CN113151368B

CN113151368B - Coenzyme Q synthesis pathway benzene ring 6-position hydroxylase and application thereof

Info

Publication number: CN113151368B
Application number: CN202110291291.4A
Authority: CN
Inventors: 许晶晶; 杨蕾; 范航; 陈晓亚; 李辰意
Original assignee: SHANGHAI CHENSHAN BOTANICAL GARDEN
Current assignee: SHANGHAI CHENSHAN BOTANICAL GARDEN
Priority date: 2021-03-18
Filing date: 2021-03-18
Publication date: 2022-07-26
Anticipated expiration: 2041-03-18
Also published as: CN113151368A

Abstract

The invention obtains benzene ring 6-position hydroxylase CoqF of arabidopsis thaliana through research. The activity is further verified by complementing 6-site hydroxylase gene mutant strains of saccharomyces cerevisiae, and the synthesis of coenzyme Q in plants is proved by analyzing arabidopsis RNAi transgenic plants. Therefore, the benzene ring 6-position hydroxylase CoqF provided by the invention can be used for improving the content of coenzyme Q, and has a greater application value.

Description

Coenzyme Q synthesis pathway benzene ring 6-position hydroxylase and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a benzene ring 6-position hydroxylase in a coenzyme Q synthesis way.

Background

Coenzyme Q (CoQ), also known as ubiquinone (ubiquinone), is a class of terpene benzoquinones that are present in all eukaryotes and in a subset of bacteria (α, β, γ proteobacterium). CoQ is composed of a quinone ring parent nucleus and polyisoprene side chains (FIG. 1), the number of side chain isoprene units in different organisms is different, 10 isoprene units are used in human, and CoQ is synthesized ₁₀ Synthesis of CoQ by E.coli ₈ Synthesis of CoQ by Saccharomyces cerevisiae ₆ Synthesis of CoQ from Arabidopsis thaliana ₉ 。

CoQ has an important physiological function, and is located centrally in the electron transport chain (respiratory chain), and transfers electrons from NADH-Q reductase (complex I) and succinate-Q reductase (complex II) to cytochrome reductase (complex III), thereby promoting oxidative phosphorylation and the transfer of electrons, thereby generating ATP. CoQ has other various functions in the cell, for example, CoQ is found in the membrane structure of almost all eukaryotic cells, and it can protect the stability of the biological membrane structure as a lipid-soluble antioxidant.

The lack of CoQ in humans can lead to very serious diseases. The mutation of CoQ synthetic pathway gene can cause primary CoQ deficiency, affect energy-consuming organs such as brain, heart, kidney, skeletal muscle and the like, and cause a series of diseases such as encephalopathy, epilepsy, cerebellar ataxia, hypertrophic cardiomyopathy, nephrotic syndrome, myopathy and the like. Factors such as statins, age increase, other diseases, etc., contribute to secondary deficiencies in CoQ. Exogenous supplementation of CoQ may improve the symptoms of CoQ deficiency to some extent.

However, the biosynthesis of CoQ is a complex process, and the synthetic pathway has not yet been fully resolved to date. It is known that enzymes of the CoQ synthetic pathway are mainly identified in Escherichia coli (Escherichia coli) or Saccharomyces cerevisiae (Saccharomyces cerevisiae). Coli related enzymes are designated Ubi (UbiA-J and UbiX) and yeast enzymes are designated Coq (Coq 1-11). The biosynthetic pathway of CoQ includes four links: the specific routes of the synthesis of the benzene ring, the synthesis of the side chain, the connection of the side chain and the benzene ring and the modification of the benzene ring are not completely the same in different organisms.

The precursor of the benzene ring is usually p-hydroxybenzoic acid. In E.coli, chorismic acid is converted to p-hydroxybenzoic acid by the action of chorismic acid lyase Ubic. Human, yeast and plant p-hydroxybenzoic acid is from the tyrosine pathway, which currently resolves only the first and last steps. In addition, the plant para-hydroxybenzoic acid is also derived in large part from the phenylpropanoid pathway.

Precursors of the polyisoprene side chain are isopentenyl diphosphate (IPP) and dimethylallyl Diphosphate (DMAPP), which are supplied by the mevalonate pathway (MVA pathway) in eukaryotes and 2-C-methyl-D-erythritol 4-phosphate pathway (2-C-methyl-D-erythrol 4-phosphate pathway, MEP pathway) in prokaryotes. Polyprenyl diphosphate synthase (PPS) produces polyisoprene pyrophosphate by condensation reaction of IPP with a propenyl acceptor at the 1' -4 position. The synthesis of eukaryotic CoQ proceeds from this reaction all on the matrix side of the inner mitochondrial membrane.

The polyprenyl pyrophosphate side chain and p-hydroxybenzoic acid are condensed under the action of 4-hydroxyphenyl benzoate polyprenyl diphosphate transferase (PPT) to form 3-polyprenyl-4-hydroxybenzoic acid (3-polyprenyl-4-hydroxyphenyl benzoate), and the enzymes in E.coli and yeast are UbiA and Coq2, respectively.

In the final process of CoQ synthesis, a benzene ring needs to be subjected to a series of modifications, including one-step decarboxylation, three-time hydroxylation modification and three-time methylation modification. In eukaryotes, 3-polyprenyl-4-hydroxybenzoic acid first introduces a hydroxyl group at the 5-position of the benzene ring, then converts to a methoxy group, and then decarboxylates by unknown enzymes. The subsequent reaction steps are consistent between eukaryotes and prokaryotes, and include introduction of a hydroxyl group at the 1-position of the benzene ring, followed by introduction of a methyl group at the 2-position, and finally introduction of a hydroxyl group at the 6-position, and conversion of the hydroxyl group at the 6-position to a methoxy group, thereby completing the synthesis of CoQ (fig. 2).

The enzymes of the CoQ synthesis process are generally conserved across species, with the exception of the benzene ring 6 hydroxylase. Three enzymes are known to have hydroxylation activity at the 6-position of the benzene ring, UbiF, UbiM and Coq7, respectively. UbiF belongs to the class a Flavin Monooxygenase (FMO), was first found in e.coli and is also present in some other gamma proteobacteria. Ubim is currently found only in a subset of proteobacteria, not a specific 6-hydroxylase, but also with 1-and 5-hydroxylating activity and is a class A flavinoid monooxygenase. Coq7 is a diiron hydroxylase (diiron hydroxylase) containing conserved sequences that bind iron ligands, known to occur in yeast, humans, nematodes and some proteobacteria.

There are no homologous proteins of the above three enzymes in plants, and it has not been known which enzyme catalyzes the 6-position hydroxylation reaction of the benzene ring, and a specific 6-position hydroxylase may exist in plants.

Disclosure of Invention

The invention discovers a new coenzyme Q synthesis way, namely benzene ring 6-hydroxylase CoqF in arabidopsis thaliana, and participates in the synthesis of coenzyme Q in plants, and no comment is made in a gene database to realize the function. The invention discovers that the new coenzyme Q synthesis way, namely the benzene ring 6-position hydroxylase CoqF, is widely present in plants, green algae, inequality flagellates, vesicular worms, chaetoceros, pythobia, crypthecodinium and other eukaryotes.

The invention provides application of a benzene ring 6-position hydroxylase gene in generation of coenzyme Q in plants, bacteria, fungi and algae, and is characterized in that the benzene ring 6-position hydroxylase gene is derived from plants, green algae, SAR super group, algae of vervain and cryptophyte.

Preferably, the hydroxylase gene at the 6 th position of the benzene ring is from arabidopsis thaliana, rice, tomato, liverwort, freshwater microalgae (Chlorella sorokiniana), marine microalgae (Ostreococcus tauri), Saprolegnia parasitica (Saprolegnia parasitica), duckweed thorny beetle (styrylonychia lemnae); more preferably, the GenBank accession numbers thereof are NP _173844.2, XP _015620261.1, XP _004239375.1, PTQ40024.1, PRW56607.1, XP _003079408.2, XP _012203255.1, CDW 87725.1.

Further, the 6-position hydroxylase gene of the benzene ring is:

(1) a nucleotide sequence of SEQ ID No.1 or degenerate sequence thereof;

(2) the sequence obtained by adding, deleting and substituting one or more nucleotides in SEQ ID No.1, and the sequence codes for the protein with the same function as SEQ ID No. 2.

In one embodiment, the application is to produce coenzyme Q by fermentation using a microorganism into which the gene for the hydroxylase at the 6-position of the benzene ring is introduced and which is capable of expressing, preferably the microorganism is Escherichia coli, yeast.

In another embodiment, the use is to increase the level of coenzyme Q in transgenic plants into which the benzene ring 6 hydroxylase gene has been introduced and expressed by transgenic means. Preferably, the plant is arabidopsis thaliana.

The invention also provides application of the benzene ring 6-position hydroxylase in generating coenzyme Q, wherein the benzene ring 6-position hydroxylase is coded by a benzene ring 6-position hydroxylase gene derived from plants, green algae, SAR super groups, vervain and cryptophyte. Preferably from Arabidopsis thaliana, rice, tomato, liverwort, fresh water microalgae (Chlorella sorokiniana), marine microalgae (Ostreococcus tauri), Saprolegnia parasitica (Saprolegnia parasitica), Spirodela polyrhiza (Stylonychia lemnae), more preferably with GenBank accession numbers NP-173844.2, XP-015620261.1, XP-004239375.1, PTQ40024.1, PRW56607.1, XP-003079408.2, XP-012203255.1, CDW 87725.1.

Further preferably, the amino acid sequence of the benzene ring 6-position hydroxylase is shown as SEQ ID No. 2.

The research of the invention finds that the gene with the activity of the benzene ring 6-position hydroxylase CoqF from plants can be used for improving the content of the coenzyme Q, for example, the coenzyme Q is produced by microbial fermentation, and provides a basis for improving the content of the coenzyme Q in organisms. The invention enriches the diversity of the synthetic routes of the coenzyme Q of eukaryote and lays a foundation for designing medicines, insecticides, pesticides and the like of the targeted coenzyme Q route. Therefore, the invention has great application value.

Drawings

FIG. 1 shows the structure of coenzyme Q.

FIG. 2 eukaryotic CoQ synthesis pathway.

FIG. 3 knock-out of E.coli UbiF gene. Wherein, (A) a design drawing for knocking out UbiF gene; (B) the wild type and mutant strains were PCR-tested, primers F/R are shown in A, and the band of the mutant strain Δ ubiF was smaller than that of the wild type.

FIG. 4AtCoqF complemented the E.coli. DELTA. ubiF mutant. Wherein (A) from top to bottom pTrc99a empty vector transformed wild type strain, pTrc99a empty vector, pTrc99a containing AtCoqF and AtCoq6 transformed delta ubiF mutant strain, respectively. Culturing positive transformant to bacterial liquid OD ₆₀₀ The cells were diluted in a 10-fold gradient at 0.5, inoculated in M9 medium containing 0.4% glucose or 0.4% succinate as a carbon source, and cultured overnight at 37 ℃. (B) CoQ ₈ LC-MS (MRM mode) detection profile of (1). (C) Quantitative determination of CoQ ₈ Data are mean ± standard deviation of three biological replicates.

FIG. 5AtCoqF complemented the Saccharomyces cerevisiae Δ coq7 mutant strain. Wherein (A) the wild type strain is transformed with pRS426 and pRS423 empty vectors, pRS426-AtCoqF and pRS423-ScCoq8, and pRS426 and pRS423-ScCoq8 to Δ coq7 mutant strains in this order from top to bottom. Culturing positive transformant to bacterial liquid OD ₆₀₀ The cells were diluted 10-fold in gradient, inoculated on SD-Ura-His medium using glucose or glycerol and ethanol as carbon sources, and cultured at 30 ℃. (B) CoQ ₆ LC-MS (MRM mode) detection scheme (1). (C) Quantitative determination of CoQ ₆ Data are mean ± sd of three biological replicates.

FIG. 6 detection of CoQ content in RNAi transgenic plants of AtCoqF. Wherein (A) qRT-PCR detects the relative expression of AtCoqF genes in three transgenic strains. (B) The plant aerial parts were assayed for coenzyme Q9 content for 4 weeks and the data were mean. + -. standard deviation of four biological replicates.

FIG. 7 CoqF Gene complementation of E.coli.DELTA.ubiF mutants by different species CoqF to generate CoQ ₈ And (6) data.

Detailed Description

The invention will be further described by the following specific embodiments for better understanding of the invention, but not to be construed as limiting the invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1: cloning of Arabidopsis thaliana CoqF Gene and complementation of E.coli Delta ubiF mutant Strain

The gene of the plant coenzyme Q synthetic pathway has the characteristic of co-expression, and a plurality of candidate hydroxylase genes are screened through the co-expression analysis of the gene and the known gene of the Arabidopsis thaliana coenzyme Q pathway. The activity of these candidate genes was examined by complementing the 6-position hydroxylase gene UbiF mutant strain of Escherichia coli. It was found that the Ubif mutant strain could be complemented back to growth after transfer into one of the candidate genes (At1g24340, NP-173844.2, GeneID:839050, nucleotide sequence as SEQ ID NO.1, amino acid sequence as SEQ ID NO.2), and was therefore named CoqF. CoqF is a gene of Arabidopsis with unknown function. The specific experimental procedure is as follows.

To obtain the E.coli Δ ubiF mutant, the UbiF gene of E.coli MG1655 strain was knocked out by CRISPR/Cas9 gene editing technique. Designing a knockout target spot in the UbiF gene, designing homologous repair templates at positions which are about 150bp away from the two sides of the target spot, deleting about 300bp of the repaired coding region of the UbiF gene, and carrying out PCR identification (AGTATGAGCGTTATCAGC, AGCGGATGGATGGTATGC) to obtain a positive strain. As shown in FIG. 3, A is a design drawing of the knock-out UbiF gene, in which primer F/R is as shown in the drawing, and the band of the.DELTA.ubiF mutant strain is smaller than that of the wild type. B is an electrophoresis picture of PCR detection of wild type and mutant strains. The specific experimental procedure is as follows.

Plasmid pCas was transformed into MG 1655. Positive clones were picked, electroporation competent cells were prepared, and electroporation into plasmid pTargetT containing the homologous fragment. Construction of pTargetT: a fragment containing N20 and sgRNA (CGGACTAGTGCAGACTGGAAACGTGGGAGGTTTTAGAGCTAGAAATAGC, CTCAAAAAAAGCACCGACTCGG), a homologous fragment 1(GGATTACCCTGTTATCCCTATTGAGCAGGTGTTCAGC, CGAATCACTGGTCAATCATCCTGTTAG) and a homologous fragment 2(TGATTGACCAGTGATTCGCGCGAAGCT, CGCGTCGACACGGGAAATGCTTCGCGA) of UbiF were amplified separately, and the resulting three-stage PCR product was amplified by overlap, digested with SpeI/SalI, and cloned into plasmid pCB003, thereby obtaining pTargetT.

The literature reports that UbiF-mutated escherichia coli cannot grow on a succinic acid-carbon source-containing medium and can grow on a glucose-carbon source-containing medium, but at a lower growth rate than the wild-type. The Δ ubiF mutant strain transferred into empty vector was observed to grow slowly on glucose medium and not on succinic acid medium, consistent with literature reports.

The Arabidopsis thaliana CoqF gene (i.e., AtCoqF) was cloned into the E.coli expression vector pTrc99a using primer CGGGGTACCATGGCGATTCTAGGGCTT, GCTCTAGATCATTGTTTCCCTAGTATGAT, KpnI/XbaI and transformed into the above-described mutant strain (. DELTA.ubiF). The resulting positive transformants were inoculated on M9 medium (A in FIG. 4) with 0.4% glucose or 0.4% succinate as a carbon source, respectively.

In addition, the known Arabidopsis thaliana benzene ring 5 hydroxylase AtCoq6 was used as a control (primer CGGAATTCATGTCTAAGGACAGGGTG, CGGGATCCTCAAGAAAATAGCGGCAAAG, EcoRI/BamHI cut), cloned into the vector pTrc99a, transformed into a delta ubiF mutant strain, and could not restore growth, indicating that AtCoq6 did not have benzene ring 6 hydroxylase activity.

Several of the above transformants were cultured overnight in liquid LB medium (containing 0.4% glucose), and CoQ was extracted and detected by LC-MS. The results show that the wild type strain synthesizes CoQ ₈ The mutant strain of Δ ubiF hardly contains CoQ ₈ The mutant strain transferred into AtCoqF can synthesize CoQ ₈ And there was no change after the transfer to AtCoq6 (B in FIG. 4). The results of the quantitative determination revealed that the mutant strain into which AtCoqF was transferred had a CoQ content similar to that of the wild type (C in FIG. 4). The above results indicate that AtCoqF has a benzene ring 6-hydroxylase activity.

Wherein, in the present embodiment, the measurementColi determining CoQ ₈ The detection method of (3) is as follows. Culturing overnight in 10mL LB liquid culture medium (containing 0.4% glucose), centrifuging to collect thallus, weighing wet weight, adding isopropanol proportionally, ultrasonic extracting at low temperature in dark place for 1h, and injecting the filtered sample into liquid phase-mass spectrometry for analysis. The liquid phase conditions were as follows: HPLC-DAD-MS (1260Infinity II-6460, Agilent) is matched with a ZORBAX Eclipse XDB C18 column (3.5 mu m, 2.1X 50mm), isopropanol is taken as a mobile phase (A), and (B) 87.5% acetonitrile water solution (containing 10mmol/L ammonium acetate) is taken as a mobile phase, and the mobile phase conditions are 0-6min and 65-15% B; the flow rate was 0.4 mL/min. Mass spectrometry conditions were as follows: ESI ion source is adopted, the capillary voltage is set to be 4.0kV, the atomizer pressure is set to be 35psi, high-purity nitrogen is used as carrier gas, and the flow rate is 11L/min; selecting positive ion mode pair CoQ ₈ (parent ion m/z 727.6, daughter ion m/z 197.1) under the conditions of a fragmentation voltage of 182V and a collision energy of 32V.

Example 2: arabidopsis thaliana CoqF gene complementation Saccharomyces cerevisiae delta coq7 mutant strain

The arabidopsis CoqF gene (amplification primer ACGAGATGTAAGAGCACAATGGCGATTCTAGGGCTT, ATCGAATTCCTGCAGCCCTCATTGTTTCCCTAGTAT) was fused to the mitochondrial signal peptide (amplification primer TTCGATATGGGATCCCCCATGTTGTTAAGATCTAGA, TGTGCTCTTACATCTCGT) of yeast Coq3 at the N-terminus and cloned into yeast expression vector pRS426, with expression regulated by the promoter (TTGCGGCCGCGATCCGGGTGTTCGG, CGCGGATCCCATATCGAACGATATCTT) and terminator (GACGTCGACAATACTTCCCCGCTATTTG, CGCTCGAGGCTATTGGCAGAAGGATT) of yeast Coq 8.

The Coq8 gene (CCGCGGCCGCATGGTTACAAATATGGTGAAAT, GGCTCGAGTTAAACTTTATAGGCAAAAATC) of yeast was cloned into expression vector pRS 423.

The two vectors were co-transformed into a mutant strain of Saccharomyces cerevisiae Δ coq7 (Y12381, purchased from EUROSCARF), and the resulting positive transformants were inoculated on SD medium (A in FIG. 5) containing 2% glucose or 3% glycerol and 2.5% ethanol as carbon sources, respectively, and the results showed that growth was possible on medium containing glycerol and ethanol as carbon sources. Whereas the mutant strain Δ coq7 transformed with an empty vector or only with CoqF could not grow on a medium with glycerol and ethanol as carbon sources.

Wild type strain BY4742Two empty vectors pRS426 and pRS423 were transferred as controls. CoQ of the above transformants was extracted and detected by LC-MS. The results show that the wild type strain can synthesize CoQ ₆ Whereas the mutant strain Δ CoQ7 contained almost no CoQ ₆ The mutant strain transferred to both AtCoqF and ScCoq8 can synthesize CoQ ₆ (B and C in FIG. 5). The above results indicate that AtCoqF has a benzene ring 6-hydroxylase activity.

In this example, the CoQ of Saccharomyces cerevisiae was determined ₆ The method of (2) is as follows. Culturing with 10mL SD-Ura-His liquid culture medium (containing 2% glucose) overnight, centrifuging to collect thallus, weighing wet weight, cracking thallus with methanol, adding isopropanol at a certain ratio, and extracting and detecting. CoQ ₆ (parent ion m/z 591.4, daughter ion m/z 197.1), fragmentation voltage 182V, collision energy 28V.

Example 3: RNAi transgenic plant of Arabidopsis CoqF with reduced CoQ content

Constructing an RNAi vector: an approximately 300BP fragment of the coding region of AtCoqF was PCR amplified (GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACAGTTGGTTCGATCCT, GGGGACCACTTTGTACAAGAAAGCTGGGTTTCTTGAACCTGGTTCAGC), cloned into the vector pDOnr207 by the BP reaction, and then both fragments were reverse cloned into the vector pK7GWIWG2R (II) by the LR reaction. The wild type Arabidopsis thaliana Col-0 was transformed by the floral dip method. Obtaining 3 strains which are obviously reduced and detecting CoQ ₉ The content, significantly lower than that of the wild type, indicates that AtCoqF is involved in CoQ synthesis in plants.

As shown in FIG. 6, qRT-PCR is shown in A to detect the relative expression of AtCoqF genes in three transgenic lines. The measurement of the content of coenzyme Q9 in the aerial part of the plants at 4 weeks is shown in B, and the data are the mean values of four biological replicates. + -. standard deviation. The coenzyme Q content of the three lines is obviously reduced and is about 68-73% of that of wild plants.

In this example, Arabidopsis thaliana CoQ was measured ₉ The method of (3) is as follows. And (3) carrying out freeze drying on the plants at a low temperature, then carrying out vibration grinding by using a ball mill, weighing 10mg of powder, adding 1mL of isopropanol, and carrying out ultrasonic extraction for 1h at a low temperature in a dark place. The detection method is the same as above. CoQ ₉ (parent ion m/z 795.6, daughter ion m/z 197.1), fragmentation voltage 216V, collision energy 36V.

Example 4: CoqF is ubiquitous in many classes of eukaryotes

Protein sequence analysis indicated that CoqF is ubiquitous in plants and green algae, and is also present in other eukaryotes, such as SAR super group (Stramenopila, Alveolata, Rhizaria), Haptosta (Haptista), Cryptophyta (Cryptista). Representative species such as three plants of rice (Oryza sativa, XP _015620261.1), tomato (Solanum lycopersicum, XP _004239375.1) and liverwort (Marchantia polymorpha, PTQ40024.1), two green algae of freshwater microalgae (PRW 56607.1) and marine microalgae (Ostreococcus tauri, XP _003079408.2), two green algae of parasitic Saprolegnia parasitica (XP _012203255.1) and duckweed thoroughwort (Stylonychia lemna, CDW87725.1) belong to SAR super-cluster species, and a CoqF gene is synthesized completely and transferred to an Escherichia coli expression vector pTrc99a and a delta ubiF mutant strain.

The results of the quantitative assay showed that after transfer of the CoqF genes from these species, the Δ ubiF mutants were able to produce CoQ, indicating that they all have benzene ring 6 hydroxylase activity (fig. 7, where the data are the mean ± standard deviation of three biological replicates). The results showed that the CoqF of three plants, rice (Oryza sativa), tomato (Solanum lycopersicum) and liverwort (Marchantia polymorpha), was transformed into E.coli.DELTA.ubiF mutant strains, and the ability to synthesize coenzyme Q was restored to 33% to 94% of that of wild type. CoqF of two kinds of green algae, namely freshwater microalgae (Chlorella sorokiniana) or marine microalgae (Ostreococcus tauri), is transferred into the Escherichia coli delta ubiF mutant strain, and the capability of synthesizing coenzyme Q is recovered and is 80-137% of that of a wild type. In the mutant strain of the escherichia coli delta ubiF, two kinds of CoqF belonging to species of a super group SAR (Saprolegnia parasitica) or Lemna minor (Stylonychia lemnae) are transferred, and the capability of synthesizing coenzyme Q is recovered and is 94% -109% of that of the wild type.

Sequence listing

<110> Shanghai mountain plant garden

<120> coenzyme Q synthesis pathway benzene ring 6-position hydroxylase and application thereof

<160> 26

<170> PatentIn version 3.5

<210> 1

<211> 2130

<212> DNA

<213> Arabidopsis thaliana

<400> 1

atggcgattc tagggcttat caagagggtt acacgaataa ccgtaaacaa ttcgagggtc 60

agagtgtacc cagtgaggta cttccaaagg aaggaccttt caagcacaaa tctattcaat 120

ggtgaagatg ctgctaagct tcctgttctg atcgtcggcg ctggaccggt gggactcgtt 180

ttatccatcc ttctcaccaa actaggagtg aaatgtgctg ttgttgacaa agccacaagc 240

ttctcgaaac atccacaagc acactttatc aacaaccgat caatggagat cttccgtgaa 300

ttggatggat tagctgagga gattgaaaga tcacagcctc ctgtagattt gtggagaaaa 360

tttatttact gtacatctct ctccggctca acactaggca cagttgatca catgcagcct 420

caagattttg agaaagttgt cagcccggct tctgttgctc acttctccca gtacaaattg 480

acaaatttat tgcttaagcg gttggaagac ctcggctttc atgttcgtgg ttccaaagag 540

tcggatggtc ttgaggctga ctctgtggtt gcgaggcaaa ttcttatggg tcatgagtgt 600

gtggggattg atgctaacaa ggacagtatt actgcaactg tttcttttct caaaggaggc 660

aagcatatga aaagaaacat tcaatgtagt ctactggttg gtgctgatgg tgctgggagt 720

gcagtaagaa agctcacagt aatagaaatg cgaggggaaa gagatctaca gaagcttgtt 780

agtgtccatt tcatgagtag agagctcggt gagtacctga tcagtaacag accagggatg 840

ctatttttta tttttaacac cgatggtata ggagttcttg ttgcccatga tcttctacaa 900

ggagaatttg ttttgcagat tccatactat ccacctcaac agagtctatc tgattttagt 960

cctgagatgt gcaagatgct gatattcaat ttggtgggac atgagctttc agacttggat 1020

gtagctgata ttaagccatg ggtcatgcat gctgaagtcg ccgagaaatt catgtgttgt 1080

gagaacagag tgatacttgc tggtgatgct gctcaccggt tcccgcctgc tggaggtttt 1140

ggaatgaaca ctggaattca ggatgctcat aatcttgcat ggaaaatagc agctcttgtt 1200

cagggttctg caaactcttc aattcttaaa acttatgaaa cagaacgtag gccgattgcc 1260

ctttccaata cttcactcag tgttcaaaac ttcagagcag ctatgtcagt tccttcagcg 1320

ctaggccttg acccaacagt tgcaaactca gtgcataggt ttataaacaa aacagttggt 1380

tcgatccttc caactgggct gcaaaaggca atcttggata atgtctttgc actaggtcgt 1440

gcacagcttt cagaatctct gttgaatgag agcaatccac tgggaaatca gagacttagc 1500

agactaaaga gtatcttcga aggaggaaaa agccttcaac tacagtttcc tgcagaagat 1560

cttggtttca ggtatttaga gggagccatt gttcctgata acgagtctga agctggtgat 1620

cccgaagtac cgagtggtcg tagaagagac tatgtccctt gtgctgaacc aggttcaaga 1680

ctgcctcata tgtatgtgaa aatactgtca gattccacaa gagaggttat tgtttctaca 1740

ctggatcttg tttcgacaga gaaagtggag tttctactta taatatcgcc attacaagag 1800

tcctatgagc tagctcatgc tacattcaaa gtcgcaaaag agtttatggc tagtgtaaaa 1860

gtatgcgtgg tctggcctag tagtgatgat ggtcttgaaa ggaagagcaa ttcagcatta 1920

gctccatggg aaaattatgt cgatgttatg gaagttaaaa aacaaaatgg tgaaggaact 1980

tcgtggtgga gtatttgtaa aatgtcagag agaggatcta ttttagtccg tcccgaccaa 2040

cacattgctt ggcgagcaaa gtctggtatt actttggatc ctactctgca catgagagat 2100

gtcttcacca tcatactagg gaaacaatga 2130

<210> 2

<211> 2130

<212> PRT

<213> Arabidopsis thaliana

<400> 2

MAILGLIKRV TRITVNNSRV RVYPVRYFQR KDLSSTNLFN GEDAAKLPVL IVGAGPVGLV 60

LSILLTKLGV KCAVVDKATS FSKHPQAHFI NNRSMEIFRE LDGLAEEIER SQPPVDLWRK 120

FIYCTSLSGS TLGTVDHMQP QDFEKVVSPA SVAHFSQYKL TNLLLKRLED LGFHVRGSKE 180

SDGLEADSVV ARQILMGHEC VGIDANKDSI TATVSFLKGG KHMKRNIQCS LLVGADGAGS 240

AVRKLTVIEM RGERDLQKLV SVHFMSRELG EYLISNRPGM LFFIFNTDGI GVLVAHDLLQ 300

GEFVLQIPYY PPQQSLSDFS PEMCKMLIFN LVGHELSDLD VADIKPWVMH AEVAEKFMCC 360

ENRVILAGDA AHRFPPAGGF GMNTGIQDAH NLAWKIAALV QGSANSSILK TYETERRPIA 420

LSNTSLSVQN FRAAMSVPSA LGLDPTVANS VHRFINKTVG SILPTGLQKA ILDNVFALGR 480

AQLSESLLNE SNPLGNQRLS RLKSIFEGGK SLQLQFPAED LGFRYLEGAI VPDNESEAGD 540

PEVPSGRRRD YVPCAEPGSR LPHMYVKILS DSTREVIVST LDLVSTEKVE FLLIISPLQE 600

SYELAHATFK VAKEFMASVK VCVVWPSSDD GLERKSNSAL APWENYVDVM EVKKQNGEGT 660

SWWSICKMSE RGSILVRPDQ HIAWRAKSGI TLDPTLHMRD VFTIILGKQ 709

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence

<400> 3

agtatgagcg ttatcagc 18

<210> 4

<211> 18

<212> DNA

<213> Artificial sequence

<400> 4

agcggatgga tggtatgc 18

<210> 5

<211> 49

<212> DNA

<213> Arabidopsis thaliana

<400> 5

cggactagtg cagactggaa acgtgggagg ttttagagct agaaatagc 49

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

ctcaaaaaaa gcaccgactc gg 22

<210> 7

<211> 37

<212> DNA

<213> Arabidopsis thaliana

<400> 7

ggattaccct gttatcccta ttgagcaggt gttcagc 37

<210> 8

<211> 27

<212> DNA

<213> Artificial sequence

<400> 8

cgaatcactg gtcaatcatc ctgttag 27

<210> 9

<211> 27

<212> DNA

<213> Artificial sequence

<400> 9

tgattgacca gtgattcgcg cgaagct 27

<210> 10

<211> 27

<212> DNA

<213> Arabidopsis thaliana

<400> 10

cgcgtcgaca cgggaaatgc ttcgcga 27

<210> 11

<211> 27

<212> DNA

<213> Artificial sequence

<400> 11

cggggtacca tggcgattct agggctt 27

<210> 12

<211> 29

<212> DNA

<213> Artificial sequence

<400> 12

gctctagatc attgtttccc tagtatgat 29

<210> 13

<211> 26

<212> DNA

<213> Artificial sequence

<400> 13

cggaattcat gtctaaggac agggtg 26

<210> 14

<211> 28

<212> DNA

<213> Artificial sequence

<400> 14

cgggatcctc aagaaaatag cggcaaag 28

<210> 15

<211> 36

<212> DNA

<213> Artificial sequence

<400> 15

acgagatgta agagcacaat ggcgattcta gggctt 36

<210> 16

<211> 36

<212> DNA

<213> Arabidopsis thaliana

<400> 16

atcgaattcc tgcagccctc attgtttccc tagtat 36

<210> 17

<211> 36

<212> DNA

<213> Artificial sequence

<400> 17

ttcgatatgg gatcccccat gttgttaaga tctaga 36

<210> 18

<211> 18

<212> DNA

<213> Artificial sequence

<400> 18

tgtgctctta catctcgt 18

<210> 19

<211> 25

<212> DNA

<213> Artificial sequence

<400> 19

ttgcggccgc gatccgggtg ttcgg 25

<210> 20

<211> 27

<212> DNA

<213> Artificial sequence

<400> 20

cgcggatccc atatcgaacg atatctt 27

<210> 21

<211> 28

<212> DNA

<213> Artificial sequence

<400> 21

gacgtcgaca atacttcccc gctatttg 28

<210> 22

<211> 26

<212> DNA

<213> Artificial sequence

<400> 22

cgctcgaggc tattggcaga aggatt 26

<210> 23

<211> 32

<212> DNA

<213> Artificial sequence

<400> 23

ccgcggccgc atggttacaa atatggtgaa at 32

<210> 24

<211> 30

<212> DNA

<213> Artificial sequence

<400> 24

ggctcgagtt aaactttata ggcaaaaatc 30

<210> 25

<211> 49

<212> DNA

<213> Artificial sequence

<400> 25

ggggacaagt ttgtacaaaa aagcaggctt caacagttgg ttcgatcct 49

<210> 26

<211> 48

<212> DNA

<213> Artificial sequence

<400> 26

ggggaccact ttgtacaaga aagctgggtt tcttgaacct ggttcagc 48

Claims

The application of the coding gene of the DMQ benzene ring 6-position hydroxylase in generating coenzyme Q in plants, bacteria, fungi and algae is characterized in that the amino acid sequence of the DMQ benzene ring 6-position hydroxylase is shown in GenBank accession numbers NP-173844.2, XP-015620261.1, XP-004239375.1, PTQ40024.1, PRW56607.1, XP-003079408.2, XP-012203255.1 and CDW 87725.1.
2. The use according to claim 1, wherein the gene encoding DMQ benzene ring 6 hydroxylase has a nucleotide sequence as shown in SEQ ID No.1 or a degenerate sequence thereof.
3. The use according to any one of claims 1 to 2, wherein coenzyme Q is produced by fermentation using a microorganism into which a gene encoding the benzene ring 6 hydroxylase of DMQ is introduced and expressed.
4. Use according to claim 3, wherein the microorganism is Escherichia coli or yeast.
The application of the DMQ benzene ring 6-position hydroxylase in the generation of coenzyme Q is characterized in that the amino acid sequence of the DMQ benzene ring 6-position hydroxylase is shown in GenBank accession numbers NP-173844.2, XP-015620261.1, XP-004239375.1, PTQ40024.1, PRW56607.1, XP-003079408.2, XP-012203255.1 and CDW 87725.1.
6. The use of claim 5, wherein: the amino acid sequence of the DMQ benzene ring 6-position hydroxylase is shown as SEQ ID No. 2.