CN107435073A

CN107435073A - Mir 3613 and its ripe miRNA new application

Info

Publication number: CN107435073A
Application number: CN201710772834.8A
Authority: CN
Inventors: 石小峰; 任静; 宋宏涛
Original assignee: Beijing Medintell Bioinformatic Technology Co Ltd
Current assignee: Qingdao Yangshen Biomedical Co Ltd
Priority date: 2017-08-31
Filing date: 2017-08-31
Publication date: 2017-12-05

Abstract

The present invention relates to mir 3613 and its ripe miRNA new application.Invention carries out transcript profile sequencing to the sample of the esophageal squamous cell carcinoma tissue of transfer, the esophageal squamous cell carcinoma tissue not shifted and cancer beside organism, and analyzed with bioinformatics method, find some molecular markers related to esophageal squamous cell carcinoma, wherein expression quantity of the 5p of miR 3613 in cancerous tissue is higher than cancer beside organism, further, fluorescent quantitative PCR experiment result is consistent with high-flux sequence result.The present invention provides potential molecular marker for the accurate diagnosis of clinical esophageal squamous cell carcinoma, has important actual application value.

Description

Mir-3613 and its ripe miRNA new application

Technical field

The present invention relates to field of gene detection, is specifically related to the related miRNA of esophageal squamous cell carcinoma and its application, more specifically It is related to the application of mir-3613 and its ripe miRNA in oesophagus squama cancer diagnosis preparation is prepared.

Background technology

The cancer of the esophagus is common malignant tumor of digestive tract, and the annual whole world there are about 300,000 people and die from the cancer of the esophagus, its incidence of disease The former positions of malignant tumour are occupied with the death rate.China is one of country of Esophageal Cancer, and especially esophageal squamous cell carcinoma (ESCC) is for I The main histological type of state's cancer of the esophagus.Current esophageal squamous cell carcinoma treatment is based on radical operation joint perioperative chemotherapy or change The pattern of radiotherapy, but its course advancement is fast, poor prognosis, late result is still unsatisfactory, and overall survival is very low within 5 years, pre- aftereffect Fruit is undesirable.Preferable, reliable oesophagus squama cancer diagnosis mark is there is no at present.Therefore, esophageal squamous cell carcinoma can be early diagnosed by finding Molecular marker, or new strategy can be provided for the improvement of oesophagus squama cancer diagnosis and prognosis.

MiRNA is that a kind of endogenous, highly conserved, length are about the non-coding microRNA of 22 nucleotides. MiRNA can be specifically bound by its 5' end with the 3' ends non-translational region (3'UTR) of target gene, is played and is adjusted in post-transcriptional level Control acts on.It can cause the degraded of said target mrna when miRNA and target gene 3'UTR are combined in a manner of base complete complementary matches, and MRNA protein translation can then be suppressed by way of the combination of non-fully complementary pairing.In recent years, miRNA is circulated as all kinds of The research of disease marker receives much concern.Circulation miRNA refers to be present in serum, blood plasma, some body fluid such as saliva, urine and brain In spinal fluid, the general designation for the miRNA being free on outside tissue.MiRNA is circulated as a newer and promising research field, it is near several Year turns into focus on its research as diagnosing tumor mark.

The present invention is to 3 esophageal squamous cell carcinoma tissues shifted, 3 esophageal squamous cell carcinoma tissues not shifted and 6 cancers The sample of side tissue carries out transcript profile sequencing, and is analyzed with bioinformatics method, finds some and esophageal squamous cell carcinoma phase The expression quantity of the molecular marker of pass, wherein miR-3613-5p in cancerous tissue is higher than cancer beside organism, further, fluorescent quantitation PCR experiment result is consistent with high-flux sequence result.The present invention provides potential point for the accurate diagnosis of clinical esophageal squamous cell carcinoma Sub- mark, there is important actual application value.

The content of the invention

It is an object of the invention to provide a kind of esophagus cancer diagnosis reagent, mir- in the diagnostic reagent detection sample The expression of 3613 and/or its ripe miRNA.

The mir-3613 sequences are shown in SEQ ID NO 1：

ugguuggguuuggauuguuguacuuuuuuuuuuguucguugcauuuuuaggaacaaaaaaaaaagcccaacc Cuucacaccacuuca, its ripe miRNA are miR-3613-5p and miR-3613-3p, and sequence is shown in SEQ ID NO 2： Uguuguacuuuuuuuuuuguuc and SEQ ID NO 3：acaaaaaaaaaagcccaacccuuc.

Further, the cancer of the esophagus includes esophageal squamous cell carcinoma and adenocarcinoma of esophagus, preferably esophageal squamous cell carcinoma.

Described sample is tumor tissues or peripheral blood.

Further, oesophagus squama cancer diagnosis reagent is based on high-flux sequence method and/or gene chips and/or quantitative PCR Mir-3613 and/or its ripe miRNA transcription situation in method and/or probing procedure detection sample.

High-flux sequence method is primarily referred to as 454life sciences companies, ABI companies and illumina companies and released Two generation sequencing technologies and helicos heliscope^TMWith pacific biosciences single-molecule sequencing technology.

It is preferred that using two generation sequence measurements, single-molecule sequencing method, northern hybridizing methods, miRNA chip of expression spectrum, Ribozyme protection analytical technology, RAKE methods, in situ hybridization, bead-based flow-cytometry detection sample in mir-3613 and/or Its ripe miRNA transcription.

Preferably, the described quantifying PCR method that is used for includes specific amplification mir-3613's and/or its ripe miRNA Primer；The described spy included based on probing procedure with mir-3613 and/or its ripe miRNA nucleic acid array hybridizing Pin.

Further, tailing method amplification miR-3613-5p primer is sequence SEQ ID NO 4：

tgttgtacttttttttttgttc。

The present invention also aims to provide above-mentioned mir-3613 and/or its ripe miRNA to prepare oesophagus squama cancer diagnosis Application in instrument.

It is an object of the invention to provide one kind to treat esophageal squamous cell carcinoma pharmaceutical composition, it is characterised in that the medicine group Compound includes：

(a) compound or composition, the compound lower mir-3613 and/or its ripe miRNA transcription and/or suppression Mir-3613 processed and/or its ripe miRNA activity；

(b) receptible carrier in pharmacy.

Further, using ASON, miRNA inhibitor, antagomiRs, miRNA sponge, miRNA The method of Erasers, Target Masking and/or Mutiple Targets ASON lowers mir-3613 and/or it is ripe MiRNA transcription and/or the activity for suppressing mir-3613 and/or its ripe miRNA.

Further, pharmaceutical composition suppresses the growth of esophageal squamous cell carcinoma cell.

It is an object of the invention to provide application of the aforementioned pharmaceutical compositions in esophageal squamous cell carcinoma is treated.

Further, miRNA inhibitor sequences are shown in SEQ ID NO 6.

Definition：

Detecting the method for miRNA expression at this stage is mainly included based on high throughput sequencing technologies, genetic chip, base In the miRNA detection methods of nucleotide hybridization and PCR-based.MiRNA detection methods based on probe hybridization technique are a kind of straight Connect detection method, it is not necessary to sample rna is expanded in advance, including northern hybridizing methods, miRNA chip of expression spectrum, ribozyme Protect the technologies such as analytical technology, RAKE methods, in situ hybridization, bead-based flow-cytometry.

(1) Northern hybridizes

Also known as Northern blot is most classical detection eucaryote RNA sizes, estimates the experimental method of its abundance.Base Present principles are as follows：MiRNA samples are fixed on carrier (such as silicon chip, microballoon or film) first, then it is miscellaneous with the probe by mark Hand over, signal detection is carried out after washing unnecessary hybridization probe；Can also the first fixed and target miRNA sequence complementation on carrier DNA probe, then hybridize with the sample miRNA by marking, then carry out signal detection.The method of signal mark includes isotope Mark, fluorescence labeling and nano gold mark etc..

(2) miRNA chip of expression spectrum

Principle is equally using the target molecule on label probe detection solid support.Pass through miRNA in design chips Gene and internalcontrol sequence, can Accurate Analysis go out the expression of corresponding miRNA in sample.Genetic chip has high-throughout excellent Point, whole expression of hundreds of genes can be once detected in same sample.The liquid-phase chip that Luminex companies develop (Liquid chip) is also known as multifunctional suspending dot matrix (Multi analyte suspension array, MASA), be it is new Generation biochip technology.Liquid-phase chip system is made up of many spherulas for main matrix, is fixed with not on every kind of spherula With probe molecule, in order to distinguish different probes, sphere matrix that each is used for label probe is all unique with one Color numbers, these spherulas are suspended in a liquid-phase system, just constitute liquid-phase chip system.The system can be to same Multiple different moleculars in one trace sample carry out quick qualitative and quantitative analysis simultaneously, and this detection technique is referred to as FMAP (Flexible multianalyte profiling) technology.Molecule hybridization is carried out in aaerosol solution, detection speed pole It hurry up.

(3) ribozyme protection analytical technology (RPA)

MiRNA detection can also use ribozyme protection analytical technology, and the probe marked and RNA samples to be measured are mixed Close, hybridize after thermal denaturation, non-hybridized RNA and the single-chain nucleic acid enzymic digestion of unnecessary probe, after heat inactivation nuclease purifying by The RNA molecule of protection, finally by denaturation PAGE electrophoretic separation probes, colour developing.This new method based on solution hybridization is simple Quickly, high sensitivity, but be also only used for analyzing known miRNA.

(4) RAKE methods

RAKE methods (RNA primed array based Klenow emzyme) are on miRNAmicroarray basis On using DNA polymerase i Klenow fragments, make miRNA and the method for fixed DNA probe hybridization.RAKE can be sensitive special MiRNA is detected in strange land, suitable for largely quickly screening all miRNA that oneself knows.It can be examined in specific cell and tumour Survey miRNA express spectra situations.Moreover, RAKE methods can also be from the tissue of the FFPE secured by formalin Isolate miRNA and it is analyzed, be the door that analysis miRNA opens hope from archive sample.

(5) in situ hybridization (in situ hybridization)

Hybridization in situ technique can intuitively understand miRNA expression ways, be a kind of easier of observation miRNA spatial and temporal expressions Method, normal mark mode include digoxin, biotin, fluorescence labeling etc..In situ hybridization (Locked on the basis of locked nucleic acid Nucleic Acid (LNA) based in situ hybridization (LNA-ISH)) it is the more probe side of current application Formula.

(6) bead-based flow-cytometry (bead-based flow cytometry)

It is a kind of liquid-phase chip technology, FCM analysis is organically combined, had concurrently by this method with chip technology The features such as flux is big, detection speed is fast, high sensitivity and specificity are good.

(7) Real-Time Fluorescent Quantitative PCR Technique (Real-time PCR, RT-PCR)

Fluoroscopic examination PCR instrument can draw dynamic changing curve to the cumulative speed of extension increasing sequence during whole PCR.Anti- Answer the initial concentration of target sequence in mixed system bigger, it is desirable to which the PCR cycle number for obtaining amplified production specific output is (general Expressed with specific threshold period Ct) it is fewer.Because miRNA length is only 22nt, traditional qRT-PCR is not suitable for amplification such as This short fragment.There are several real time quantitative PCR methods for miRNA, such as tailing method, neck ring method now.Neck ring method is one The preferable miRNA detections qRT-PCR methods of kind：Special loop-stem structure primer is designed first, it is inverse as template using miRNA to be measured The transcription synthesis chains of cDNA first, the cDNA one end is stem Loop primer, and stem loop structure, which is opened, substantially increases cDNA length Degree, then carry out real-time quantitative PCR amplification by template design primer of the cDNA of synthesis.QRT-PCR has specificity high, sensitive A variety of advantages such as spend, be quick and easy.

(8) PCR sequencing PCR

MiRNA known to major part is to be sequenced to find and identify by cDNA clone.The method needs first to build miRNA CDNA library, then enter performing PCR amplification, amplified production is then cloned on expression vector and is sequenced.Takada develops one kind and changed The amplification PCR cloning PCR (miRNA amplification profiling, mRAP) entered, mRAP methods first connect at miRNA 3 ' ends Joint, then with the reverse transcription primer reverse transcription complementary with joint.Because specific reverse transcriptase has end deoxynucleotide Enzymatic activity, some nucleotides (mainly deoxycytidylic acid) can be connected to 3 ' ends of the cDNA chains that reverse transcription goes out.When 5 ' terminations Head is with after poly (C) cohesive end annealing of cDNA chains, adding a pair of general primers and can be achieved to expand cDNA PCR.By , can be directly with the expression quantity of miRNA in clone and a small amount of tissue of sequencing technologies detection in mRAP High sensitivities.Sequence label gram Grand method is that one kind is developing the higher miRAGE of detection efficiency on the basis of serial analysis of gene expression (SAGE) technology (miRNA SAGE) PCR cloning PCR, the method can detect multiple miRNA by generating big sub-series, by single sequencing reaction, bright It is aobvious to improve detection efficiency.

High-flux sequence (High-throughput sequencing) is also known as sequencing technologies (next of future generation Generation sequencing) it is the change for tradition being sequenced revolution, once to hundreds of thousands to millions of DNA Molecule carries out sequencing, greatly improves sequencing efficiency.This kind of large scale sequencing technology greatly improves multiple species and lost The solution reading rate of information is passed, to obtain all miRNA sequence information, decryption miRNA collection of illustrative plates provides guarantee.High pass simultaneously The analysis that sequence to carry out the transcript profile and genome of species in careful overall picture is measured, so the depth that is otherwise known as Degree sequencing (deep sequencing).

MicroRNA gain-of-functions technology based on RNA be by exogenous supplement miRNAs synthesize precursor substance come Raise miRNAs level.For example, can be with the artificial synthesized bob folder sample RNA (short consistent with endogenous miRNA sequence Hairpin RNA, shRNA), promoter is done by polymerase II or III, with virus for carrier transfectional cell, by Dicer enzyme modifications It is loaded into RISC afterwards to play a role, equivalent to rise pre-miRNA level, action effect is stable and lasting.

This technique avoids the nonspecific action of miRNA and gene for gene specific miR Mimics technologies.This people The specific oligonucleotide chain with the complementary combinations of the UTR of target gene 3 ' of work synthesis, can be played after being transcribed with miRNA identicals Adjustment effect.

The carrier permitted in the pharmacy of the pharmaceutical composition of the present invention is the load generally utilized in preparation Body, the carrier include lactose (lactose), dextrose (dextrose), sucrose (sucrose), sorbierite (sorbitol), sweet Reveal alcohol (mannitol), starch, acacia gum, calcium phosphate, alginates (alginate), gel (gelatin), calcium silicates, Microcrystalline cellulose, polyvinylpyrrolidone (polyvinylpyrrolidone), cellulose (cellulose), water, syrup, first Base cellulose (methyl cellulose), methyl hydroxybenzoate (methyl hydroxybenzoate), propyl hydroxy benzene Propyl formate (propyl hydroxybenzoate), talcum, magnesium stearate (stearic acid magnesium) and mineral Oily (mineral oil) etc., but it is not limited to this.

The pharmaceutical composition of the present invention can easily be implemented according to general technical staff of the technical field of the invention Method, carried out using receptible carrier in pharmacy and/or excipient it is formulation, so as in the form of unit dose Prepare or interior prepare in the multicapacity container.Now, formulation be the solution of oiliness or aqueous medium, suspension or Emulsion form, it can also be either extract, powder agent, granule, tablet or capsule form, can also include scattered Agent or stabilizer.

Figure of description

Fig. 1 is miR-3613-5p relative expression's situation map

Fig. 2 is the ROC curve figure of miR-3613-5p diagnosis esophageal squamous cell carcinomas

Fig. 3 is the influence figure of CCK8 methods detection miR-3613-5p cell growths

Embodiment

With reference to specific embodiment, the present invention is expanded on further, is only used for explaining the present invention, and it is not intended that to this The limitation of invention.It will be understood by those skilled in the art that：Can in the case where not departing from the principle and objective of the present invention So that these embodiments are carried out with a variety of change, modification, replacement and modification, the scope of the present invention is limited by claim and its equivalent It is fixed.The experimental method of unreceipted actual conditions in the following example, generally according to normal condition or according to the bar proposed by manufacturer Part examinations.

The collection of the sample of embodiment 1

3 esophageal squamous cell carcinoma tissues shifted, 3 esophageal squamous cell carcinoma tissues not shifted and 6 cancer beside organisms Sample of the sample standard deviation from hospital's surgery excision in January, -2017 in June, 2015, all samples were put within vitro 10 minutes Enter in liquid nitrogen container, be subsequently transferred to store in -80 DEG C of refrigerators.

The Total RNAs extraction of embodiment 2

1 extracting method

1) 80mg tissue blocks are taken, add 800 μ l Lysis/Binding buffer solutions, tissue block are carried out using homogenizer even Slurry.Sample will be placed in and keep low-temperature condition on ice during homogenate.

2) 1/10 volume Homogenate Additive are added into the above-mentioned tissue sample being homogenized, are put on ice Put 10min.

3) water-saturated phenol with Lysis/Binding buffer solution equivalent volumes is added, shakes 45s, 10,000 × g room temperatures Centrifuge 5min.

4) supernatant is carefully taken out into new test tube, is added the absolute ethyl alcohol of 1.25 times of volumes, after mixing, is moved into purification column In, 10,000 × g, 15s is centrifuged, outwells the liquid in collecting pipe.Because the maximum volume of pillar only has 700 μ l, therefore again This multiple step operation, until all supernatants all filter completion.

5) 700 μ l miRNA eluents 1 are added into centrifugation pillar, room temperature, 10,000 × g, 15s is centrifuged, outwells collection Liquid, use new collecting pipe instead.

6) again with 500 μ l eluents 2/3 add centrifugal column in, 10,000 × g, centrifuge 10s, repeat the step for once.

7) 1min, 10,000 × g are centrifuged, discards unnecessary liquid.

8) aforesaid liquid is transferred to new centrifuge tube, adds the DEPC processing 30s of 95 DEG C of 100 μ l preheating, 10,000 × G, centrifugation.

9) using nanodrop measure RN A concentration and 260nm/280nm ratio.

10) RNA obtained is stored in -80 DEG C of refrigerators.

2 extraction standards

Determine RNA concentration and 260nm/280nm ratio：The purity requirement of total serum IgE is that OD260/OD280 values should be 1.8 To between 2.2；The detection of RNA integralities：With 1% agarose gel electrophoresis detection RNA integrality；

According to the requirement of sequencing company, tiny RNA sequencing more than the μ g of total amount 3, concentration is more than 300ng/ μ l.

Embodiment 3 is sequenced and data analysis

The foundation and the sequencing of upper machine of sequencing library are carried out by sequencing company, used sequenator is Illumina companies HiSeq2000 sequenators.

The data provided according to sequencing company carry out statistical analysis, fdr<0.001, log2 (FC) absolute value>1, two groups The difference of count average values is more than 100.It is several to differential expression miRNA people to select the obvious miRNA of differential expression in filtering The molecular marker related to esophageal squamous cell carcinoma being never reported before enters our research range, wherein miR-3613- Although 5p variant expression between transfer group and ill two groups of group, difference unobvious, in transfer and ill cancerous tissue Expression quantity is all remarkably higher than cancer beside organism.

MiRNA expression in the Real-time PCR of embodiment 4 detection esophageal squamous cell carcinoma peripheral blood samples

1 sample collection：

26 esophageal squamous cell carcinoma patient peripheral blood samples and 31 normal healthy controls peripheral blood samples are all from hospital, and illness group is equal It is to be made a definite diagnosis by pathological examination.

2 miRNA are extracted：

Using the GenEluteTM plasma/serum RNA small scale purification kits (production code member RNB500) of sigma companies, Concrete operations are with reference to kit operational manual.

3 miRNA reverse transcriptions

The RT systems of table 1

Component	Concentration	Volume (μ l)
			Total RNA	-	1μg
miScript HiSpec Buffer	5×	4
			Nucleics Mix	10×	2
miScript Reverse Transcriptase Mix	-	2
			Nuclease-free H₂O	-	Filling-in is to 20

After 37 DEG C of insulation 60min make reverse transcription reaction complete in the type PCR instruments of ABI 9700,95 DEG C of 5min terminating reactions.Add Enter 80 μ l Nuclease-free H₂O is diluted to 100 μ l and is stored in -20 DEG C of refrigerators, for subsequent experimental.

4 quantitative fluorescent PCRs

The RT-PCR systems of table 2

MiRNAs detection of expression sets 3 parallel tube reactions every time, and internal reference is used as using general snRNA U6.

PCR programs：95℃10min；40 circulations (95 DEG C of 10s, 60 DEG C of 30s).Circulation is examined after terminating using melting curve Survey product specificities：97 DEG C are to slowly warm up to from 60 DEG C, 5 fluorescence signals of every DEG C of collection.5 statistical analysis

Analyzed using OriginPro8.1 softwares.Compare between statistical method mean and examined using t, P<0.05 (difference Significantly) and P<0.01 (difference highly significant) is set to statistically significant.As a result show compared with normal healthy controls, esophageal squamous cell carcinoma group MiR-3613-5p is significantly raised, and is about 3.5 times (see the Fig. 1) of control group, RT-PCR results and high flux data results Unanimously.

The evaluation analysis of the diagnostic of embodiment 5

It is to establish Receiver Operating Characteristics for single miRNA molecule or the method for the efficiency evaluation of diagnostic model (receiver operating characteristic, ROC) curve, passes through (the Area Under of area under calculated curve Curve) come judge diagnosis ability.We download the data about esophageal squamous cell carcinoma in TCGA databases, obtain data set (bag Include 13 control groups and 95 case groups), and then analyzed, as a result show, the AUC of mir-3613 diagnosis esophageal squamous cell carcinomas is 0.818 (see Fig. 2), show that it has good reference value on diagnosis esophageal squamous cell carcinoma.

The culture and transient transfection of the esophageal squamous cell carcinoma cell line of embodiment 6

First, material prepares：

Esophageal squamous cell carcinoma cell line EC109 is purchased from Chinese Academy of Sciences's Shanghai cell bank.

Lipofectamine^TM2000Transfection Reagent(Invitrogen)。

RPMI 1640 and DMEM culture mediums are purchased from GIBCO companies, and NBCS and tire Niu Erqing are purchased from PAA companies.

MiR-3613-5p sequences issue Synesis Company, ask its chemical synthesis miR-3613-5p mimics (SEQ ID NO 5：uguuguacuuuuuuuuuuguuc)、miR3613-5p inhibitor(SEQ ID NO 6： ) and its non specific control gaacaaaaaaaaaaguacaaca.

2nd, experimental method

1st, cell culture

Esophageal squamous cell carcinoma cell line EC109 use containing 10% NBCS the culture mediums of RPMI 1640,37 DEG C, 5% CO₂, Secondary Culture under conditions of saturated humidity, when cell culture to adherent about 80% density, PBS is used after washing 2 times 0.25% trypsin digestion cell simultaneously terminates digestion with the complete medium containing serum, desired proportions passage, is given birth to using logarithm Long-term cell carries out subsequent experimental.

2nd, cell cryopreservation and recovery

After cell is digested with appropriate 0.25% pancreatin and terminates digestion with the complete medium containing serum, addition contains Single cell suspension is made in 10%DMSO frozen stock solution, adds 1mL into sterile cryopreservation tube, is preserved after progressively cooling in liquid nitrogen. Freezing program is：4 DEG C of 30min, -20 DEG C of 1-2h, -80 DEG C overnight, be transferred in liquid nitrogen container preserve afterwards.During cell recovery, It is transferred in culture medium and is cultivated after rapid defrosting in 37 DEG C of water-baths.Liquid is changed after 12-16 hours and carries out cellar culture.

3rd, miRNA is transiently transfected

Lipofectamine is pressed in operation^TM2000 reagent specifications are carried out.24h is by growth conditions good before transfection EC109 cells are inoculated into 6 orifice plates, and cell count is about 4 × 10⁵/ L, cellar culture are to the same day, cell fusion degree is transfected Tested during 70-80%.100nM miR-3613-5p mimics/miR3613-5p inhibitor are added to 250 μ l It is soft to mix in the culture medium of serum-free 1640；It is another to dilute 5 μ l Lipofectamine with the culture medium of 250 μ l serum-frees 1640^TM 2000 liposomes are soft to mix；Mixing, 20min is incubated at room temperature, to form transfection composite：Then said mixture is added to In cell culture medium, gently mix, be replaced by after cultivating 4-6h containing 10% calf serum complete medium.Wherein, it is non-specific The mimics Negative Control (mimics NC) and inhibitor Negative Control (inhibitor of property NC) sequence is as control.

Cell total rna is extracted after culture 24-48h, reverse transcription detects miR- after transient transfection into cDNA, real-time quantitative PCR The change of 3613-5p expression.

4. experimental result

Transiently transfected using cationic-liposome method, respectively by miR-3613-5p mimics or miR-3613- 5pinhibitor and corresponding control sequence Negative Control (NC) transfection esophageal squamous cell carcinoma cell line EC109.Transfect 48h Afterwards, cell total rna is extracted.Using U6 as internal reference, real-time quantitative PCR detects miR-3613-5p expression.As a result show：With it is right Compared according to group, after EC109 transfection miR-3613-5p mimics, miR-3613-5p expression increases about 3.3 times；Transfection After miR-3613-5p inhibitor, expression have dropped nearly 71%.Result above shows, by transiently transfecting miR-3613-5p Mimics and miR-3613-5p inhibitor effectively can raise or lower miR-3613-5p expression, and reliable results can be carried out Subsequent experimental.

Embodiment 7 transfects influences of the miR-3613-5p to Human esophageal squamous cell cancer cell growth

CCK-8 methods are examined using the Cell Counting Kit-8 kits of Japanese colleague's chemistry institute (Dojindo) Survey.Cell transfecting step is with reference to embodiment 6.Active cell number is detected after transfection 24h, sucks old culture medium, is added per hole Enter the CCK8 detection reagents of Fresh.First prepare institute's gaging hole number corresponding detection reagent (per 100 microlitre 1640 of hole culture medium and 10 microlitres of CCK8), 100 microlitres of mixtures are added after mixing per hole.One group of blank control, as only CCK8 detections are set simultaneously Reagent is without detection groups of cells.Cell, which is put into incubator, to be continued to cultivate, and ELIASA detects OD450 after 2h.Successively in transfection 48h, 72h, Same time point adds CCK8 detection reagents after 96h, and OD450 is detected after being incubated 2h.Drawn according to every class mean and standard deviation thin Intracellular growth curve map.

Using influences of the CCK-8 methods detection miR-3613-5p to esophageal squamous cell carcinoma cell in-vitro growth.As a result find Cell growth can be obviously promoted after miR-3613-5p (transfection miR-3613-5p mimics) is overexpressed in EC109 cells, and is pressed down Cell viability measurement can be reduced after miR-3613-5p (transfection miR-3613-5p inhibitor) processed (see Fig. 3).

Although describing the present invention with reference to various preferred embodiments, it will be appreciated by those skilled in the art that can carry out each Kind change, and available equivalents substitute base region of its component without departing from the present invention.Come in addition, many changes can be carried out Particular case or material is set to be suitable for the teachings of the present invention without departing from its base region.

Therefore, the present invention is not intended to be defined in the particular disclosed herein for being used to carry out the present invention；On the contrary, This invention is intended to all embodiments including falling within the scope of the appended claims.

Sequence table

<110>Beijing Yang Shen biology information technologies Co., Ltd

<120>Mir-3613 and its ripe miRNA new application

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 87

<212> RNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

ugguuggguu uggauuguug uacuuuuuuu uuuguucguu gcauuuuuag gaacaaaaaa 60

aaaagcccaa cccuucacac cacuuca 87

<210> 2

<211> 22

<212> RNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

uguuguacuu uuuuuuuugu uc 22

<210> 3

<211> 24

<212> RNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

acaaaaaaaa aagcccaacc cuuc 24

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

tgttgtactt ttttttttgt tc 22

<210> 5

<211> 22

<212> RNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

uguuguacuu uuuuuuuugu uc 22

<210> 6

<211> 22

<212> RNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

gaacaaaaaa aaaaguacaa ca 22

Claims

1. a kind of esophagus cancer diagnosis reagent, the esophagus cancer diagnosis reagent can detect mir-3613 and/or its maturation in sample MiRNA expression.

2. esophagus cancer diagnosis reagent according to claim 1, it is characterised in that the cancer of the esophagus is esophageal squamous cell carcinoma.

3. esophagus cancer diagnosis reagent according to claim 1, it is characterised in that sample is tumor tissues or peripheral blood.

4. esophagus cancer diagnosis reagent according to claim 2, it is characterised in that oesophagus squama cancer diagnosis reagent is based on high flux Sequence measurement and/or gene chips and/or quantifying PCR method and/or probing procedure detection sample in mir-3613 and/ Or its ripe miRNA transcription situation, it is preferred that it is described be used for quantifying PCR method include specific amplification mir-3613 and/ Or its ripe miRNA primer；The described core included based on probing procedure with mir-3613 and/or its ripe miRNA The probe of acid sequence hybridization.

5. esophagus cancer diagnosis reagent according to claim 4, it is characterised in that surveyed using two generation sequence measurements, unimolecule Sequence method, northern hybridizing methods, miRNA chip of expression spectrum, ribozyme protection analytical technology, RAKE methods, in situ hybridization, it is based on Mir-3613 and/or its ripe miRNA transcription in the Flow cytometry sample of microballoon.

6. application of the esophagus cancer diagnosis reagent in oesophagus squama cancer diagnosis instrument is prepared according to claim 1-5.

7. one kind treats esophageal squamous cell carcinoma pharmaceutical composition, it is characterised in that described pharmaceutical composition includes：(a) compound or group Compound, the compound lower mir-3613 and/or its ripe miRNA transcription and/or suppress mir-3613 and/or its maturation MiRNA activity；(b) receptible carrier in pharmacy.

8. pharmaceutical composition according to claim 7, it is characterised in that using ASON, miRNA Inhibitor, antagomiRs, miRNA sponge, miRNA Erasers, Target Masking and/or Mutiple Targets antisense are few The method of nucleotides lowers mir-3613 and/or its ripe miRNA transcription and/or blocks mir-3613 and/or its maturation MiRNA activity.

9. application of the pharmaceutical composition in esophageal squamous cell carcinoma is treated according to claim 7-8.

10. pharmaceutical composition according to claim 9, it is characterised in that miRNA inhibitor sequences are shown in SEQ ID NO 6。