CN113136400B

CN113136400B - Construction method and application of CHO cell strain expressing foreign protein

Info

Publication number: CN113136400B
Application number: CN202010055178.1A
Authority: CN
Inventors: 田克恭; 谭菲菲; 张许科
Original assignee: Pulaike Biological Engineering Co Ltd
Current assignee: Pulaike Biological Engineering Co Ltd
Priority date: 2020-01-17
Filing date: 2020-01-17
Publication date: 2022-09-09
Anticipated expiration: 2040-01-17
Also published as: CN113136400A; CN115851831A

Abstract

The invention relates to a construction method and application of a CHO cell for efficiently expressing foreign protein, wherein the method comprises the following steps: adding a signal peptide sequence at the N end of an exogenous protein sequence; step (2) fusion-connecting the foreign protein added with the signal peptide sequence and Fc together to construct an expression plasmid; step (3) transfecting CHO cells with the expression plasmid constructed in the step (2); and (4) harvesting the foreign protein. The present invention also relates to a method for expressing a foreign protein using the constructed CHO cell, and a vaccine composition comprising the foreign protein.

Description

Construction method and application of CHO cell strain expressing foreign protein

Technical Field

The invention belongs to the field of cell lines and preparation methods thereof, and particularly relates to cells modified by introducing foreign genetic materials, and a construction method and application thereof.

Background

CHO cells were isolated from adult female hamster ovary and were epithelial adherent cells. The cell has immobility, can be passaged for more than hundred generations, and is a cell widely used in bioengineering at present. Compared with other expression systems, the expression system has the following advantages: (1) has accurate post-transcriptional modification function, and the expressed protein is closest to the natural protein of eukaryote in the aspects of molecular structure, physicochemical property and biological function; (2) the culture medium can not only grow in a wall-attached manner, but also be cultured in a suspension manner, and can bear higher shearing force and osmotic pressure; (3) has the high-efficiency amplification and expression capacity of the recombinant gene; (4) has the extracellular secretion function of the product, rarely secretes the endogenous protein of the product, and is convenient for separating and purifying downstream products.

However, how to improve the expression level of the foreign protein expressed by the CHO expression system is always the direction of research by scholars at home and abroad, most of the methods aim at improving the expression level of the foreign protein by specifically modifying specific foreign genes, are not suitable for high-efficiency expression of other foreign proteins, and when the CHO expression system is applied to other foreign proteins, the genes of other foreign proteins need to be modified again, so that the process is complicated. Therefore, a high-efficiency expression method which is suitable for different foreign proteins and is simple to operate is needed in practical production.

Disclosure of Invention

In order to solve the above problems, the present invention provides a CHO cell construction method for efficiently expressing a foreign protein, wherein the method comprises: adding a signal peptide sequence at the N end of an exogenous protein sequence; step (2), fusing and connecting the foreign protein sequence added with the signal peptide sequence and the Fc sequence together to construct an expression plasmid; step (3) transfecting CHO cells with the expression plasmid constructed in the step (2); and (4) harvesting the foreign protein.

In the step (4), a clone strain with higher yield is screened; and (3) evaluating the stability and the yield of the obtained clone strains so as to select the clone strains with better stability, good cell growth characteristics and higher protein yield for production.

The method of the invention can realize high-efficiency expression of the foreign protein, can obviously improve the expression quantity of the foreign protein compared with the conventional CHO expression, can be applied to high-efficiency expression of various foreign proteins, can be widely applied to various veterinary vaccine proteins, does not need to optimize the gene of the foreign protein, and has wide application range.

As an embodiment of the invention, in the CHO cell construction method of the invention, the signal peptide sequence in the step (1) is shown in SEQ ID No.1, SEQ ID No.2, SEQ ID. No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No. ID., SEQ ID No.13 or SEQ ID No. 14. The signal peptide shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID. No.11, SEQ ID No.12, SEQ ID No.13 or SEQ ID No.14 can be optionally applied to a CHO cell construction method for efficiently expressing a specific foreign protein, and is not limited to a specific signal peptide sequence used in each example.

As an embodiment of the invention, in the CHO cell construction method, the Fc sequence in the step (2) is shown in SEQ ID No.15 or SEQ ID No. 16. The Fc sequence shown in SEQ ID No.15 and the Fc sequence shown in SEQ ID No.16 can be optionally applied to a CHO cell construction method for efficiently expressing a specific foreign protein, and are not limited to the specific Fc sequences used in the respective examples.

In one embodiment of the present invention, in the CHO cell construction method according to the present invention, the foreign protein gene in the step (1) comprises African swine fever virus CD2v protein, avian adenovirus Penton protein, avian adenovirus Fiber-2 protein, avian egg-loss syndrome virus Penton protein, avian egg-loss syndrome virus tFiber protein, chicken infectious bursal disease virus VP2 protein, porcine circovirus type 3 Cap protein, porcine circovirus type 2 Cap protein, porcine pseudorabies virus gB protein, porcine pseudorabies virus gD protein, porcine parvovirus VP2 protein, swine fever virus E2 protein, bovine infectious rhinotracheitis virus gB protein, bovine infectious rhinotracheitis virus gD protein, foot-and-mouth disease virus VP0 protein, foot-and-mouth disease virus VP3 protein, foot-and-mouth disease virus VP1 protein, rabbit VP60 protein, Japanese schistosome GALE protein, Japanese schistosome Wnt5 protein.

The invention also relates to the CHO cell which is prepared/constructed by the method and can efficiently express the foreign protein.

The invention also relates to a method for efficiently expressing the foreign protein, wherein the method uses the CHO cell to express the foreign protein.

The invention also relates to application of the constructed CHO cell in preparation of foreign protein.

The invention also relates to application of the method for efficiently expressing the foreign protein in preparation of the foreign protein.

The invention also relates to a vaccine composition, which comprises the foreign protein prepared by the method and a pharmaceutically acceptable carrier. In particular, the vaccine composition is a subunit vaccine composition.

The foreign protein prepared by the preparation method has the advantages of biological safety, immunogenicity, immune efficacy and no adverse reaction on the growth and development of animals, and can be used for preparing subunit vaccines.

As one embodiment of the present invention, in the vaccine composition of the present invention, the carrier includes an adjuvant including: (1) mineral oil, alumina gel adjuvant, saponin, alfvudine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) a copolymer of a polymer of acrylic acid or methacrylic acid, maleic anhydride and an alkenyl derivative; and one or more of RIBI adjuvant system, Block copolymer (Block co-polymer), SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide, Montanide ISA 206, and Gel adjuvant; preferably, the saponin is Quil A, QS-21, GPI-0100.

The adjuvant content is 5% -70% V/V.

The adjuvant may be present in an amount selected from the group consisting of 5% V/V, 6% V/V, 7% V/V, 8% V/V, 9% V/V, 10% V/V, 15% V/V, 20% V/V, 25% V/V, 30% V/V, 35% V/V, 40% V/V, 45% V/V, 50% V/V, 55% V/V, 60% V/V, 65% V/V, 66% V/V, 67% V/V, and 70% V/V.

The invention also relates to a vaccine composition prepared from the prepared foreign protein, and a subunit vaccine composition is prepared by adding a pharmaceutically acceptable carrier into the foreign protein prepared by the method.

The vaccine compositions of the present invention may be formulated using available techniques, preferably together with a pharmaceutically acceptable carrier. For example, the oil may help stabilize the formulation and additionally serve as a vaccine adjuvant. The oil adjuvant can be naturalThe source can also be obtained by artificial synthesis. The term "adjuvant" refers to a substance added to the composition of the present invention to increase the immunogenicity of the composition. Known adjuvants include, but are not limited to: (1) aluminium hydroxide, saponin (saponin) (e.g. QuilA), alfuzidine, DDA, (2) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivatives, (3) vaccines can be made in the form of oil-in-water, water-in-oil or water-in-oil-in-water emulsions, or (4) Montanide ^TM Gel。

In particular, the emulsion may be based on light liquid paraffin oil, isoprenoid oil, such as squalane or squalene; oils resulting from the oligomerization of olefins, in particular isobutene or decene, esters of acids or alcohols with linear alkyl groups, more in particular vegetable oils, ethyl oleate, propylene glycol di (caprylate/caprate), glycerol tri (caprylate/caprate), propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used with an emulsifier to form an emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of polyoxyethylated fatty acids (e.g.oleic acid), sorbitan, mannitol (e.g.anhydromannitol oleate), glycerol, polyglycerol, propylene glycol and optionally ethoxylated oleic acid, isostearic acid, ricinoleic acid, hydroxystearic acid, ethers of fatty alcohols and polyols (e.g.oleyl alcohol), polyoxypropylene-polyoxyethylene block copolymers, in particular Pluronic R, in particular L121 (cf. Hunter et al, 1995, "The therapy and Practical applications of Adjuvants" (eds. D.E.S. ed.) John Wilandsons, NY, 51-94; Todd et al, Vaccine, 1997, 15, 564 570).

In particular, the acrylic or methacrylic acid polymers are crosslinked by polyalkenyl ethers of sugars or polyols. These compounds are known as carbomers.

The amount of adjuvant suitable for use in the compositions of the invention is preferably an effective amount. By "effective amount" is meant the amount of adjuvant necessary or sufficient to exert their immunological effect in a host when administered in combination with the antigen of the invention without causing undue side effects. The precise amount of adjuvant to be administered will vary depending on factors such as the ingredients used and the type of disease being treated, the type and age of the animal being treated, the mode of administration, and the other ingredients in the composition.

The subunit vaccine compositions of the invention may further comprise other agents added to the compositions of the invention. For example, the compositions of the present invention may also comprise agents such as: drugs, immunostimulants (e.g., alpha-interferon, beta-interferon, gamma-interferon, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), and interleukin 2(IL2)), antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants, and preservatives. To prepare such compositions, methods well known in the art may be used.

The vaccine composition, in particular the subunit vaccine composition, according to the invention may be in an oral or non-oral dosage form.

Preferred are non-oral dosage forms that can be administered by intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, or epidural routes.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and substitutions are intended to be within the scope of the invention.

The chemical reagents used in the examples of the invention are analytically pure and purchased from the national pharmaceutical group.

In order that the invention may be more readily understood, reference will now be made to the following examples. The experimental methods are conventional methods unless specified otherwise; the biomaterial is commercially available unless otherwise specified.

Example 1 construction method of CHO cell line that highly expresses African Swine fever Virus CD2v protein

Synthesis of CD2v protein Gene sequence

The sequence of the CD2v protein gene shown in SEQ ID No.17 is synthesized, and a signal peptide sequence shown in SEQ ID No.1 is added at the N end of the CD2v sequence.

Construction of expression vector for CD2v fusion Fc

Design of primers to join CD2v added with a signal peptide sequence shown in SEQ ID No.1 and Fc gene shown in SEQ ID No.15 together by fusion, firstly, CD2v gene is amplified by primers SF1(5 'GCTCTAGAGCCACCATGGACTGGACCTGGAGGATCC 3')/SR 1(5 'GTAGGTCCCCTTGGCTCGTACAGTTTGAAGAAAG 3'), then Fc is amplified by primers SF2(5 'CTTTCTTCAAACTGTACGAGCCAAGGGGACCTAC 3')/SR 2(5 'GCAAGCTTTTACTTGCCGGGTGTCCTAGAAAAGG 3'), and then the amplification of fusion product CD2v-mFc is carried out by using the former two rounds of PCR products as templates and using primers SF1/SR 2. The amplified product is cut by EcoRI and Xho I and then connected with a pCAGGS vector, the connection product is identified by sequencing, and a plasmid with correct sequence is named as pCAGGS-CD2 v-Fc.

3. Transfection of CHO-S cells for Stable protein expression

After transformation of the correctly sequenced plasmid pCAGGS-CD2v-Fc, the plasmid was extracted using an endotoxin-free plasmid extraction kit and the plasmid concentration was determined to be at least 1. mu.g/. mu.l. The extracted plasmid was linearized using an NruI endonuclease.

The cell viability rate during transfection is higher than 95%, according to 1X 10 ⁶ The density of viable cells/ml was inoculated into 125ml culture flasks and supplemented with CD FortiCHO complete medium to 30 ml. Add 50. mu.g of linearized plasmid to OptiPRO SFM medium to a final volume of 1.5ml and mix gently. Mu.l FreeStyle MAX transfection reagent was added to 1.45ml OptiPRO SFM to a final volume of 1.5ml and gently mixed. Immediately add the diluted FreeStyle MAX reagent solution to the plasmid DNA dilution solution, mix well, incubate the mixture at room temperature for 10 minutes to form DNA-lipid complexes, add 3ml OptiPRO SFM medium containing transfection reagent drop by drop to 125ml culture flasks containing cells. The transfected cell cultures were placed at 37 ℃ with 8% CO ₂ Was incubated on a shaker at 130 rpm. After 48 hours, drug screening was initiated.

The cells were centrifuged and resuspended, two T-150 flasks were inoculated at a density of 5X 10 ⁵ Viable cells/ml. In the 1 st T-150 flask, puromycin was added to a final concentration of 10. mu.g/ml, and MTX (methotrexate) was added to 100 nmol/L. In the 2 nd T-150 flask, puromycin was added to a final concentration of 20. mu.g/ml and MTX to 200nmol/L was added. Then the T-flask was placed at 37 ℃ with 5% CO ₂ And (4) incubating in a static incubator. After the cells showed signs of resuscitation, the cells were transferred to 125ml shake flasks at a seeding density of 3X 10 ⁵ Individual viable cells/ml. The cells were incubated at 37 ℃ with 8% CO ₂ Was incubated on a shaker at 130 rpm. Cells in flasks were passaged every 3-4 days at a seeding density of 3X 10 for each passage ⁵ Viable cells/ml. When the cell survival rate exceeds 85%, the viable cell density exceeds 1 × 10 ⁶ At individual viable cells/ml, drug screening stage 1 is complete.

Each cell pool of screening stage 1 was inoculated with 2 new 125ml shake flasks at a density of 4X 10 ⁵ Viable cells/ml. In the 1 st flask puromycin was added to a final concentration of 30. mu.g/ml and MTX to 500nmol/L was added. In the 2 nd flask puromycin was added to a final concentration of 50. mu.g/ml and MTX to 1000nmol/L was added. The cells were placed at 37 ℃ with 8% CO ₂ Was incubated on a shaking table at 130 rpm. Sampling and counting every 3-4 days, and inoculating the cells in the subculture bottle every 3-4 days at the inoculation density of 3X 10 when the cells show resuscitation signs ⁵ Individual viable cells/ml. When the cell viability reached 90%, the stage 2 screening was completed.

Recovering the cells of each cell pool obtained in the 2 nd stage until the cell viability rate is more than 90%, according to the 3 × 10 ⁵ Viable cells/ml were inoculated into 125ml shake flasks containing 30ml fresh medium, and the cells were placed at 37 ℃ with 8% CO ₂ The incubation was performed on a shaker at a rotation speed of 130 rpm. Samples were taken periodically (days 0, 3, 5, 7, 10, 12, 14) until the culture viability dropped below 50%. Glucose was added to the culture after sampling: on days 3, 5 and 7, 4g/L and 6g/L of glucose were added, respectively. Identification of different cell pools by dot Blot and Western BlotThe 5 cell pools with higher expression levels were selected for limiting dilution in the next step.

Cells of 5 cell pools selected in the above steps are recovered in a selective culture medium without puromycin and MTX, and limited dilution is carried out when the cell viability reaches more than 90% after 2-5 days. A cloning medium (CD FortCHO medium supplemented with 6mM L-glutamine) containing 5% to 8% CO at 37 ℃ is used ₂ The static incubator is used for static incubation culture. After three times of screening, 15 clones with higher yield are selected for stability evaluation in the next step.

Resuscitating 15 clones in high yield into 125ml shake flasks with 8% CO at 37 ℃ ₂ The shaking table at 130rpm was incubated. Subculturing 1 time every 3 days, and inoculating density of 1.5 × 10 ⁵ Individual viable cells/ml. Yield of the tracing clone: after subculturing in new flasks, the cells in the old flask were still fed, 5g/L glucose was added, the flask was incubated until day 7, and then sampled for protein production. And continuously carrying out passage and carrying out yield evaluation on the 7 th day, continuously transmitting to 30 generations, and selecting a clone strain with good stability, good cell growth characteristics and high protein yield for production.

Example 2 preparation of African swine fever virus CD2v protein

The CHO cell line selected in example 1 was inoculated into a bioreactor containing Dynamis medium at a density of 3X 10 ⁵ Viable cells/ml. The parameters are set to be pH7.1-7.2, dissolved oxygen is 40%, the temperature is 37 ℃, and the stirring speed is 130 rpm. Samples were taken daily from day 3, glucose and lactate concentrations were measured, and cell counts were made. When the glucose level was below 2g/L, glucose was fed to 6 g/L.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. When the cell viability is reduced to about 80%, the cell culture is harvested, and the supernatant obtained by centrifugation is subjected to Western Blot to confirm that the target protein African swine fever virus CD2v protein is expressed. Protein quantification is carried out according to a BCA protein concentration determination kit method of Biyuntian, and the protein content is 0.5 g/L. The CD2v gene without the addition of the signal peptide sequence and Fc sequence was not expressed in CHO cells.

Example 3 preparation of porcine pseudorabies Virus gD protein subunit vaccine

With reference to the method of example 1, a CHO cell line expressing porcine pseudorabies virus gD protein with high efficiency was constructed, and the gene sequence of the porcine pseudorabies virus gD protein is shown in SEQ.ID NO 18. Wherein a signal peptide sequence shown in SEQ ID No.2 is added at the N end of the gD sequence; designing a primer to connect gD added with a signal peptide sequence shown in SEQ ID No.2 and an Fc gene shown in SEQ ID No.15 together through fusion.

Inoculating the selected CHO cell strain into a bioreactor containing Dynamis culture medium at a density of 3 × 10 ⁵ Viable cells/ml. The pH value is 7.1-7.2, the dissolved oxygen content is 40%, the temperature is 37 ℃, and the stirring speed is 130 rpm. Samples were taken daily from day 3, glucose and lactate concentrations were measured, and cell counts were performed. When the glucose level was below 2g/L, glucose was fed to 6 g/L.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. And culturing until the cell viability is reduced to about 80%, harvesting cell culture, and centrifuging the obtained supernatant to perform Western Blot to confirm that the target protein, namely the porcine pseudorabies virus gD protein is expressed. The content of the target protein is higher, and the content of gD protein is 3 g/L.

And (3) uniformly mixing the porcine pseudorabies virus gD protein expressed by the CHO cell strain with the 206 adjuvant according to a proportion, stirring for 15 minutes at the temperature of 30 ℃ at a speed of 120 r/min, and storing at the temperature of 4 ℃ to obtain the porcine pseudorabies virus gD protein subunit vaccine composition. The specific ratio is shown in table 1.

TABLE 1 porcine pseudorabies virus gD protein subunit vaccine ratio

Components	Vaccine 1	Vaccine 2
			gD protein (μ g/ml)	20	100
206 adjuvant (V/V%)	46	46

Example 4 porcine pseudorabies Virus gD protein subunit vaccine immunogenicity assay

12 piglets with 21-day-old PRV antigen-antibody negative are randomly divided into 3 groups and 4 piglets per group, wherein the 1 st group and the 2 nd group are respectively injected with the vaccine 1 and the vaccine 2 prepared in the example 3 through muscle, the immune dose is 2ml per head, and the 3 rd group control group is injected with 2ml per head of DMEM culture medium. 28 days after immunization, the virus liquid of porcine Pseudorabies virus HN1201 strain (porcine Pseudorabies virus HN1201 strain, with the preservation number of CCTCC NO. V201311, the preservation unit of China center for type culture Collection, the preservation address of Wuhan university in Wuhan, China, the preservation date of 2013, 5 months and 20 days, disclosed in China patent application CN104004774A) is attacked by intramuscular injection with the dosage of 2 multiplied by 10 ^8.0 TCID ₅₀ First, the body temperature of piglets is measured every day after the challenge, and clinical symptoms and death are observed. The results are shown in Table 2.

TABLE 2 porcine pseudorabies virus gD protein subunit vaccine immunogenicity test results

Group of	Clinical symptoms and death	Rate of protection
			1	The body temperature is raised for 1-2 days, the appetite is normal, the mental symptoms are basically absent, and the survival is realized	100％(4/4)
2	The body temperature is raised for 1-2 days, the appetite is normal, the mental symptoms are basically absent, and the health food survives	100％(4/4)
			3	Has obvious symptoms, 2 deaths after 2 days and all deaths after 3 days	0％(0/4)

The result shows that the porcine pseudorabies virus gD protein subunit vaccine can provide 100 percent (4/4) protection for the piglets after being immunized by the piglets, and the control piglets all die 4 days after being attacked by the virus, thereby showing good immune protection.

EXAMPLE 5 preparation of avian adenovirus Fiber-2 protein subunit vaccine

By referring to the method of example 1, a CHO cell strain capable of efficiently expressing avian adenovirus Fiber-2 protein is constructed, and the gene sequence of avian adenovirus Fiber-2 is shown in SEQ. ID NO 19. Wherein a signal peptide sequence shown in SEQ ID No.3 is added at the N end of the Fiber-2 sequence; primers were designed to join Fiber-2 to which a signal peptide sequence shown in SEQ ID No.3 was added and the Fc gene shown in SEQ ID No.15 by fusion.

Inoculating the CHO cell strain to a bioreactor containing Dynamis culture medium at a density of 3 × 10 ⁵ Individual viable cells/ml. Setting the parameters of pH7.1-7.2, dissolved oxygen content of 40% and temperatureAt 37 ℃ and a stirring speed of 130 rpm. Samples were taken daily from day 3, glucose and lactate concentrations were measured, and cell counts were performed. When the glucose level was below 2g/L, glucose was fed to 6 g/L.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. When the cell viability is reduced to about 80 percent, harvesting cell culture, and carrying out Western Blot on supernatant obtained by centrifugation to confirm that the target protein, namely the avian adenovirus Fiber-2 protein, is expressed. The content of target protein is high, and the AGP titer of the Fiber-2 protein reaches 1: 128.

Mixing the fowl adenovirus Fiber-2 protein expressed by CHO cell strain and mineral oil adjuvant at a certain proportion, and adding 1% thimerosal solution before stopping stirring to make its final concentration be 0.01%. The specific ratio is shown in Table 3.

TABLE 3 avian adenovirus Fiber-2 protein subunit vaccine ratios

Components	Vaccine 3	Vaccine 4
			Fiber-2 protein (AGP potency)	1:4	1:32
Mineral oil adjuvant (V/V%)	66％	66％

EXAMPLE 6 avian adenovirus Fiber-2 protein subunit vaccine immunogenicity assay

30 SPF chickens of 21 days old are divided into 3 groups, each group comprises 10 SPF chickens, the 4 th group to the 5 th group are respectively injected with the vaccine 3 and the vaccine 4 prepared in the immunization example 5 through the neck part subcutaneously, the immunization dose is 0.3ml, and the 6 th group is injected with 0.3ml of physiological saline subcutaneously to serve as a challenge control. All test chickens were kept separately, and 21 days after immunization, virus liquid was attacked by intramuscular injection with FAV-HN strain (fowladenovirus, FAV-HN strain (bird adenovirus, strain FAV-HN) with a preservation number of CCTCC NO. V201609, a preservation unit of China center for type culture Collection, a preservation address of university of Wuhan, China, a preservation time of 2016, 2 months and 29 days, disclosed in Chinese patent application CN107523556A), and observed for 14 days, and the number of diseases, deaths and protections was recorded. The results are shown in Table 4.

TABLE 4 results of the immunogenicity test of the avian adenovirus Fiber-2 protein subunit vaccine

The results show that the 6 th group of the challenge control group is completely killed, and the 4 th to 5 th groups of the immunization groups generate better immune protection to the immunized chickens, so that the immunization effect is good. The result shows that the avian adenovirus Fiber-2 protein subunit vaccine prepared by the method can provide effective immune protection for chicken flocks.

Example 7 preparation of an avian egg drop syndrome Virus tFiber protein subunit vaccine

By referring to the method of example 1, a CHO cell strain capable of efficiently expressing the tFiber protein of the avian egg-dropping syndrome virus is constructed, and the gene sequence of the tFiber protein of the avian egg-dropping syndrome virus is shown in SEQ.ID NO 20. Wherein a signal peptide sequence shown in SEQ ID No.4 is added at the N end of the tFiber sequence; primers were designed to join the tFiber to which the signal peptide sequence shown in SEQ id No.4 was added to the Fc gene shown in SEQ id No.15 by fusion.

Inoculating the selected CHO cell strain into a bioreactor containing Dynamis culture medium at a density of 3 × 10 ⁵ Viable cells/ml. Setting the pH value to be 7.1-7.2, the dissolved oxygen content to be 40 percent, the temperature to be 37 ℃,the stirring speed was 130 rpm. Samples were taken daily from day 3, glucose and lactate concentrations were measured, and cell counts were performed. When the glucose level was below 2g/L, glucose was fed to 6 g/L.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. And culturing until the cell viability rate is reduced to about 80%, harvesting the cell culture, and performing Western Blot on the supernatant obtained by centrifugation to confirm that the target protein, namely the poultry egg-loss syndrome virus tFiber protein is expressed. The content of the target protein is higher, and the AGP titer of the tFiber protein reaches 1: 512.

Mixing the avian egg drop syndrome virus tFiber protein expressed by the CHO cell strain and the mineral oil adjuvant uniformly according to a proportion, and adding 1% of thimerosal solution before stopping stirring to ensure that the final concentration is 0.01%. The specific ratio is shown in Table 5.

TABLE 5 avian egg drop syndrome Virus Fiber protein subunit vaccine ratios

Components	Vaccine 5	Vaccine 6
			tFiber protein (AGP potency)	1:8	1:64
Mineral oil adjuvant (V/V%)	66％	66％

Example 8 avian egg drop syndrome Virus tFiber protein subunit vaccine immunogenicity assay

30 SPF chickens of 21 days old were divided into 3 groups of 10 chickens, and the vaccine 5 and the vaccine 6 prepared in immunization example 7 were injected subcutaneously into the neck of 7 th to 8 th groups, respectively, and the immunization dose was 0.5ml, and the 9 th group was injected subcutaneously with 0.5ml of physiological saline as a blank control. All test chickens were kept separately, and 21 days after immunization, each chicken was bled separately, serum was separated, and serum HI antibody titer of avian egg drop syndrome was determined. The results are shown in Table 6.

TABLE 6 avian egg drop syndrome Virus tFiber protein subunit vaccine immunogenicity test results

The results show that the HI antibody titer of the control group 9 at 21 days after immunization is 0, and the HI antibody titers of the immunization groups 7 to 8 are high and the immunization effect is good. The result shows that the avian egg drop syndrome virus tFiber protein subunit vaccine prepared by the method can provide effective immune protection for chicken flocks.

EXAMPLE 9 preparation of infectious bursal disease Virus VP2 protein

Referring to the method of example 1, a CHO cell strain capable of efficiently expressing the protein of the chicken infectious bursal disease virus VP2 was constructed, and the gene sequence of the chicken infectious bursal disease virus VP2 was disclosed in the Chinese patent application CN 103849631A. Wherein a signal peptide sequence shown in SEQ ID No.5 is added at the N end of the VP2 sequence; design primer through fusion will add the signal peptide sequence of SEQ ID No.5 VP2 and SEQ ID No.15 Fc gene connected together.

Inoculating the selected CHO cell strain into a bioreactor containing Dynamis culture medium at a density of 3 × 10 ⁵ Viable cells/ml. The pH value is 7.1-7.2, the dissolved oxygen content is 40%, the temperature is 37 ℃, and the stirring speed is 130 rpm. Samples were taken daily from day 3, glucose and lactate concentrations were measured, and cell counts were made. When the glucose level was below 2g/L, glucose was fed to 6 g/L.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. Culturing until the cell viability is reduced to about 80%, harvesting cell culture, centrifuging to obtain supernatant, and performing Western Blot to confirm that the target protein, namely the chicken infectious bursal disease virus VP2 protein, is expressed. The content of the target protein is high, and the AGP titer of the VP2 protein reaches 1: 128.

Example 10 preparation of Leporis Virus VP60 protein

By referring to the method of example 1, a CHO cell strain capable of efficiently expressing the protein of the Lepidoptera virus VP60 is constructed, and the gene sequence of the Lepidoptera virus VP60 is shown in SEQ.ID NO 21. Wherein a signal peptide sequence shown in SEQ ID No.6 is added at the N end of the VP60 sequence; design primer through fusion will add the signal peptide sequence of SEQ ID No.6 VP60 and SEQ ID No.16 Fc gene connected together.

Inoculating the selected CHO cell strain into a bioreactor containing Dynamis culture medium at a density of 3 × 10 ⁵ Viable cells/ml. The parameters are set to be pH7.1-7.2, dissolved oxygen is 40%, the temperature is 37 ℃, and the stirring speed is 130 rpm. Samples were taken daily from day 3, glucose and lactate concentrations were measured, and cell counts were performed. When the glucose level was below 2g/L, glucose was fed to 6 g/L.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. When the cell viability is reduced to about 80%, the cell culture is harvested, and the supernatant obtained by centrifugation is subjected to Western Blot to confirm that the target protein Lepidoptera syndrome VP60 protein is expressed. The content of target protein is high, and the HA titer of the VP60 protein reaches 16log 2.

Example 11 preparation of porcine circovirus type 3 Cap protein subunit vaccine

By referring to the method of example 1, a CHO cell strain capable of efficiently expressing the porcine circovirus type 3 Cap protein is constructed, and the porcine circovirus type 3 Cap gene sequence is shown in SEQ.ID NO 22. Wherein a signal peptide sequence shown in SEQ ID No.7 is added at the N end of the Cap sequence; designing a primer to connect Cap added with a signal peptide sequence shown in SEQ ID No.7 and Fc gene shown in SEQ ID No.15 together through fusion.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. And (3) culturing until the cell viability is reduced to about 80%, harvesting cell culture, and carrying out Western Blot on supernatant obtained by centrifugation to confirm that the target protein porcine circovirus type 3 Cap protein is expressed. The content of the target protein is high and is 0.5 g/L.

And (2) uniformly mixing the porcine circovirus type 3 Cap protein expressed by the CHO cell strain with a water-soluble adjuvant Gel adjuvant (Saybox francisco) in proportion to obtain the porcine circovirus type 3 Cap protein subunit vaccine composition. The specific ratio is shown in Table 7.

TABLE 7 porcine circovirus type 3 Cap protein subunit vaccine ratios

Components	Vaccine 7	Vaccine 8
			Cap protein (μ g/ml)	25	100
Gel adjuvant (V/V%)	10％	10％

Example 12 porcine circovirus type 3 Cap protein subunit vaccine immunogenicity assay

15 healthy piglets which are 28-30 days old and have PCV2 and PCV3 antigen detected by ELISA and have negative antibodies are randomly divided into 3 groups and 5 groups, and the subunit vaccine of the porcine circovirus type 3 Cap protein prepared in the immunization example 11 is immunized. The 10 th to 11 th groups are immune vaccines 7 to 8 respectively, and the 12 th group is immune and serves as a challenge control group. Each immunization group was injected with 2 ml/head of vaccine, and the control group was inoculated with 2 ml/head of physiological saline. The piglet is subjected to virus challenge 28 days after immunization, the virus challenge dose is SG strain Porcine Circovirus (Porcine Circovirus type 3 SG strain), the Porcine Circovirus type 3 SG strain is preserved in China center for type culture Collection with the preservation number of CCTCC NO. V201712, the preservation date is 3/23 days in 2017, the preservation address is university of Wuhan and Wuhan, China published in China patent application CN108660115A)105.0TCID 50/head, after virus challenge, each piglet is continuously observed, and judgment is carried out according to clinical symptoms, pathological changes and virus detection results of each piglet, and specific results are shown in Table 8.

TABLE 8 porcine circovirus type 3 Cap protein subunit vaccine immunogenicity test results

The result shows that the porcine circovirus type 3 Cap protein subunit vaccine can provide 100 percent (5/5) protection for the piglets after being immunized by the piglets, and the control piglets are all attacked after being attacked by the virus. The porcine circovirus type 3 Cap protein subunit vaccine prepared by the method can provide effective immune protection for swinery.

Example 13 preparation of porcine circovirus type 2 Cap protein

Referring to the method of example 1, a CHO cell line expressing the protein of the porcine circovirus type 2 Cap was constructed, and the sequence of the porcine circovirus type 2 Cap gene is disclosed in Chinese patent application CN 101920012A. Wherein a signal peptide sequence shown in SEQ ID No.8 is added at the N end of the Cap sequence; designing a primer, and connecting the Cap added with the signal peptide sequence shown in SEQ ID No.8 and the Fc gene shown in SEQ ID No.15 together through fusion.

Inoculating the CHO cell strain to a bioreactor containing Dynamis culture medium at a density of 3 × 10 ⁵ Individual viable cells/ml. The pH value is 7.1-7.2, the dissolved oxygen content is 40%, the temperature is 37 ℃, and the stirring speed is 130 rpm. Samples were taken daily from day 3, glucose and lactate concentrations were measured, and cell counts were performed. When the glucose level was below 2g/L, glucose was fed to 6 g/L.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. And (3) culturing until the cell viability is reduced to about 80%, harvesting cell culture, and carrying out Western Blot on supernatant obtained by centrifugation to confirm that the target protein porcine circovirus type 2 Cap protein is expressed. The content of the target protein is high and is 0.6 g/L.

Example 14 preparation of porcine parvovirus VP2 protein

Referring to the method of example 1, a CHO cell strain capable of efficiently expressing the protein of porcine parvovirus VP2 was constructed, and the sequence of the porcine parvovirus VP2 gene was disclosed in Chinese patent application CN 103908664A. Wherein a signal peptide sequence shown in SEQ ID No.9 is added at the N end of the VP2 sequence; design primer through fusion will add the signal peptide sequence of SEQ ID No.9 VP2 and SEQ ID No.15 Fc gene connected together.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. When the cell viability is reduced to about 80%, the cell culture is harvested, and the supernatant obtained by centrifugation is subjected to Western Blot to confirm that the target protein porcine parvovirus VP2 protein is expressed. The content of the target protein is high and is 2.2 g/L.

Example 15 preparation of classical swine fever Virus E2 protein

Referring to the method of example 1, a CHO cell line for efficiently expressing the hog cholera virus E2 protein was constructed, and the sequence of the hog cholera virus E2 gene was disclosed in chinese patent application CN 105527442A. Wherein a signal peptide sequence shown in SEQ ID No.10 is added at the N end of the E2 sequence; primers were designed to join E2 to which a signal peptide sequence shown in SEQ ID No.10 was added and the Fc gene shown in SEQ ID No.15 by fusion.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. When the cell viability is reduced to about 80%, the cell culture is harvested, and the supernatant obtained by centrifugation is subjected to Western Blot to confirm that the target protein classical swine fever virus E2 protein is expressed. The content of the target protein is high and is 2.7 g/L.

Example 16 preparation of Schistosoma japonicum GALE protein

Referring to the method of example 1, a CHO cell strain expressing the GALE protein of Schistosoma japonicum was constructed, and the GALE gene sequence of Schistosoma japonicum was disclosed in the Chinese patent application CN 102079783A. Wherein a signal peptide sequence shown in SEQ ID No.14 is added at the N end of the GALE sequence; primers were designed to join GALE to which a signal peptide sequence shown in SEQ ID No.14 was added and the Fc gene shown in SEQ ID No.16 by fusion. In this example, the signal peptide sequence shown in SEQ ID No.14 was used, but any of the other signal peptide sequences shown in SEQ ID No.1-13 may be used. This also applies to the other embodiments. The Fc gene sequences shown in SEQ ID No.15 and SEQ ID No.16 can also optionally be used in the various embodiments.

Inoculating the CHO cell strain to a bioreactor containing Dynamis culture medium at a density of 3 × 10 ⁵ Viable cells/ml. The pH value is 7.1-7.2, the dissolved oxygen content is 40%, the temperature is 37 ℃, and the stirring speed is 130 rpm. Samples were taken daily from day 3, glucose and lactate concentrations were measured, and cell counts were performed. When the glucose level was below 2g/L, glucose was fed to 6 g/L.

Meanwhile, 1 XCD efficiency C + AGT additive is added on the 3 rd day, the 5 th day, the 7 th day and the 10 th day after inoculation, and the adding amount is 10 percent of the volume of the culture solution each time. Culturing until the cell viability is reduced to about 80%, harvesting cell culture, centrifuging to obtain supernatant, and performing Western Blot to confirm that the target protein schistosoma japonicum GALE protein is expressed. The content of the target protein is higher and is 1.2 g/L.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> Proteco bioengineering GmbH

<120> construction method and application of CHO cell strain for efficiently expressing foreign protein

<130> 19NAP0369C

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 57

<212> DNA

<213> Artificial Synthesis

<400> 1

atggactgga cctggaggat cctcttcttg gtggcggccg ccacaggcgc gcactcc 57

<210> 2

<211> 75

<212> DNA

<213> Artificial Synthesis

<400> 2

atgggcgtgc tgctgaccca gaggaccctg ctgtccctgg tgctggccct gctgttcccc 60

tccatggcct ccatg 75

<210> 3

<211> 48

<212> DNA

<213> Artificial Synthesis

<400> 3

atgaagtgcc tgctgtacct ggccttcctg ttcatcggcg tgaactgc 48

<210> 4

<211> 63

<212> DNA

<213> Artificial Synthesis

<400> 4

atggagaccg acaccctgct gctgtgggtg ctgctgctgt gggtgcctgg ctccacaggc 60

gac 63

<210> 5

<211> 57

<212> DNA

<213> Artificial Synthesis

<400> 5

atgggctggt cctgcatcat cctgttcctg gtggctaccg ctaccggcgt gcactcc 57

<210> 6

<211> 51

<212> DNA

<213> Artificial Synthesis

<400> 6

atgagggcct ggatcttctt cctgctgtgt ctggctggca gggctctggc c 51

<210> 7

<211> 54

<212> DNA

<213> Artificial Synthesis

<400> 7

atggccttcc tgtggctgct gtcctgttgg gccctgctgg gcaccacctt cggc 54

<210> 8

<211> 45

<212> DNA

<213> Artificial Synthesis

<400> 8

atgaacctgc tgctgatcct gacctttgtg gccgccgccg tggcc 45

<210> 9

<211> 51

<212> DNA

<213> Artificial Synthesis

<400> 9

atgggcgtga aggtgctgtt cgccctgatc tgcatcgctg tggccgaggc c 51

<210> 10

<211> 48

<212> DNA

<213> Artificial sequence

<400> 10

atgaagtggg tgaccttcat ctccctgctg ttctcctccg cctactcc 48

<210> 11

<211> 72

<212> DNA

<213> Artificial sequence

<400> 11

atggccctgt ggatgaggct gctgcctctg ctggctctgc tggctctgtg gggacctgat 60

cctgccgctg cc 72

<210> 12

<211> 48

<212> DNA

<213> Artificial sequence

<400> 12

atgaagccca tcttcctggt gctgctggtg gtgacctccg cctacgcc 48

<210> 13

<211> 48

<212> DNA

<213> Artificial sequence

<400> 13

atgaagacca tcatcgccct gtcctacatc ttctgcctgg tgctgggc 48

<210> 14

<211> 60

<212> DNA

<213> Artificial Synthesis

<400> 14

atgtacagga tgcagctgct gtcctgcatc gccctgtccc tggccctggt gaccaactcc 60

<210> 15

<211> 702

<212> DNA

<213> Artificial Synthesis

<400> 15

gagccaaggg gacctacaat caagccttgc ccaccatgca agtgcccagc tcctaatctg 60

ctgggcggac catccgtgtt catcttccca cctaaaatca aagatgtgct catgatctcc 120

ctctccccta tcgtgacttg cgtggtggtg gatgtgagcg aggacgaccc agatgtccag 180

atcagctggt tcgtgaacaa cgtggaggtg catactgctc agacacagac tcatagggag 240

gactacaaca gcacactgag agtcgtgtcc gctctgccaa tccagcatca agattggatg 300

agcggcaagg agtttaagtg caaggtcaac aacaaggatc tgccagcccc tatcgagagg 360

acaatcagca agccaaaagg cagcgtgagg gctcctcaag tgtacgtgct ccctcctcca 420

gaggaggaga tgactaaaaa gcaagtgact ctcacttgca tggtgacaga cttcatgcca 480

gaggacatct acgtggagtg gactaacaac ggcaagactg aactgaatta caaaaacaca 540

gagccagtgc tggactccga cggaagctac ttcatgtaca gcaagctgag ggtcgagaag 600

aagaactggg tcgagaggaa ttcctacagc tgttccgtgg tgcacgaagg actgcacaac 660

caccacacta ctaagtcctt ttctaggaca cccggcaagt aa 702

<210> 16

<211> 357

<212> DNA

<213> Artificial Synthesis

<400> 16

cctatcacaa ggacaatcag caaggctatc ggccagagca gagagccaca agtctacact 60

ctcccaccac cagctgagga gctgtctagg agcaaggtca cagtgacttg tctcgtgatc 120

ggcttctacc ctccagacat ccacgtcgag tggaaaagca atggacagcc agagccagag 180

ggcaactata ggactacacc accacagcaa gatgtggacg gcacattctt cctctactcc 240

aagctcgccg tcgataaggc taggtgggat cacggcgaga ctttcgaatg cgccgtcatg 300

cacgaagccc tccacaacca ctacactcag aagtccatca gcaagactca aggcaaa 357

<210> 17

<211> 573

<212> DNA

<213> African swine fever virus

<400> 17

atcgattatt gggtgagctt taacaagact atcattctgg acagcaatat tactaacgac 60

aataacgaca tcaacggcgt gagctggaac ttctttaaca acagcttcaa tactctcgcc 120

acatgtggca aggccggcaa cttctgcgag tgtagcaact atagcacaag catctacaac 180

attactaaca actgctctct gactatcttc ccacataacg acgtcttcga cactacatac 240

caagtggtct ggaatcagat cattaactac acaatcaaac tgctgactcc agccactcca 300

cctaacatca catacaactg cacaaatttt ctgattactt gtaaaaaaaa taatggcaca 360

aatacaaata tctatctgaa catcaacgat acattcgtca agtacacaaa cgagtccatt 420

ctggagtaca actggaacaa ctccaacatc aataatttca ctgccacttg catcattaat 480

aacacaatct ccactagcaa tgagactaca ctgatcaact gcacatatct gactctgagc 540

tccaactact tttatacttt cttcaaactg tac 573

<210> 18

<211> 1029

<212> DNA

<213> Pseudorabies virus

<400> 18

gctgatgtgg atgccgtgcc cgctcccacc tttcctcctc ctgcctaccc ctacaccgag 60

agctggcagc tgacactgac cacagtgcct tcccccttcg tgggccctgc cgatgtgtac 120

cacaccaggc ccctggagga tccttgcgga gtggtggctc tcatcagcga ccctcaggtc 180

gacaggctgc tgaacgaggc tgtggcccac aggaggccta catacagggc ccacgtggcc 240

tggtacagga tcgccgacgg ctgtgcccac ctgctgtact ttatcgagta cgctgactgc 300

gaccccaggc agattttcgg caggtgccgg aggaggacca cccctatgtg gtggaccccc 360

tccgccgact acatgttccc caccgaggac gagctgggcc tgctgatggt ggcccctggc 420

aggttcaatg agggccagta caggaggctg gtgtccgtgg acggcgtgaa catcctcacc 480

gacttcatgg tggccctgcc tgagggccag gaatgtcctt tcgcccgggt cgaccagcac 540

cggacctaca agttcggcgc ctgctggtcc gacgactcct tcaagagggg cgtggacgtg 600

atgaggttcc tgaccccctt ctatcagcag cccccccaca gggaggtggt gaactactgg 660

tacaggaaga acggcaggac actgccccgg gcttatgctg ccgccacacc ttacgccatc 720

gaccccgcta ggcccagcgc tggatccccc aggccccgtc cccgtccccg tcctcggccc 780

cgtcctaaac ctgagcctgc ccctgctaca cctgctcccc ctggaaggct gcctgaacct 840

gctacccggg atcacgctgc tggcggaagg cctacaccca ggcctccccg tcctgagacc 900

cctcataggc ctttcgctcc ccctgctgtc gtcccttccg gatggcctca gcctgccgag 960

ccttttcccc ccaggacaac cgccgctcct ggagtctcca ggcataggca tcaccaccat 1020

caccactga 1029

<210> 19

<211> 1440

<212> DNA

<213> avian adenovirus

<400> 19

atgttacgtg ctcctaaacg gcgacatagc gaaaacggtc aaccggaatc ggaagccggc 60

cccagccctg cgccaataaa acgcgccaaa aggatggtac gagcaagcca gctagacctc 120

gtttaccctt ttgactacgt ggctgaccca gttggtggtc tcaacccccc attcctgggc 180

ggctctggtc ctctggtgga tcagggaggc cagttgaccc taaatgttac ggaccctatc 240

ataataaaga atcgctccgt ggacctggca catgacccct ctctagacgt caatgcccag 300

ggacaactag cagttgctgt tgaccctgag ggtgctttgg acatcacacc agatggccta 360

gatgtgaagg tagatggggt caccgtgatg gtgaatgatg actgggaact ggctgtgaag 420

gtggacccca gcggtgggtt ggacagtaca gcagggggcc tgggggtgtc tgtcgatgat 480

actttactcg tggaccaggg cgaactggga gtgcacctga accagcaagg acctatcacc 540

gcagactcca gcgggataga tctagagatc aatcccaaca tgttcaccgt caatacatcc 600

acagggagcg gtgttttaga attaaacctg aaggctcaag gtggcatcca ggctggctct 660

tcgggcgtgg gggttagtgt tgatgaatca cttgaaatcg tgaataatac actagaagtt 720

aagcctgacc cgagtggccc acttactgtg tcagccaacg gacttgggct gaaatatgat 780

tccaacactc tggccgtgac cgccggggcc ttgacggtag tgggcggcgg tagtgtctca 840

actccaattg ccacatttgt gtccggcagt ccctcgctga atacctacaa tgcgactatc 900

gtaaactcct catcccaccc cttctcctgc gcctactacc tccagcagtg gaatgtgcag 960

ggtttattat tcacatcatt atatgtgaaa ctggattcta caacaatggg cacaaggccg 1020

ggggacaaca gcagtgccaa cgccaagtgg tttactttct gggtgtccgc ctatttacaa 1080

cagtgcaacc cttccggtat tcaggccggt actgttagtc catctaccgc ggcgttagcc 1140

gatttcgaac cgatggcgaa ccggagcgta agctccccgt ggacgtactc ggctaacgcg 1200

tattatcaac ctagtagcgg ggagtttcag gttttcacgc ccgtagttac cggcgcatgg 1260

aatccgggca atatcggaat tcgtgtactg cccgtaccgg taactgcatc tggtgatcga 1320

tacacgctac tgtgttattc gttgcaatgt acgaactcgt cgatttttaa cccggcaaat 1380

agcggtacga tgatagttgg gccggttcta tactcgtgtc cggcagcctc tgtaccgtaa 1440

<210> 20

<211> 741

<212> DNA

<213> Eggdrop syndrome-1976 virus

<400> 20

ccgctgtcta tcacctctga cggtgaactg accctggctt acgactctac cgacttccag 60

gttaccgaaa acggtctggc tctgaaagtt tctccgaccc agaccccgct gacccgtatc 120

atctctatgg gtaacaacct gttcgactct ggttacgaaa tcttcgcttc ttgcccgcag 180

aacaaagctg ctaaagttgc tggttacgtt tacctgacct ctgttggtgg tctggttcac 240

ggtaccatcc agatcaaagc taccgctggt tactggttca ccggtggtaa ctctgttcag 300

gaatctatcc gtttcggtct ggttctgtgc ccgttctctg ctcgtgaccc gaccgctaac 360

ctgtctggtt ggccggctcc ggttgtttgg tctggtgact ctaacacccc gctgtacttc 420

gctgctaacg ctatctctta caccaacaac cgtgttaacc tggctgttac cggtaacttc 480

tacaaagaag aaaccgaact gccgggttac acccgtcact ctttctgccc gaccggtacc 540

accggtatga acttcaccgg tggtaacctg tacgtttgcc cgtgcaccgt taacaccggt 600

gctaccaccc tgaacgctat ctacatggtt ttcgttatca cccagtctgc tctgggtacc 660

aacttcttcg cttctaacac cccgccgaac accttcttcc tgaccccgcc gatcccgttc 720

acctacgttg gtgctcagta a 741

<210> 21

<211> 1740

<212> DNA

<213> Rabbit hemorrhagic disease virus

<400> 21

atggaaggca aagcacggac ggccccgcaa ggagaggcag ctgggactgc gacaactgca 60

tcggtccctg gaacaaccac tgatggcatg gatcctggag tcgttgccgc gacgtcagtc 120

gttaccgctg agaacagttc cgcctccgtg gcaacggcgg gcattggcgg tccaccccag 180

caggtcgacc agcaggagac atggagaaca aatttctatt acaatgatgt gttcacctgg 240

tctgtcgcag acgcgccagg tagcatcctt tacacagtgc agcacagccc tcagaacaat 300

cctttcacag ctgtgttgtc gcagatgtat gcaggctggg caggtggtat gcagtttaga 360

tttattgtag ccggaagtgg agtattcgga ggacgattag tggcagcagt tatccccccg 420

ggaattgaga tcggaccggg cctcgaagtg cgtcaattcc cacatgttgt tatcgatgca 480

agatcgttgg aacctgtaac gattactatg ccagacctgc gtccaaatat gtatcatccg 540

acaggagatc caggactagt cccgacattg gttctgagtg tgtacaacaa ccttataaac 600

ccctttggag gttctacgaa cgcgatacaa gtgaccgtgg aaacaagacc tagtgaagac 660

tttgagttcg tgatgatccg agcaccctca tcaaaaaccg tcgacagcat ttctccggct 720

ggacttctca cgacacccgt gctcacgggg gtcggcaacg acaataggtg gaacggccag 780

atcgtgggac tacaaccagt cccgggtggc ttctcgacgt gcaatagaca ctggaacctg 840

aatggctcaa catacggctg gagctcacct aggtttgcag atatagatca ccgccgtggc 900

agtgccagct attctggaaa taattcaact aatgtgctcc agttttggta tgcaaacgcc 960

ggctctgcaa ttgataaccc cattagccaa gttgcacctg atgggtttcc tgacatgtcc 1020

tttgttcctt ttaactcacc gaacatccca acagcaggct gggtgggctt tggcggcatc 1080

tggaatagta acaatggtgc ccctgctgca actactgtcc aagcatatga actgggattc 1140

gccacaggcg ctcccaacaa tctacagcct actacaaaca cttccggcgc tcagaccgtc 1200

gccaagtcta tatatgccgt cgtaactggc accaaccaga atcccacggg gctatttgta 1260

atggcgtcgg gagtcataag cacccccaat gcctcagcag ttacatatac tccacaaccc 1320

gatcgtattg ttaccacccc aggtacacct gctgcagctc cggtgggtaa gaatactcct 1380

atcatgttcg cttctgtcgt aaggagaacg ggtgatgtca atgctgcagc ggggagcacc 1440

aatgggactc agtacggtac tggtagtcag cctttaccag ttaccattgg cctctcgctg 1500

aacaactact cctctgcttt gatgcccggc cagttctttg tgtggcagct cacatttgct 1560

tcgggtttta tggagattgg tctatcggta gatggttatt tttatgccgg tacgggggca 1620

agcacaacat tgatcgatct aaccgagctc atagacgtcc gaccagtcgg tccacgcccg 1680

tcgaaaagta cacttgtttt caacttagga gggacgacaa atggtttcag ctacgtttga 1740

<210> 22

<211> 645

<212> DNA

<213> Porcine circovirus

<400> 22

atgcgtcatc gtgcgatatt tcgtcgacga ccacgaccta ggcgccggcg gcgccatcgt 60

cgccgttacg cgcggcgcaa attatttata cgtagaccga ctgcgggaac gtactacacg 120

aaaaaatatt cgacgatgaa cgtaatctcg gtaggtactc cgcaaaacaa taagccgtgg 180

cacgctaacc attttattac gcggttaaac gaatgggaga ctgcgataac tttcgaatac 240

tacaaaatat taaaaatgaa agtaactcta tctcccgtta tcagtccagc gcaacaaacg 300

aagacgatgt tcgggcatac tgcgatcgat ttggacggag cgtggactac gaatacgtgg 360

ttgcaagacg acccgtacgc cgaatcaagc acacgtaaag taatgacttc gaaaaaaaaa 420

catagccgat attttacgcc aaaaccttta ttggcgggta caacaagcgc gcacccggga 480

caatcgctat tttttttttc acgtccaacc ccgtggttga acacgtacga tccaaccgtt 540

caatggggtg ctttactttg gtcgatatac gtcccggaaa aaactggtat gactgatttt 600

tacggtacga aggaagtatg gatacgttac aaatctgtac tataa 645

Claims

1. A method for constructing a CHO cell expressing a foreign protein, wherein the method comprises: adding a signal peptide sequence at the N end of an exogenous protein sequence; step (2) the foreign protein sequence added with the signal peptide sequence is fused with an Fc sequence to construct an expression plasmid; step (3) transfecting CHO cells with the expression plasmid constructed in the step (2); and (4) harvesting the foreign protein;

wherein the sequence of the signal peptide in the step (1) is shown as SEQ ID. No. 1;

wherein the Fc sequence in the step (2) is shown as SEQ ID. No. 15;

wherein the foreign protein gene in the step (1) is African swine fever virus CD2v protein, and the sequence thereof is shown as SEQ ID. No. 17.

2. A CHO cell expressing a foreign protein constructed by the method of claim 1.

3. A method of expressing a foreign protein, wherein the method uses the CHO cell of claim 2 to express the foreign protein.

4. Use of a CHO cell according to claim 2 or the method according to claim 3 for preparing a foreign protein.