |
| KR102010279B1 (en) | Molecular marker for discriminating Codonopsis lanceolata among genus Codonopsis and uses thereof | |
| CN110541041A (en) | SNP marker related to Chinese domestic horse dwarf trait and application thereof | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN111334588B (en) | Molecular marker related to black and brown feather characters of duck and application thereof | |
| Karamura et al. | Genotyping the local banana landrace groups of East Africa | |
| CN113151485A (en) | Chip, primer combination, kit and identification method for identifying Jining whooping chicken | |
| CN106434971B (en) | PCR primer, method and kit for analyzing genetic diversity of gramineous plants | |
| CN115807122A (en) | SNP molecular marker for pineapple seed resource identification and application thereof | |
| CN113151486A (en) | Method for identifying Longsheng chicken based on specific genetic locus | |
| CN114717330A (en) | SNP molecular marker related to number of lambs born in single sheep fetus, primer group, kit, detection method and application | |
| CN112481389A (en) | Molecular marker primer combination for identifying shou Guang chicken species and identification method | |
| CN109609681B (en) | Identification method of loblolly pine individual based on chloroplast genome sequence | |
| CN111471774B (en) | Co-dominant long INDEL molecular marker for sex discrimination of cynoglossus semilaevis and method | |
| CN108913784B (en) | Detection method of EC12 SNP marker of exopalaemon carinicauda | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| CN112430675A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN111778345A (en) | Simple and efficient potato multi-R gene polymerization assisted breeding method | |
| CN112522420A (en) | Specific genetic site, primer combination and method for Liyang chicken species identification | |
| CN112430670A (en) | Primer combination, kit and method for identifying Wenshang Luhua chicken | |
| CN112680528A (en) | Method for identifying white-ear yellow chickens by using specific SNPs and/or INDELs loci | |
| CN104293904A (en) | Detection kit and detection method for chicken miRNA-1606 gene polymorphism | |
| CN115323060B (en) | Fish nuclear gene molecular marker primer, molecular marker and molecular marker database |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210805 Address after: 225125 No. 58, Cang Jie Road, Hanjiang District, Yangzhou, Jiangsu Applicant after: JIANGSU INSTITUTE OF POULTRY SCIENCES Address before: 225125 No. 58, Cang Jie Road, Hanjiang District, Yangzhou, Jiangsu Applicant before: JIANGSU INSTITUTE OF POULTRY SCIENCES Applicant before: Xueyi Technology (Chengdu) Co.,Ltd. |
|
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |