CN113151477B - miRNA marker for detecting intestinal cancer and application thereof - Google Patents
miRNA marker for detecting intestinal cancer and application thereof Download PDFInfo
- Publication number
- CN113151477B CN113151477B CN202110500044.0A CN202110500044A CN113151477B CN 113151477 B CN113151477 B CN 113151477B CN 202110500044 A CN202110500044 A CN 202110500044A CN 113151477 B CN113151477 B CN 113151477B
- Authority
- CN
- China
- Prior art keywords
- mir
- colorectal cancer
- mirna
- primer
- reverse transcription
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses a miRNA marker for detecting intestinal cancer and application thereof, belonging to the field of tumor molecular diagnosis. The miRNA markers comprise miR-10a-3p, miR-374a-5p, and can further comprise miR-126-3p and/or miR-379a-5p, and the miRNA markers can be used for preparing colorectal cancer diagnostic reagents or colorectal cancer diagnostic kits. The colorectal cancer diagnosis reagent is a reagent for detecting the expression level of the miRNA markers, and selects a primer, a probe, a sequencing library, a chip or a combination thereof. The colorectal cancer detection sensitivity of the invention is up to 98.5%, and the specificity is 96%. The invention provides a new scheme and strategy for noninvasive diagnosis of colorectal cancer.
Description
Technical Field
The invention belongs to the field of tumor molecular diagnosis, and particularly relates to a miRNA marker for detecting intestinal cancer and application thereof.
Background
Colorectal cancer is one of the most common malignancies in china and even worldwide. In china, its incidence is third place in malignant tumors. More than 40 ten thousand cases are diagnosed every year, and more than 20 ten thousand patients die every year. The prognosis of colorectal cancer is related to the severity of disease diagnosis, most early colorectal cancers can be cured, the 5-year survival rate of early colorectal cancer is close to 100%, and the 5-year survival rate of stage IV is less than 10%, so that early diagnosis is the most effective means for reducing morbidity and mortality.
At present, the gold standard for colorectal cancer detection and diagnosis confirmation is enteroscopy detection, but the detection compliance is poor due to factors such as complex preparation process and invasiveness, and in order to effectively improve the early diagnosis proportion of high-risk people in China, a detection method with high sensitivity and characteristics and no wound is urgently needed to improve the compliance of early detection.
Micro RNA (miRNA) is a small RNA belonging to the non-coding RNA, having a length of 18-22 bases, and mediates post-transcriptional gene silencing by binding to the 3' -UTR region of mRNA. Studies have shown that about 60% of protein-encoding genes are regulated by mirnas, and thus mirnas are involved in many biological functions such as cell development, differentiation, apoptosis, etc. The miRNA plays an important role in regulation and control in the process of generating the tumor, the abnormity of the miRNA expression level is closely related to the size of the tumor, the tumor migration capability and the malignancy degree of the tumor, some miRNAs can promote the generation of the cancer and some miRNAs can inhibit the generation of the cancer according to the difference of the regulation and control targets.
The existing research identifies some miRNAs related to the occurrence and development of colorectal cancer, such as miRNA-21 can target and regulate PDCD4 gene and promote the invasion and transfer of intestinal cancer cells; miRNA-148b can target and regulate CCK2R gene and promote proliferation of intestinal cancer cells. These studies suggest that mirnas can be used as markers for colorectal cancer detection. Therefore, identification of mirnas or combinations with high sensitivity and specificity for colorectal cancer would undoubtedly provide new ideas and tools for noninvasive early diagnosis and screening of colorectal cancer.
Disclosure of Invention
The invention aims to solve the problem of colorectal cancer detection by enteroscopy, and provides a miRNA marker for detecting colorectal cancer and application thereof, so as to realize early noninvasive diagnosis of colorectal cancer. The present inventors screened miRNA markers having high diagnostic value for colorectal cancer from thousands of mirnas by meta analysis and extensive studies.
The purpose of the invention is realized by the following technical scheme:
a miRNA marker for detecting colorectal cancer comprises miR-10a-3p and miR-374a-5 p.
In another preferred example, the miRNA marker for detecting the colorectal cancer comprises miR-10a-3p, miR-374a-5p and miR-126-3 p.
In another preferred example, the miRNA marker for detecting the colorectal cancer comprises miR-10a-3p, miR-374a-5p and miR-379a-5 p.
In another preferred example, the miRNA marker for detecting the colorectal cancer comprises miR-10a-3p, miR-374a-5p, miR-126-3p and miR-379a-5 p.
The sequence of the above-mentioned mirnas and their accession numbers in miRbase are as follows:
miR-10a-3 p: CAAAUUCGUAUCUAGGGGAAUA, miRBase Access Number is MIMAT 0004555.
miR-374a-5 p: UUAUAAUACAACCUGAUAAGUG, miRBase Access Number is MIMAT 0000727.
miR-126-3 p: UCGUACCGUGAGUAAUAAUGCG, miRBase Access Number is MIMAT 0000445.
miR-379a-5 p: UGGUAGACUAUGGAACGUAGG, miRBase Access Number is MIMAT 0000733.
The miRNA marker is applied to the preparation of a colorectal cancer diagnostic reagent or a colorectal cancer diagnostic kit.
A colorectal cancer diagnostic reagent, which is a reagent for detecting the expression level of the miRNA marker. The reagent is selected from a primer, a probe, a sequencing library, a chip or a combination thereof.
In some preferred embodiments, the reagents include primers and probes.
In another preferred embodiment, the reagent comprises a reverse transcription primer for detecting miRNA, an upstream primer for amplifying DNA formed by reverse transcription of miRNA (PCR upstream primer), and a reverse transcription primer for amplifying miRNAA universal downstream primer for forming DNA (universal PCR downstream primer) and a probe (PCR probe) for detecting the DNA formed by reverse transcription of miRNA. The reverse transcription primer is a hairpin-shaped stem-loop structure, the 3' end of the stem-loop structure is a Flap sequence, the Flap sequence refers to a single-stranded sequence of a stem, and the Flap sequence can be complementarily combined with miRNA. Under the action of reverse transcriptase, the reverse transcription primer can reverse transcribe miRNA about 20bp into a long DNA sequence, and the reverse transcription primer contains a binding site of a universal PCR downstream primer and is used for subsequent fluorescent quantitative PCR reaction to realize the quantification of miRNA. Furthermore, the reagent also comprises a primer (reverse transcription primer, upstream primer and downstream primer) and a probe for detecting the internal reference, U6 is a small nuclear RNA, and the research shows that the expression level of the small nuclear RNA in plasma is relatively constant, so that U6 is used as the internal reference gene and 2 is used as the internal reference geneΔctThe method carries out normalization processing on the expression quantity of miRNA.
In another preferred embodiment, the sequences of the primers and probes for detecting the mirnas are as follows:
reverse transcription primer of miR-10a-3 p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTATTCC, respectively;
upstream primer of miR-10a-3 p: CGTATCTAGGGGAATAGTCG, respectively;
reverse transcription primer of miR-374a-5 p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACTTA, respectively;
an upstream primer of miR-374a-5 p: ATACAACCTGATAAGTGGTCGTATC, respectively;
reverse transcription primer of miR-126-3 p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATT, respectively;
an upstream primer of miR-126-3 p: CGTGAGTAATAATGCGGTCG, respectively;
reverse transcription primer of miR-379a-5 p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTACG, respectively;
upstream primer of miR-379a-5 p: ACTATGGAACGTAGGGGTCG, respectively;
a universal downstream primer: GTCGTATCCAGTGCAGGG, respectively;
and (3) probe: TCCGAGGTATTCGCACT are provided.
A colorectal cancer diagnostic kit comprises the colorectal cancer diagnostic reagent.
The detection sample of the colorectal cancer diagnostic reagent or the colorectal cancer diagnostic kit comprises feces, tissues, serum, plasma and the like.
The invention has the following advantages and beneficial effects: the invention screens 9 miRNAs with potential high diagnostic efficiency on colorectal cancer from thousands of miRNAs, verifies the combination of different miRNAs, and finds that the detection effect of the combination of miR-10a-3p, miR-374a-5p and miR-126-3p and the detection effect of the combination of miR-10a-3p, miR-374a-5p and miR-379a-5p are obviously superior to other combinations when 3 miRNAs are jointly detected, and the detection sensitivity and specificity of the two combinations on the colorectal cancer are both more than 95% in a plasma sample. Further, when 4 miRNAs are jointly detected, the detection effect of the combination of the four miRNAs miR-10a-3p, miR-374a-5p, miR-126-3p and miR-379a-5p is further improved, the detection sensitivity of the combination on colorectal cancer is up to 98.5%, and the specificity is 96%. The invention provides a new scheme and strategy for noninvasive diagnosis of colorectal cancer.
Drawings
FIG. 1 is a ROC curve for combinations 1-6 of example 3.
FIG. 2 is a ROC curve for combinations 7-13 of example 4.
FIG. 3 is a ROC curve for combinations 14-18 of example 5.
Detailed Description
The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.
The invention screens out 9 miRNAs with potential high diagnostic efficacy on colorectal cancer from thousands of miRNAs through meta analysis and a large amount of research. The sequences of these 9 mirnas and their accession numbers in miRbase are as follows:
mature miR-10a-3p sequence: CAAAUUCGUAUCUAGGGGAAUA, miRBase Access Number is MIMAT 0004555;
mature miR-23a-3p sequence: AUCACAUUGCCAGGGAUUUCC, miRBase Access Number is MIMAT 0000078;
mature miR-29c-3p sequence: UAGCACCAUUUGAAAUCGGUUA, miRBase Access Number is: MIMAT 0000681;
mature miR-30b-5p sequence: UGUAAACAUCCUACACUCAGCU, miRBase Access Number is: MIMAT 0000420;
mature miR-30e-5p sequence: UGUAAACAUCCUUGACUGGAAG, miRBase Access Number is MIMAT 0000692;
mature miR-126-3p sequence: UCGUACCGUGAGUAAUAAUGCG, miRBase Access Number is MIMAT 0000445;
mature miR-374a-5p sequence: UUAUAAUACAACCUGAUAAGUG, miRBase Access Number is MIMAT 0000727;
mature miR-379a-5p sequence: UGGUAGACUAUGGAACGUAGG, miRBase Access Number is MIMAT 0000733;
mature miR-653-5p sequence: GUGUUGAAACAAUCUCUACUG, miRBase Access Number is MIMAT 0003328.
Example 1
(1) Sample collection
Peripheral venous blood was collected from 115 colorectal cancer patients and 80 healthy people at the southern hospital of Wuhan university, 10mL of blood was collected from each subject, all colorectal cancer patients were confirmed by pathological examination and did not suffer from other tumor diseases and diseases that may affect the experimental results of the study, and the patients were not treated with any radiotherapy, chemotherapy or surgery before sampling.
(2) Plasma separation
10mL of blood was centrifuged at 1300 Xg for 12 minutes to separate plasma, about 4.5mL of plasma could be separated from each sample and stored in a freezer at-80 ℃ until use.
(3) Plasma RNA extraction
The kit is a miRcute serum/plasma miRNA extraction and separation kit (DP503) purchased from Tiangen Biotechnology (Beijing) Co., Ltd, the specific operation is described in the kit specification, and the final elution volume is 30 mu L.
(4) Reverse transcription of RNA
miRNA reverse transcriptase and reagents were purchased from Takara, reverse transcription primers were synthesized by Biotechnology (Shanghai) Inc., and PCR systems are shown in Table 1 below:
TABLE 1
| Reagent | Dosage of |
| 5×primerScript Buffer | 4μL |
| PrimerScript RT Enzyme mix | 1μL |
| Reverse transcription primer (10. mu.M) | 1μL |
| RNA | 5μL |
| RNase-Free water | 9μL |
| Total of | 20μL |
Reverse transcription primers for each miRNA are shown in table 2 below:
TABLE 2
(5) Fluorescent quantitative PCR reaction
The PCR system is shown in Table 3 below:
TABLE 3
| Reagent | Dosage of |
| 10×Buffer | 2.5μL |
| dNTP(2.5mM each) | 2.5μL |
| PCR upstream primer (10mM) | 0.5μL |
| Downstream primer for PCR (10mM) | 0.5μL |
| PCR general probe (10mM) | 0.5μL |
| DNA template | 5μL |
| Taq enzyme (5U/. mu.L) | 0.5μL |
| Purified water | Make up to 25 mu L |
The system is a PCR system for detecting a single miRNA, when two or more miRNAs are simultaneously detected, the volume of purified water can be changed by adding a PCR upstream primer, a PCR universal downstream primer and a PCR universal probe of the corresponding miRNA according to the amount in a table.
The PCR primer and probe sequences for each gene are shown in table 4 below:
TABLE 4
The 5 'end of the universal probe is marked with FAM luminescent group, and the 3' end is marked with MGB fluorescence quenching group.
The 5 'end of the U6 probe is marked with ROX luminescent group, and the 3' end is marked with MGB fluorescence quenching group.
The PCR instrument used was ABI7500, and the PCR reaction conditions are shown in Table 5 below:
TABLE 5
Ct value reading: after the PCR is finished, adjusting a base line, setting a fluorescence value of the sample in the primary PCR before the minimum Ct value is advanced by 1-2 cycles as a base line value, and setting a threshold value in an exponential growth period of an amplification curve to obtain the Ct value of each gene of the sample.
Quality control: the NTC control (negative control) and the positive control are synchronously detected during each detection, the negative control is purified water, the positive control is artificially synthesized plasmid containing target gene, and the artificially synthesized plasmid is purchased from Wuhan-jin Kerui bioengineering Co., Ltd and has a concentration of 103Copy/microliter. Negative control should have no amplification, positive control should have significant exponential growth, and positive control should have a Ct value between 26-30. After the negative control, the positive control and the reference gene all meet the requirements, the experiment is effective, and the next step of sample result judgment can be carried out.Otherwise, when the experiment is invalid, the detection is required to be carried out again.
And (3) data analysis: after PCR is finished, reading the miRNA detection Ct value of each sample, calculating the delta Ct of the miRNA and U6, carrying out ROC analysis by using SPSS software to evaluate the diagnosis efficiency of each miRNA and the combination thereof on colorectal cancer samples and normal samples, wherein during analysis, the state variable of the normal samples is recorded as '0', the state variable of the cancer samples is recorded as '1', and 2 of the maximum Youden index is takenΔctValues are cut-off values, where Δ Ct is the Ct value for the gene of interest-the Ct value for the reference gene U6, and the corresponding sensitivity, specificity and AUC values are recorded.
Experimental example 2
The method of example 1 is adopted to detect the expression level of each miRNA in 80 samples of plasma samples of 30 healthy persons and plasma samples of 50 patients with colorectal adenomas, wherein each miRNA is detected independently, namely, a primer and a probe of only one miRNA are added into a PCR system. The amplification results were analyzed by SPSS software to obtain the sensitivity, specificity, and mean AUC values for each miRNA for differentiating cancer samples from normal samples, and the specific results are shown in table 6 below.
TABLE 6
| Specific markers | Sensitivity of the reaction | Specificity of | Mean AUC |
| miR-10a-3p | 74.0％ | 96.7％ | 0.849 |
| miR-23a-3p | 58.0％ | 90.0％ | 0.740 |
| miR-29c-3p | 54.0％ | 93.3％ | 0.741 |
| miR-30b-5p | 58.0％ | 93.3％ | 0.734 |
| miR-30e-5p | 76.0％ | 80.0％ | 0.793 |
| miR-126-3p | 60.0％ | 96.7％ | 0.788 |
| miR-374a-5p | 78.0％ | 96.7％ | 0.875 |
| miR-379a-5p | 68.0％ | 96.7％ | 0.821 |
| miR-653-5p | 62.0％ | 93.3％ | 0.768 |
As can be seen from the results, the detection sensitivity of 3 of the 9 miRNAs on cancer samples is more than 70%, and the miRs are miR-10a-3p, miR-30e-5p and miR-374a-5p, wherein the detection specificity of the miR-30e-5p is poor, so that the AUC value of the miR-10a-3p and the AUC value of the miR-374a-5p are both more than 0.8. Of the remaining 6 miRNAs, the AUC value of miR-379a-5p was above 0.8, but its detection sensitivity to cancer samples was low, less than 70%.
Experimental example 3
The method of example 1 is adopted to detect the expression level of each miRNA in 80 samples of plasma samples of 30 healthy human and plasma samples of 50 patients with colorectal adenomas (the samples are the same as in experimental example 2), which means that the two miRNAs are detected in a combined manner, namely, primers and probes of the two miRNAs are added into a PCR system at the same time. The amplification results were analyzed by SPSS software to obtain the sensitivity, specificity, and mean AUC values for each miRNA for differentiating cancer samples from normal samples, and the specific results are shown in table 7 below and fig. 1.
TABLE 7
In a comprehensive way, the miR-10a-3p and miR-374a-5p have the highest diagnostic efficacy on cancer samples, and the two miRNAs are selected for further verification.
Experimental example 4
Another 50 healthy human plasma samples and 65 plasma samples of patients with colorectal adenoma are selected, and the method of example 1 is adopted to detect the expression level of each miRNA combination in the 115 samples, which means that three miRNA combinations are detected, namely, primers and probes of the three miRNAs are simultaneously added into a PCR system. The amplification results were analyzed by SPSS software to obtain the sensitivity, specificity, and mean AUC values for each miRNA combination to distinguish cancer samples from normal samples, and the specific results are shown in table 8 below and fig. 2.
TABLE 8
| Combination numbering | Specific markers | Sensitivity of the reaction | Specificity of | Mean AUC |
| Combination 7 | miR-10a-3p+miR-374a-5p+miR-23a-3p | 84.6％ | 90.0％ | 0.885 |
| Combination 8 | miR-10a-3p+miR-374a-5p+miR-29c-3p | 83.1％ | 96.0％ | 0.902 |
| Combination 9 | miR-10a-3p+miR-374a-5p+miR-30b-5p | 86.2％ | 96.0％ | 0.924 |
| |
miR-10a-3p+miR-374a-5p+miR-30e-5p | 92.3％ | 78.0％ | 0.861 |
| Combination 11 | miR-10a-3p+miR-374a-5p+miR-126-3p | 95.4％ | 96.0％ | 0.969 |
| Combination 12 | miR-10a-3p+miR-374a-5p+miR-379a-5p | 95.4％ | 98.0％ | 0.970 |
| Combination 13 | miR-10a-3p+miR-374a-5p+miR-653-5p | 86.2％ | 92.0％ | 0.912 |
In 9 miRNAs, a combination of 3 miRNAs is formed by combining one of the other 7 miRNAs based on miR-10a-3p and miR-374a-5p, and the combination has 7 kinds. The results show that the diagnostic efficacy of the two combinations of miR-10a-3p + miR-374a-5p + miR-126-3p and miR-10a-3p + miR-374a-5p + miR-379a-5p is obviously superior to that of other combinations: the detection sensitivity of the kit to cancer is 95.4%. The specificity is 96.0% and 98.0%, respectively, and the AUC value is greater than 0.960. The combination of miR-10a-3p + miR-374a-5p + miR-30e-5p has low specificity which is less than 80%, and the sensitivity of the remaining four combinations is low which is less than 90%.
Experimental example 5
The method of example 1 is adopted to select 50 healthy human plasma samples and 65 plasma samples of patients with colorectal adenoma (the samples are the same as in example 4), and the expression level of each miRNA combination in the 115 samples is detected, which means that the four miRNA combinations are detected, namely, primers and probes of the four miRNAs are simultaneously added into a PCR system. The amplification results were analyzed by SPSS software to obtain the sensitivity, specificity, and mean AUC values for each miRNA combination to distinguish cancer samples from normal samples, and the specific results are shown in table 9 below and fig. 3.
TABLE 9
The combination of 4 miRNAs is formed by taking the combination of three miRNAs of miR-10a-3p + miR-374a-5p + miR-126-3p and miR-10a-3p + miR-374a-5p + miR-379a-5p as a basis and adding another miRNA, and in the experimental example, the detection effects of 5 combinations are detected. The results show that when the four miRNAs, namely the miR-10a-3p, miR-374a-5p, miR-126-3p and miR-379a-5p, are used in combination, the diagnostic efficiency of the combination is obviously superior to that of other combinations, the detection sensitivity of the combination on a cancer sample is up to 98.5%, the specificity of the combination is up to 96.0%, and the average AUC value is 0.992.
Sequence listing
<110> Wuhan university Zhongnan Hospital
Wuhan Emisen Life technologies, Inc
<120> miRNA marker for detecting intestinal cancer and application thereof
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactattcc 50
<210> 2
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacggaaat 50
<210> 3
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactaaccg 50
<210> 4
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacagctga 50
<210> 5
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacagtgcg 50
<210> 6
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgaccgcatt 50
<210> 7
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgaccactta 50
<210> 8
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgaccctacg 50
<210> 9
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgaccagtag 50
<210> 10
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
cgcttcacga atttgcgtgt cat 23
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cgtatctagg ggaatagtcg 20
<210> 12
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
attgccaggg atttccg 17
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
aacatcctac actcagctgg tc 22
<210> 14
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
aaacatccta cactcagctt gtc 23
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cttgactgga agggtcgtat c 21
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cgtgagtaat aatgcggtcg 20
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
atacaacctg ataagtggtc gtatc 25
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
actatggaac gtaggggtcg 20
<210> 19
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
aacaatctct actgggtcgt atc 23
<210> 20
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gtcgtatcca gtgcaggg 18
<210> 21
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
tccgaggtat tcgcact 17
<210> 22
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gcttcggcag cacatatact aaaat 25
<210> 23
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
tatggaacgc ttcacgaatt tg 22
<210> 24
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
tggaacgata cagagaagat tagca 25
Claims (9)
1. A miRNA marker for detecting colorectal cancer, comprising: the miRNA marker consists of miR-10a-3p and miR-374a-5p, or consists of miR-10a-3p, miR-374a-5p and miR-126-3p, or consists of miR-10a-3p, miR-374a-5p and miR-379a-5p, or consists of miR-10a-3p, miR-374a-5p, miR-126-3p and miR-379a-5 p;
the sequence of each miRNA was as follows:
miR-10a-3p：CAAAUUCGUAUCUAGGGGAAUA，
miR-374a-5p：UUAUAAUACAACCUGAUAAGUG，
miR-126-3p：UCGUACCGUGAGUAAUAAUGCG，
miR-379a-5p：UGGUAGACUAUGGAACGUAGG。
2. use of the miRNA marker of claim 1 in the preparation of a colorectal cancer diagnostic reagent or a colorectal cancer diagnostic kit.
3. A diagnostic reagent for colorectal cancer, which is characterized in that: a reagent for detecting the expression level of the miRNA marker of claim 1.
4. The diagnostic reagent for colorectal cancer according to claim 3, characterized in that: the reagent is selected from a primer, a probe, a sequencing library, a chip or a combination thereof.
5. The diagnostic reagent for colorectal cancer according to claim 3, characterized in that: the reagent comprises a primer and a probe.
6. The diagnostic reagent for colorectal cancer according to claim 5, wherein: the reagent comprises a reverse transcription primer for detecting miRNA, an upstream primer for detecting DNA formed by reverse transcription of miRNA, a universal downstream primer for amplifying DNA formed by reverse transcription of miRNA and a probe for amplifying DNA formed by reverse transcription of miRNA; wherein, the reverse transcription primer is a hairpin-shaped stem-loop structure, the 3' end of the stem-loop structure is a section of Flap sequence, and the Flap sequence is complementarily combined with miRNA.
7. The diagnostic reagent for colorectal cancer according to claim 6, wherein: the sequences of the primers and the probes are as follows:
reverse transcription primer of miR-10a-3 p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTATTCC, respectively;
upstream primer of miR-10a-3 p: CGTATCTAGGGGAATAGTCG, respectively;
reverse transcription primer of miR-374a-5 p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACTTA, respectively;
an upstream primer of miR-374a-5 p: ATACAACCTGATAAGTGGTCGTATC, respectively;
reverse transcription primer of miR-126-3 p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATT, respectively;
an upstream primer of miR-126-3 p: CGTGAGTAATAATGCGGTCG, respectively;
reverse transcription primer of miR-379a-5 p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTACG, respectively;
upstream primer of miR-379a-5 p: ACTATGGAACGTAGGGGTCG, respectively;
a universal downstream primer: GTCGTATCCAGTGCAGGG, respectively;
and (3) probe: TCCGAGGTATTCGCACT are provided.
8. A diagnostic kit for colorectal cancer, characterized in that: comprising the colorectal cancer diagnostic reagent of any one of claims 3 to 7.
9. The diagnostic reagent for colorectal cancer according to any one of claims 3 to 7 or the diagnostic kit for colorectal cancer according to claim 8, wherein: test samples include stool, tissue, serum, and plasma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110500044.0A CN113151477B (en) | 2021-05-08 | 2021-05-08 | miRNA marker for detecting intestinal cancer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110500044.0A CN113151477B (en) | 2021-05-08 | 2021-05-08 | miRNA marker for detecting intestinal cancer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113151477A CN113151477A (en) | 2021-07-23 |
| CN113151477B true CN113151477B (en) | 2022-04-15 |
Family
ID=76873904
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110500044.0A Active CN113151477B (en) | 2021-05-08 | 2021-05-08 | miRNA marker for detecting intestinal cancer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113151477B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016144265A1 (en) * | 2015-03-09 | 2016-09-15 | Agency For Science, Technology And Research | Method of determining the risk of developing breast cancer by detecting the expression levels of micrornas (mirnas) |
| WO2020148401A1 (en) * | 2019-01-16 | 2020-07-23 | Ospedale San Raffaele S.R.L. | Biomarkers for renal cell carcinoma |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105658789B (en) * | 2013-08-14 | 2020-07-14 | 兰诺龙有限公司 | Stem cell microparticles and miRNA |
| EP3744859A3 (en) * | 2014-08-07 | 2021-03-17 | Agency For Science, Technology And Research | Microrna biomarker for the diagnosis of gastric cancer |
-
2021
- 2021-05-08 CN CN202110500044.0A patent/CN113151477B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016144265A1 (en) * | 2015-03-09 | 2016-09-15 | Agency For Science, Technology And Research | Method of determining the risk of developing breast cancer by detecting the expression levels of micrornas (mirnas) |
| WO2020148401A1 (en) * | 2019-01-16 | 2020-07-23 | Ospedale San Raffaele S.R.L. | Biomarkers for renal cell carcinoma |
Non-Patent Citations (3)
| Title |
|---|
| microRNA-374a suppresses colon cancer progression by directly reducing CCND1 to inactivate the PI3K/AKT pathway;Yiyu Chen等;《Oncotarget》;20160512;第7卷(第27期);第1-14页 * |
| miR-10a suppresses colorectal cancer metastasis by modulating the epithelial-to-mesenchymal transition and anoikis;Yankun Liu等;《Cell Death and Disease》;20170406;第8卷;e2739 * |
| The latest progress on miR‐374 and its functional implications in physiological and pathological processes;Hongjun Bian等;《J Cell Mol Med》;20191231;第23卷;第3063–3076页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113151477A (en) | 2021-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106148538B (en) | MicroRNA marker group and its preparing the application in evaluating breast cancer chemosensitivity kit | |
| CN108949992B (en) | Biomarker related to esophageal squamous carcinoma and grading thereof | |
| CN107674916B (en) | Application of circular RNA in colorectal cancer biomarker | |
| CN107519193B (en) | Molecular diagnostic marker for early stage esophageal squamous carcinoma and application thereof | |
| CN106011139A (en) | Method for detecting circular RNA for bladder cancer screening and application thereof | |
| CN104975019B (en) | Application of the finger-print of tiny RNA composition in human ovarian cancer diagnosing and treating | |
| CN112980947A (en) | Primer and kit for detecting circulating microRNA (microribonucleic acid) related to lung cancer diagnosis and treatment | |
| CN103074431B (en) | Special primer, kit and method for testing minRNA-128 in colorectal cancer serum | |
| CN107177676B (en) | Use of long-chain non-coding RNA NONHSAT113026 as molecular marker for diagnosing kidney cancer | |
| CN108624693A (en) | Applications of the miR-577 in preparing diagnosis of nephropathy marker | |
| CN110205386B (en) | miRNA molecule miR-33a-5p related to endometrial cancer and application thereof | |
| CN113151477B (en) | miRNA marker for detecting intestinal cancer and application thereof | |
| CN109295225A (en) | The optimization method and testing product of EGFR gene L858R mutation digital pcr detection architecture | |
| Zhao et al. | Serum microRNA-155 as a potential biomarker for breast cancer screening | |
| CN111575374B (en) | Molecular marker for early pancreatic tumor detection, detection method and application thereof | |
| CN109136367A (en) | The method for improving the diagnosis efficiency of BRAF gene V600E mutation | |
| CN109266750B (en) | Biomarker for nasopharyngeal carcinoma diagnosis and application | |
| CN109266751B (en) | Biomarker combination for nasopharyngeal carcinoma diagnosis and application | |
| CN107858424B (en) | Application of miRNA-4731-3p as primary lung cancer diagnosis marker | |
| CN111705133B (en) | Application of LncRNAs in preparation of primary liver cancer early diagnosis kit | |
| CN112646892B (en) | Group of piRNA biomarkers for early diagnosis of breast cancer and application thereof | |
| JP5884219B2 (en) | Method for detecting urothelial cancer based on miRNA expression profiling | |
| CN113930505B (en) | Kit and device for lung cancer diagnosis | |
| CN114632152B (en) | Application of lncRNA TC8260 as lung cancer treatment target | |
| CN107435073A (en) | Mir 3613 and its ripe miRNA new application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |